Announcement

Collapse
No announcement yet.

H3n2

Collapse
X
  • Filter
  • Time
  • Show
Clear All
new posts

  • H3n2

    copy of thread 75820 from August 2008


    ---------edit1----------
    see also this paper:
    http://www.pubmedcentral.nih.gov/art...medid=16333111


    2001/2002 was a H1N1-season, not much H3N2 around.

    The H3N2 in 2002 (A/Taiwan/872/2002) was more similar to the
    flu in 1999 (A/Waikato/1/09-08-2000) than to that from 2000 or 2001.
    Then in ~May 2002 a new HA appeared with 12 changes
    (T31C?,C121A,G156T,T273G,C511A,A512C,A516T(C),G648 A,
    G1011A,C1044T,T1149C,C1642T)
    {changes[G439A,T114C,C323A,T400C,]were probably made earlier}
    and reassorted into existing H3N2.
    Most of the mutations are non-synonymous, even many changes
    different from A<-->G,C<-->T, which is normal.
    It may even have come from swine - there are some closely
    related swine-sequences from Hong Kong 2002.
    I'm not aware of other epidemics, which started this way,
    with a sudden new non-avian HA, maybe 1918-panflu did.

    This formed what was called the Fujian-strain, after virus
    A/Fujian/411/11-08-2002(H3N2). The full genome of that virus or
    any other from that strain from 2002 is not yet available,
    even after 6 years ! Such sequences are often withheld for
    political reasons or because someone wants to publish a paper
    exclusively.
    Recently some earlier viruses from that strain were published,
    the earliest available is :
    A/Hong Kong/CUHK24044/01-06-2002(H3N2). [HA,NA,M available]
    Some few of these viruses already appeared in Europe and USA
    in season 2002/3 , e.g. A/NY/485/20-01-2003,
    A/NY/214/23-04-2003 where we have the full genomes available.

    In spring 2003 it was already suspected that this strain
    would become dominant but it was not included in the
    next season's US-vaccine because of technical problems
    to grow it.

    Then the HA of that virus reassorted again and acquired 7 new
    segments from temporary H3N2. The first public such genome is:
    A/Wellington/3/19-05-2003. This virus was dominant in
    Australia,NZ 2003 , USA 2003/4 and AUS,NZ 2004.
    But then it disappeared suddenly and in mid 2004 the old
    strain A/NY/485 became dominant again until now.

    a picture of HA1-differences rooted at A/Beijing/353/89
    http://magictour.free.fr/panflu/32HUG1.GIF

    and here viewed from 1979:
    http://magictour.free.fr/panflu/32HUG3.GIF

    see here the full genomes since 1972:
    http://magictour.free.fr/panflu/h3g2.gif

    diversity of H3N2s:
    http://magictour.free.fr/panflu/h3anche2.gif
    http://magictour.free.fr/panflu/h3dif2.gif

    picture with 1067 H3N2 genomes 1999-2007:
    http://magictour.free.fr/panflu/geno32k.GIF

    mutual differences in the 8 segments of selected H3N2-virusesin 0/00)
    http://magictour.free.fr/panflu/fujian.l6

    see also this thread:
    http://www.setbb.com/fluwiki2/viewto...forum=fluwiki2


    ------------edit 2--------------
    see here how Panama (o) was replaced by Fujian (.) in Asia,Oceania in 2002:
    Code:
    ooooooooooooooooooooo.oo..ooooo.o.oo.oo....oo....o...o..o.........................
    the first (.) is on June 1st, so within 5-6 months all Pananma was replaced in Asia.
    Apparantly not only did Fujian spread very well, but it also killed Pananma.
    We regularly see this elimination in pandemics.
    How would one flu strain kill another one ? It can't be that the viruses
    meet each other so it must be human immunity. People infected by
    Fujian (apparantly there were a lot, despite some immunity from Panama)
    induced some immunity which didn't let Panama enter later.
    Maybe Fujian induced more immunity against Panama than vice versa ?
    Also astonishing that this process is so fast with only a fraction of the population infected
    but a large proportion of the superspreaders must have been involved

    -----------------------------------------------------

    2000/1 was the H1N1-season in USA.
    2001/2 as well as 2001 and 2002 in NZ was H3N2 with
    a 56-reassortment of old viruses from 1998/9

    Then the first Fujian variant appeared in June 2002
    with an old virus from ~1999, different to the one
    from 2001-2
    Then in ~May 2003 it reassorted with 7 of the 2001-2 segments
    keeping only its HA

    -------------------------------------

    the closest virus to the first 2002-Fujian virus is a swine virus !
    Several papers demonstrated that swine are frequently infected
    from human epidemics, maybe the 2002-Fujian-semi-pandemic
    started in Swine !
    Maybe seasonal flu starts each year from swine in China ?!?

    ---------edit 2013/05/01-------------
    now we have a new virus from Taiwan,March 2002 which already
    had the Fujian mutations in HA. It has a different NA
    A/Taiwan/92/2002/03/17 (H3N2)
    and a paper:
    http://www.plosone.org/article/info&#37;...l.pone.0061957
    I'm interested in expert panflu damage estimates
    my current links: [url]http://bit.ly/hFI7H[/url] ILI-charts: [url]http://bit.ly/CcRgT[/url]

  • #2
    Re: H3n2

    in mid 2002 (China?) in H3N2 suddenly ~10 mutations happened in HA,
    no apparant reassortment, the other segments were not much changed.
    This virus was then very successful and replaced all other human H3N2
    until now.
    In 2003 it reasorted, got the 7 segments except HA from an older H3N2
    and caused a severe season in USA, starting in November.
    Then this reassorted thing disappeared and was replaced by a descendent
    of the 2002-virus again.
    In 2006/7 only one special strain survived (was detected, that is)
    which is the ancestor of all(?) human H3N2 since then


    my reconstruction of that 2002 "Fujian" virus
    Code:
    >A/Index_Fujian/2002(H3N2)
    ATGGAAAGAATAAAAGAACTACGGAACCTGATGTCGCAGTCTCGCACTCGCGAGATACTGACAAAAACCACAGTGGACCATATGGCCATAATTAAGAAGTACACATCGGGGAGACAGGAAAAGAACCCGTCACTTAGGATGAAATGGATGATGGCAATGAAATACCCAATCACTGCTGACAAAAGGATAACAGAAATGGTTCCGGAGAGAAATGAACAAGGACAAACTCTATGGAGTAAAATGAGTGATGCTGGATCAGATCGAGTGATGGTATCACCTTTGGCTGTGACATGGTGGAATAGAAATGGACCCGTGACAAGTACGGTCCATTACCCAAAAGTATACAAGACTTATTTTGACAAAGTCGAAAGGTTAAAACATGGAACCTTTGGCCCTGTTCATTTTAGAAATCAAGTCAAGATACGCCGAAGAGTAGACATAAACCCTGGTCATGCAGACCTCAGTGCCAAGGAGGCACAAGATGTAATTATGGAAGTTGTTTTTCCCAATGAAGTGGGAGCCAGGATACTAACATCAGAATCGCAATTAACAATAACTAAAGAGAAAAAAGAAGAACTCCGAGATTGCAAAATTTCTCCCTTGATGGTTGCATACATGTTAGAGAGAGAACTTGTCCGAAAAACAAGATTTCTCCCAGTTGCTGGCGGAACAAGCAGTATATACATTGAAGTTTTACATTTGACTCAAGGAACGTGTTGGGAACAAATGTACACTCCAGGTGGAGAAGTGAGGAATGACGATGTTGACCAAAGCCTAATTATTGCAGCCAGGAACATAGTAAGAAGAGCCGCAGTATCAGCAGATCCACTAGCATCTTTATTGGAGATGTGCCACAGCACACAAATTGGCGGGACAAGGATGGTGGACATTCTTAGACAGAACCCGACTGAAGAACAAGCTGTGGATATATGCAAGGCTGCAATGGGATTGAGAATCAGCTCATCCTTCAGCTTTGGTGGGTTTACATTTAAAAGAACAAGCGGGTCATCAGTCAAAAAAGAGGAAGAAGTGCTTACAGGCAATCTCCAAACATTGAAGATAAGAGTACATGAGGGGTATGAGGAGTTCACAATGGTGGGGAAAAGAGCAACAGCTATACTCAGAAAAGCAACCAGAAGATTGGTTCAGCTCATAGTGAGTGGAAGAGACGAACAGTCAATAGCCGAAGCAATAATTGTGGCCATGGTGTTTTCACAAGAGGATTGCATGATAAAAGCAGTTAGAGGTGACCTGAATTTCGTCAACAGAGCAAATCAGCGGTTGAACCCCATGCATCAGCTTTTAAGGCATTTTCAGAAAGATGCGAAAGTGCTTTTTCAGAATTGGGGAATTGAACACATCGACAGTGTGATGGGAATGGTTGGAGTATTACCAGATATGACTCCAAGCACAGAGATGTCAATGAGAGGAATAAGAGTCAGCAAAATGGGTGTGGATGAATACTCCAGTACAGAGAGGGTGGTGGTTAGCATTGATCGGTTTTTGAGAGTTCGAGACCAACGCGGGAATGTATTATTATCTCCTGAGGAGGTCAGTGAAACACAGGGAACTGAGAGACTGACAATAACTTATTCATCGTCGATGATGTGGGAGATTAACGGTCCTGAGTCGGTTTTGGTCAATACCTATCAATGGATCATCAGAAATTGGGAAGCTGTCAAAATTCAATGGTCTCAGAATCCTGCAATGTTGTACAACAAAATGGAATTTGAACCATTTCAATCTTTAGTCCCCAAGGCCATTAGAAGCCAATACAGTGGGTTTGTCAGAACTCTATTCCAACAAATGAGAGACGTACTTGGGACATTTGACACCACCCAGATAATAAAGCTTCTCCCTTTTGCAGCCGCTCCACCAAAGCAAAGCAGAATGCAGTTCTCTTCACTGACTGTAAATGTGAGGGGATCAGGGATGAGAATACTTGTAAGGGGCAATTCTCCTGTATTCAACTACAACAAGACCACTAAAAGACTAACAATTCTCGGAAAAGATGCCGGCACTTTAATTGAAGACCCAGATGAAAGCACATCCGGAGTGGAGTCCGCCGTATTGAGAGGGTTTCTCATTATAGGTAAGGAAGACAGAAGATACGGGCCAGCATTAAGCATCAATGAACTGAGTAACCTTGCAAAAGGGGAAAAGGCTAATGTGCTAATCGGGCAAGGAGACGTGGTGTTGGTAATGAAACGAAAACGGGACTCTAGCATACTTACTGACAGCCAGACAGCGACCAAAAGAATTCGGATGGCCATCAATTAA
    ATGGATGTCAATCCGACTCTACTGTTCCTAAAGGTTCCAGCGCAAAATGCCATAAGCACCACATTCCCTTATACTGGAGATCCTCCATACAGCCATGGAACAGGAACAGGGTACACCATGGACACAGTCAACAGAACACACCAATATTCAGAGAAGGGGAAGTGGACGACAAATACAGAAACTGGGGCACCCCAACTCAACCCAATTGATGGACCACTACCTGAGGATAATGAGCCAAGTGGATATGCACAAACAGACTGTGTCCTGGAGGCTATGGCCTTCCTTGAAGAATCCCACCCAGGTATCTTTGAGAACTCATGCCTTGAAACAATGGAAGTCGTTCAACAAACAAGGGTGGACAAACTAACCCAAGGTCGCCAGACTTATGATTGGACATTAAACAGAAATCAACCGGCAGCAACTGCATTAGCCAACACCATAGAAGTTTTTAGATCGAATGGACTAACAGCTAATGAATCAGGAAGGCTAATAGATTTCCTCAAGGATGTGATGGAATCAATGGATAAAGAGGAAATGGAGATAACAACACACTTTCAAAGAAAAAGGAGAGTAAGAGACAACATGACCAAGAAAATGGTCACACAAAGAACAATAGGGAAGAAAAAACAAAGAGTGAATAAGAGAGGCTATCTAATAAGAGCTTTGACATTGAACACGATGACCAAAGATGCAGAGAGAGGTAAATTAAAAAGAAGGGCTATTGCAACACCCGGGATGCAAATTAGAGGGTTCGTGTACTTCGTTGAAACTTTAGCTAGAAGCATTTGCGAAAAGCTTGAACAGTCTGGACTTCCGGTTGGGGGTAATGAAAAGAAGGCCAAACTGGCAAATGTTGTGAGAAAAATGATGACTAATTCACAAGACACAGAGCTTTCTTTCACAATCACTGGGGACAACACTAAGTGGAATGAAAATCAAAACCCTCGAATGTTTTTGGCGATGATTACATATATCACAAAAAATCAACCTGAGTGGTTCAGAAACATCCTGAGCATCGCACCAATAATGTTCTCAAACAAAATGGCAAGACTGGGAAAAGGATACATGTTCGAGAGTAAGAGAATGAAGCTCCGAACACAAATACCCGCAGAAATGCTAGCAAGCATTGACCTGAAGTATTTCAATGAATCAACAAGGAAGAAAATTGAGAAAATAAGGCCTCTTCTAATAGATGGCACAGCATCATTGAGCCCTGGGATGATGATGGGCATGTTCAACATGCTAAGTACGGTTTTAGGAGTCTCGATACTGAATCTTGGGCAAAAGAAATACACCAAGACAACATACTGGTGGGATGGGCTCCAATCCTCCGACGATTTTGCCCTCATAGTGAATGCACCAAATCATGAGGGAATACAAGCAGGAGTGGATAGATTCTACAGGACCTGCAAGTTAGTGGGAATCAACATGAGCAAAAAGAAGTCCTATATAAATAAAACAGGGACATTTGAATTCACAAGCTTTTTTTATCGATATGGATTTGTGGCTAATTTTAGCATGGAGCTGCCCAGTTTTGGAGTGTCTGGAATAAACGAGTCAGCTGATATGAGCATTGGAGTAACAGTGATAAAGAACAACATGATAAACAATGACCTTGGACCAGCAACAGCCCAGATGGCTCTCCAATTGTTCATCAAAGACTACAGATATACATATAGGTGCCATAGAGGAGACACACAAATTCAGACGAGAAGATCATTCGAGCTAAAGAAGCTGTGGGATCAAACCCAATCAAGGGCAGGACTATTGGTATCAGATGGGGGACCAAACTTATACAATATCCGGAATCTTCACATCCCTGAAGTCTGCTTAAAGTGGGAGCTAATGGATGAGAATTATCGGGGAAGACTTTGTAATCCCCTGAATCCCTTTGTCAGCCATAAAGAAATTGAGTCTGTAAACAATGCTGTAGTGATGCCAGCCCATGGTCCGGCCAAAAGTATGGAATATGATGCCGTTGCAACTACACACTCCTGGATTCCCAAGAGGAACCGCTCTATTCTCAACACAAGCCAAAGGGGAATTCTTGAGGATGAACAGATGTACCAGAAGTGCTGCAACTTGTTCGAGAAATTTTTCCCTAGTAGTTCATATAGGAGACCGATTGGAATTTCTAGCATGGTGGAGGCCATGGTGTCTAGGGCCCGGATTGATGCCAGAATTGACTTCGAGTCTGGACGGATTAAGAAGGAAGAGTTCTCTGAGATCATGAAGATCTGTTCCACCATTGAAGAACTCAGACGGCAAAAATAA
    ATGGAAGATTTTGTGCGACAATGCTTCAACCCGATGATTGTCGAACTTGCAGAAAAAGCAATGAAAGAGTATGGGGAGGATCTGAAAATTGAAACAAACAAATTTGCAGCAATATGCACTCACTTGGAGGTATGTTTCATGTATTCAGATTTTCATTTCATCAATGAACAAGGCGAATCAATAGTGGTAGAACTTGATGATCCAAATGCACTGTTAAAGCACAGATTTGAAATAATCGAGGGGAGAGACAGAACAATGGCCTGGACAGTAGTAAACAGTATCTGCAACACTACTGGAGCTGAAAAACCGAAGTTTCTACCAGATTTGTATGATTACAAGGAGAACAGATTCATCGAAATTGGAGTGACAAGGAGAGAAGTCCACATATATTACCTTGAAAAGGCCAATAAGATTAAATCTGAGAACACACACATTCACATTTTCTCATTCACTGGGGAGGAAATGGCCACAAAGGCAGACTACACTCTCGACGAGGAAAGCAGGGCTAGGATTAAGACCAGGCTATTTACCATAAGACAAGAAATGGCCAACAGAGGCCTCTGGGATTCCTTTCGTCAGTCCGAAAGAGGCGAAGAAACAATTGAAGAAAAATTTGAAATCTCAGGAACTATGCGTAGGCTTGCCGACCAAAGTCTCCCACCGAACTTCTCCTGCCTTGAGAATTTTAGAGCCTATGTGGATGGATTCGAACCGAACGGCTGCATTGAGGGCAAGCTTTCTCAAATGTCCAAAGAAGTGAATGCCAAAATTGAACCTTTTCTGAAGACAACACCAAGACCAATCAAACTTCCGAATGGACCTCCTTGTTATCAGCGGTCCAAATTCCTCCTGATGGATGCTTTAAAATTGAGCATTGAAGACCCAAGTCACGAAGGAGAAGGGATCCCATTATATGATGCGATCAAGTGCATAAAAACATTCTTTGGATGGAAAGAACCTTATATAGTCAAACCACACGAAAAGGGAATAAATTCAAATTACCTGCTGTCATGGAAGCAAGTATTGTCAGAATTGCAGGACATTGAAAATGAGGAGAAGATTCCAAGGACTAAAAACATGAAGAAAACGAGTCAACTAAAGTGGGCTCTTGGTGAAAACATGGCACCAGAGAAAGTAGACTTTGAAAACTGCAGAGACATAAGCGATTTGAAGCAATATGATAGTGACGAACCTGAATTAAGGTCACTTTCAAGCTGGATACAGAATGAGTTCAACAAGGCCTGCGAGCTAACTGATTCAATCTGGATAGAGCTCGATGAAATTGGAGAGGACGTAGCCCCAATTGAGTACATTGCAAGCATGAGGAGGAATTATTTCACAGCAGAGGTGTCCCATTGTAGAGCCACTGAGTACATAATGAAGGGGGTATACATTAATACTGCCCTGCTCAATGCATCCTGTGCAGCAATGGACGATTTTCAACTAATTCCCATGATAAGCAAGTGCAGAACTAAAGAGGGAAGGCGAAAAACCAATTTATATGGATTCATCATAAAGGGAAGATCTCATTTAAGGAATGACACAGATGTGGTAAACTTTGTGAGCATGGAGTTTTCTCTCACTGACCCGAGACTTGAGCCACATAAATGGGAGAAATACTGTGTCCTTGAGATAGGAGATATGTTACTAAGAAGTGCCATAGGCCAAATTTCAAGGCCTATGTTCTTGTATGTGAGGACAAACGGAACATCAAAGGTCAAAATGAAATGGGGAATGGAGATGAGACGTTGCCTCCTTCAGTCACTCCAGCAGATCGAGAGCATGATTGAAGCCGAGTCCTCGGTTAAAGAGAAAGACATGACCAAAGAGTTTTTTGAGAATAAATCAGAAGCATGGCCCATTGGGGAGTCCCCCAAGGGAGTGGAAGAAGGTTCCATTGGGAAAGTCTGTAGGACTCTATTGGCTAAGTCAGTGTTCAATAGCCTGTATGCATCACCACAATTGGAAGGATTTTCAGCGGAGTCAAGAAAACTGCTCCTTGTTGTTCAGGCTCTTAGGGACAACCTCGAACCTGGGACCTTTGATCTTGGGGGGCTATATGAAGCAATTGAGGAGTGCCTGATTAATGATCCCTGGGTTTTGCTCAATGCGTCTTGGTTCAACTCCTTCCTGACACATGCATTAAAATAG
    ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCAAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTGGAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGCAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAGAATGGAACAAGCTCTGCTTGCAAAAGGAGATCTAATAAAAGTTTCTTTAGTAGATTGAATTGGTTGACCCAATTAAAATACAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAAAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAGTGACCAAATCAGCCTATATGCTCAAGCATCAGGAAGAATCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGATCTAGACCCAGGGTAAGGGATGTCTCCAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTTCAAAATGTAAACAGGATCACATATGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATCGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGACGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGCACAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCAACCAAATCAATGGGAAACTGAATAGGTTAATCGGGAAAACAAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAGAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATTTGA
    ATGGCGTCCCAAGGCACCAAACGGTCTTATGAACAGATGGAAACTGATGGGGATCGCCAGAATGCAACTGAGATTAGGGCATCCGTCGGGAAGATGATTGATGGAATTGGGAGATTCTACATCCAAATGTGCACTGAACTTAAACTCAGTGATTATGAAGGGCGGTTGATCCAGAACAGCTTGACAATAGAGAAAATGGTGCTCTCTGCTTTTGATGAAAGAAGGAATAAATATCTGGAAGAACACCCCAGCGCGGGGAAAGATCCTAAGAAAACTGGGGGGCCCATATACAGGAGAGTAGATGGAAAATGGATGAGGGAACTCGTCCTTTATGACAAAGAAGAAATAAGGCGAATCTGGCGCCAAGCCAACAATGGTGAGGATGCGACAGCTGGTCTAACTCACATAATGATCTGGCATTCCAATTTGAATGATGCAACATACCAGAGGACAAGAGCTCTTGTTCGAACCGGAATGGATCCCAGAATGTGCTCTCTGATGCAGGGCTCGACTCTCCCTAGAAGGTCCGGAGCTGCAGGTGCTGCAGTCAAAGGAATCGGGACAATGGTGATGGAGCTGATCAGAATGGTCAAACGGGGGATCAACGATCGAAATTTCTGGAGAGGTGAGAATGGGCGGAAAACAAGAAGTGCTTATGAGAGAATGTGCAACATTCTTAAAGGAAAATTTCAAACAGCTGCACAAAGAGCAATGGTGGATCAAGTGAGAGAAAGTCGGAACCCAGGAAATGCTGAGATCGAAGATCTCATATTTTTGGCAAGATCTGCATTGATATTGAGAGGGTCAGTTGCTCACAAATCTTGCCTACCTGCCTGTGTGTATGGACCTGCAGTATCCAGTGGGTACGACTTCGAAAAAGAGGGATATTCCTTGGTGGGAATAGACCCTTTCAAACTACTTCAAAATAGCCAAGTATACAGCCTAATCAGACCTAACGAGAATCCAGCACACAAGAGTCAGCTGGTGTGGATGGCATGCCATTCTGCTGCATTTGAAGATTTAAGATTGTTAAGCTTCATCAGAGGGACAAAAGTATCTCCGCGAGGGAAACTTTCAACTAGAGGAGTACAAATTGCTTCAAATGAGAACATGGATAATATGGGATCGAGCACTCTTGAACTGAGAAGCGGGTACTGGGCCATAAGGACCAGGAGTGGAGGAAACACTAATCAACAGAGGGCCTCCGCAGGCCAAACCAGTGTGCAACCTACGTTTTCTGTACAAAGAAACCTCCCATTTGAAAAGTCAACCATCATGGCAGCATTCACTGGAAATACGGAGGGAAGAACTTCAGACATGAGGGCAGAAATCATAAGAATGATGGAAGGTGCAAAACCAGAAGAAGTGTCGTTCCGGGGGAGGGGAGTTTTCGAGCTCTCAGACGAGAAGGCAACGAACCCGATCGTGCCCTCTTTTGATATGAGTAATGAAGGATCTTATTTCTTCGGAGACAATGCAGAAGAGTACGACAATTAA
    ATGAATCCAAATCAAAAGATAATAACGATTGGCTCTGTTTCTCTCACCATTTCCACAATATGCTTCTTCATGCAAATTGCCATCCTGATAACTACTGTAACATTGCATTTCAAGCAATATGAATTCAACTCCCCCCCAAACAACCAAGTGATGCTGTGTGAACCAACAATAATAGAAAGAAACATAACAGAGATAGTGTATCTGACCAACACCACCATAGAGAAGGAAATATGCCCCAAACTAGCAGAATACAGAAATTGGTCAAAGCCGCAATGTAACATTACAGGATTTGCACCTTTTTCTAAGGACAATTCGATTCGGCTTTCCGCTGGTGGGGACATCTGGGTGACAAGAGAACCTTATGTGTCATGCGATCCTGACAAGTGTTATCAATTTGCCCTTGGACAGGGAACAACACTAAACAACGTGCATTCAAATGACACAGTACATGATAGGACCCCTTATCGGACCCTATTGATGAATGAGTTGGGTGTTCCATTTCATCTGGGGACCAAGCAAGTGTGCATAGCATGGTCCAGCTCAAGTTGTCACGATGGAAAAGCATGGCTGCATGTTTGTGTAACGGGGGATGATGAAAATGCAACTGCTAGCTTCATTTACAATGGGAGGCTTGTAGATAGTATTGTTTCATGGTCCAAAAAAATCCTCAGGACCCAGGAGTCAGAATGCGTTTGTATCAATGGAACTTGTACAGTAGTAATGACTGATGGGAGTGCTTCAGGAAAAGCTGATACTAAAATACTATTCATTGAGGAGGGGAAAATCGTTCATACTAGCACATTGTCAGGAAGTGCTCAGCATGTCGAGGAGTGCTCCTGTTATCCTCGATATCCTGGTGTCAGATGTGTCTGCAGAGACAACTGGAAAGGCTCCAATAGGCCCATCGTAGATATAAACATAAAGGATTATAGCATTGTTTCCAGTTATGTGTGCTCAGGACTTGTTGGAGACACACCCAGAAAAAACGACAGCTCCAGCAGTAGCCATTGCTTGGATCCAAACAATGAGGAAGGTGGTCATGGAGTGAAAGGCTGGGCCTTTGATGATGGAAATGACGTGTGGATGGGAAGAACGATCAGCGAGAAGTTACGCTCAGGATATGAAACCTTCAAAGTCATTGAAGGCTGGTCCAACCCTAACTCCAAATTGCAGATAAATAGGCAAGTCATAGTTGACAGAGGTAATAGGTCCGGTTATTCTGGTATTTTCTCTGTTGAAGGCAAAAGCTGCATCAATCGGTGCTTTTATGTGGAGTTGATAAGGGGAAGAAAACAGGAAACTGAAGTCTTGTGGACCTCAAACAGTATTGTTGTGTTTTGTGGCACCTCAGGTACATATGGAACAGGCTCATGGCCTGATGGGGCGGACATCAATCTCATGCCTATATAA
    ATGAGCCTTCTAACCGAGGTCGAAACGTATGTTCTCTCTATCGTTCCATCAGGCCCCCTCAAAGCCGAGATCGCGCAGAGACTTGAAGATGTCTTTGCTGGGAAAAACACAGATCTTGAGGCTCTCATGGAATGGCTAAAGACAAGACCAATTCTGTCACCTCTGACTAAGGGGATTTTGGGGTTTGTGTTCACGCTCACCGTGCCCAGTGAGCGAGGACTGCAGCGTAGACGCTTTGTCCAAAATGCCCTCAATGGGAATGGAGATCCAAATAACATGGACAAAGCAGTTAAACTGTATAGGAAACTTAAGAGGGAGATAACGTTCCATGGGGCCAAAGAAATAGCTCTCAGTTATTCTGCTGGTGCACTTGCCAGTTGCATGGGCCTCATATACAATAGGATGGGGGCTGTAACCACTGAAGTGGCATTTGGCCTGGTATGTGCAACATGTGAGCAGATTGCTGACTCCCAGCACAGGTCTCATAGGCAAATGGTGGCAACAACCAATCCATTAATAAGACATGAGAACAGAATGGTTTTGGCCAGCACTACAGCTAAGGCTATGGAGCAAATGGCTGGATCAAGTGAGCAGGCAGCGGAGGCCATGGAGATTGCTAGTCAGGCCAGGCAAATGGTGCAGGCAATGAGAGCCATTGGGACTCATCCTAGCTCCAGTACTGGTCTAAGAGATGATCTTCTTGAAAATTTGCAGACCTATCAGAAACGAATGGGGGTGCAGATGCAACGATTCAAGTGACCCGCTTGTTGTTGCCGCGAGTATCATTGGGATCTTGCACTTGATATTGTGGATTCTTGATCGTCTTTTTTTCAAATGCGTCTATCGACTCTTCAAACACGGCCTTAAAAGAGGCCCTTCTACGGAAGGAGTACCTGAGTCTATGAGGGAAGAATATCGAAAGGAACAGCAGAATGCTGTGGATGCTGACGACAGTCATTTTGTCAGCATAGAGTTGGAGTAA
    ATGGATTCCAACACTGTGTCAAGTTTCCAGGTAGATTGCTTTCTTTGGCATATCCGGAAACAAGTTGTAGACCAAGAACTGAGTGATGCCCCATTCCTTGATCGGCTTCGCCGAGATCAGAGGTCCCTAAGGGGAAGAGGCAATACTCTCGGTCTAGACATCAAAGCAGCCACCCATGTTGGAAAGCAAATTGTAGAAAAGATTCTGAAAGAAGAATCTGATGAGGCACTTAAAATGACCATGGTCTCCACACCTGCTTCGCGATACATAACTGACATGACTATTGAGGAATTGTCAAGAAACTGGTTCATGCTAATGCCCAAGCAGAAAGTGGAAGGACCTCTTTGCATCAGAATGGACCAGGCAATCATGGAGAAAAACATCATGTTGAAAGCGAATTTCAGTGTGATTTTTGACCGACTAGAGACCATAGTATTACTAAGGGCTTTCACCGAAGAGGGAGCAATTGTTGGCGAAATCTCACCATTGCCTTCTTTTCCAGGACATACTATTGAGGATGTCAAAAATGCAATTGGGGTCCTCATCGGAGGACTTGAATGGAATGATAACACAGTTCGAGTCTCTAAAAATCTACAGAGATTCGCTTGGAGAAGCAGTAATGAGAATGGGGGACCTCCACTTACTCCAAAACAGAAACGGAAAATGGCGAGAACAGCTAGGTCAAAAGTTTGAAGAGATAAGATGGCTGATTGAAGAAGTGAGACACAGACTAAAAACAACTGAAAATAGCTTTGAACAAATAACATTCATGCAAGCATTACAACTGCTGTTTGAAGTGGAACAGGAGATAAGAACTTTCTCATTTCAGCTTATTTAA

    and of the 2007-ancestor virus:
    Code:
    >Index/USA-2007(H3N2)
    ATGGAAAGAATAAAAGAACTACGGAATCTGATGTCGCAGTCTCGCACTCGCGAGATACTGACAAAAACCACAGTGGACCATATGGCCATAATTAAGAAGTACACATCGGGGAGACAGGAAAAGAACCCGTCACTTAGGATGAAATGGATGATGGCAATGAAATACCCAATCACTGCTGACAAAAGGATAACAGAAATGGTTCCGGAGAGAAATGAACAAGGACAAACTCTATGGAGTAAAATGAGTGATGCTGGATCAGATAGAGTGATGGTATCACCTTTGGCTGTAACATGGTGGAATAGAAATGGACCCGTGACAAGTACGGTCCATTACCCAAAAGTGTACAAGACTTATTTCGACAAAGTCGAAAGGTTAAAACATGGAACCTTTGGCCCTGTTCATTTTAGAAATCAAGTCAAGATACGCAGAAGAGTAGACATAAACCCTGGTCATGCAGACCTCAGTGCCAAAGAGGCACAAGATGTAATTATGGAAGTTGTTTTTCCCAATGAAGTGGGAGCCAGGATACTAACATCAGAATCACAATTAACAATAACTAAAGAGAAAAAAGAAGAACTCCGAGATTGCAAAATTTCTCCCTTGATGGTTGCATACATGTTAGAGAGAGAACTTGTACGAAAAACAAGATTTCTCCCAGTTGCTGGCGGAACAAGCAGTATATACATTGAAGTTTTACATTTGACTCAAGGAACGTGTTGGGAACAAATGTACACTCCAGGTGGAGGAGTGAGGAATGACGATGTTGACCAAAGCCTAATTATTGCGGCCAGGAACATAGTAAGAAGAGCCGCAGTATCAGCAGATCCACTAGCATCTTTATTGGAGATGTGCCACAGCACACAAATTGGCGGGACAAGGATGGTGGACATTCTTAGACAGAACCCGACTGAAGAACAAGCTGTGGATATATGCAAGGCTGCAATGGGATTGAGAATCAGCTCATCCTTCAGCTTTGGTGGGTTTACATTTAAAAGAACAAGCGGGTCATCAGTCAAAAAAGAAGAAGAGGTGCTTACAGGCAATCTCCAAACATTGAAAATAAGAGTACATGAGGGGTATGAGGAGTTCACAATGGTGGGGAAAAGAGCAACAGCTATACTAAGAAAAGCAACCAGAAGATTGGTTCAGCTCATAGTGAGTGGAAGAGACGAACAGTCAATAGCCGAAGCAATAATCGTGGCCATGGTGTTTTCACAAGAGGATTGCATGATAAAAGCAGTTAGAGGTGACCTGAATTTCGTCAACAGAGCAAATCAGCGGTTGAACCCCATGCATCAGCTTTTAAGGCATTTTCAGAAAGATGCGAAAGTGCTTTTTCAAAATTGGGGAGTTGAACACATCGACAGTGTGATGGGAATGATTGGAGTATTACCAGATATGACTCCAAGCACAGAGATGTCAATGAGAGGAATAAGAGTCAGCAAAATGGGTGTGGATGAATACTCCAGTACAGAGAGGGTGGTGGTTAGCATTGATCGGTTTTTGAGAGTTCGAGACCAACGTGGGAATGTATTATTATCTCCTGAGGAGGTCAGTGAAACACAGGGAACTGAGAGACTGACAATAACTTATTCATCGTCGATGATGTGGGAGATTAACGGTCCTGAGTCGGTTTTGGTCAATACCTATCAATGGATCATCAGAAATTGGGAAGCTGTCAAAATTCAATGGTCTCAGAATCCTGCAATGTTGTACAACAAAATGGAATTTGAACCATTTCAATCTTTAGTCCCCAAGGCCATTAGAAGCCAATACAGTGGGTTTGTCAGAACTCTATTCCAACAAATGAGAGACGTACTTGGGACATTTGACACCACCCAGATAATAAAGCTTCTCCCTTTTGCAGCTGCTCCACCAAAGCAAAGCAGAATGCAGTTCTCTTCACTGACTGTGAATGTGAGGGGATCAGGGATGAGAATACTTGTAAGGGGCAATTCTCCTGTATTCAACTACAACAAGACCACTAAAAGACTAACAATTCTCGGAAAAGATGCCGGCACTTTAATTGAAGACCCAGATGAAAGCACATCCGGAGTGGAGTCCGCCGTCTTGAGAGGGTTTCTCATTATAGGTAAGGAAGACAGAAGATACGGACCAGCATTAAGCATCAATGAACTGAGTAACCTTGCAAAAGGGGAAAAGGCTAATGTGCTAATCGGGCAAGGAGACGTGGTGTTGGTAATGAAACGAAAACGGGACTCTAGCATACTTACTGACAGCCAGACAGCGACCAAAAGAATTCGGATGGCCATCAATTAA
    ATGGATGTCAATCCGACTCTACTGTTCCTAAAGGTTCCAGCGCAAAATGCCATAAGCACAACATTCCCTTATACTGGAGATCCTCCATACAGCCATGGAACAGGAACAGGGTACACCATGGACACAGTCAACAGAACACACCAATATTCAGAGAAGGGGAAGTGGACGACAAATACAGAAACTGGGGCACCCCAACTCAACCCAATTGATGGACCACTACCTGAGGATAATGAACCAAGTGGATATGCACAAACAGACTGTGTCCTGGAGGCTATGGCCTTCCTTGAAGAATCCCACCCAGGTATCTTTGAGAACTCATGCCTTGAAACAATGGAAGCCGTTCAACAGACAAGGGTGGACAAACTAACCCAAGGTCGCCAGACTTATGATTGGACATTAAACAGAAATCAACCGGCAGCAACTGCATTAGCCAACACCATAGAAGTTTTTAGATCGAACGGATTAACAGCTAATGAATCAGGAAGGCTAATAGATTTCCTCAAGGATGTGATGGAATCAATGGATAAAGAGGAAATGGAGATAACAACACACTTTCAAAGAAAAAGGAGAGTAAGGGACAACATGACCAAGAAAATGGTCACACAAAGAACAATAGGGAAGAAAAAACAAAGAGTGAATAAGAGAGGCTACCTAATAAGAGCTTTGACATTGAACACGATGACCAAAGATGCAGAGAGAGGCAAATTAAAAAGAAGGGCTATTGCAACACCCGGGATGCAAATTAGAGGGTTCGTGTACTTCGTTGAAACTTTAGCTAGAAGCATTTGCGAAAAGCTTGAACAGTCTGGACTTCCGGTTGGGGGTAATGAAAAGAAGGCCAAACTGGCAAATGTTGTGAGAAAAATGATGACTAATTCACAAGACACAGAGCTTTCTTTCACAATCACTGGGGACAACACTAAGTGGAATGAAAATCAAAACCCTCGAATGTTTTTGGCGATGATTACATACATCACAAAAAATCAACCTGAGTGGTTCAGAAACATCCTGAGCATCGCACCAATAATGTTCTCAAACAAAATGGCAAGACTGGGAAAAGGATACATGTTCGAGAGTAAGAGAATGAAGCTCCGGACACAAATACCTGCAGAAATGCTAGCAAGCATTGACCTGAAGTATTTCAATGAATCAACAAGGAAGAAAATTGAGAAAATAAGGCCTCTTCTAATAGATGGCACAGCATCATTGAGCCCTGGAATGATGATGGGCATGTTCAACATGCTAAGTACGGTTTTAGGAGTCTCGATACTGAATCTTGGACAAAAGAAATACACCAAGACAACATACTGGTGGGATGGGCTCCAATCCTCCGACGATTTTGCCCTCATAGTGAATGCACCAAATCATGAGGGAATACAAGCAGGAGTGGATAGATTCTACAGGACCTGCAAGTTAGTGGGAATCAACATGAGCAAAAAGAAGTCCTATATAAATAAAACAGGGACATTTGAATTCACTAGCTTTTTTTATCGATATGGATTTGTGGCTAATTTTAGCATGGAGCTGCCCAGTTTTGGAGTGTCTGGAATAAACGAGTCAGCTGATATGAGCATTGGAGTAACAGTGATAAAGAACAACATGATAAACAATGACCTTGGACCAGCAACAGCCCAAATGGCTCTCCAATTGTTCATCAAAGATTACAGATACACATATAGGTGCCATAGAGGAGACACACAAATCCAGACGAGAAGATCATTCGAGCTAAAGAAGCTGTGGGATCAAACCCAATCAAGGGCAGGACTATTGGTATCAGATGGGGGACCAAACTTATACAATATCCGGAATCTTCACATCCCTGAAGTCTGCTTAAAGTGGGAGCTGATGGATGAGAATTATCGGGGAAGACTTTGTAATCCCCTGAATCCCTTTGTCAGCCATAAAGAAATTGAGTCTGTAAACAATGCTGTAGTAATGCCAGCCCATGGTCCGGCCAAAAGTATGGAATATGATGCCGTTGCAACTACACACTCCTGGATTCCCAAGAGGAACCGCTCTATTCTAAACACAAGCCAAAGGGGAATTCTTGAGGATGAACAGATGTACCAGAAGTGCTGCAACTTGTTCGAGAAATTTTTCCCTAGTAGTTCATATAGGAGACCGATTGGAATTTCTAGCATGGTGGAGGCCATGGTGTCTAGGGCCCGGATTGATGCCAGAATTGACTTCGAGTCTGGACGGATTAAGAAGGAAGAGTTCTCTGAGATCATGAAGATCTGTTCCACCATTGAAGAACTCAGACGGCAAAAATAA
    ATGGAAGATTTTGTGCGACAATGCTTCAACCCGATGATTGTCGAACTTGCAGAAAAAGCAATGAAAGAGTATGGGGAGGATCTGAAAATTGAAACAAACAAATTTGCAGCAATATGCACTCACTTGGAGGTGTGTTTCATGTATTCAGATTTTCATTTCATCAATGAACAAGGCGAATCAATAGTGGTAGAACTTGACGATCCAAATGCACTGTTAAAGCACAGATTTGAAATAATCGAGGGGAGAGACAGAACAATGGCCTGGACAGTAGTAAACAGTATCTGCAACACTACTGGAGCTGGAAAACCGAAGTTTCTACCAGATTTGTATGATTACAAGGAGAACAGATTCATCGAAATTGGGGTGACAAGGAGAGAAGTCCACATATATTACCTTGAAAAGGCCAATAAGATTAAATCTGAGAACACACACATTCACATTTTCTCATTCACTGGGGAGGAAATGGCCACAAAGGCAGACTACACTCTCGACGAGGAAAGCAGGGCTAGGATTAAGACCAGGCTGTTTACCATAAGACAAGAAATGGCCAACAGAGGCCTCTGGGATTCCTTTCGTCAGTCCGAAAGAGGCGAAGAAACAATTGAAGAAAAATTTGAAATCACAGGAACTATGCGTAGGCTTGCCGACCAAAGTCTCCCACCGAACTTCTCCTGCCTTGAGAATTTTAGAGCCTATGTGGATGGATTCGAACCGAACGGCTGCATTGAGGGCAAGCTTTCTCAAATGTCCAAAGAAGTGAATGCCCAAATTGAACCTTTTCTGAAGACAACACCAAGACCAATCAAACTTCCGAATGGACCTCCTTGTTATCAGCGGTCCAAATTCCTCCTGATGGATGCTTTAAAATTGAGCATTGAAGACCCAAGTCACGAAGGAGAAGGGATCCCATTATATGATGCGATCAAGTGCATAAAAACATTCTTTGGATGGAAAGAACCTTATATAGTCAAACCACACGAAAAGGGAATAAATTCAAATTACCTGCTGTCATGGAAGCAAGTACTGTCAGAATTGCAGGACATTGAAAATGAGGAGAAGATTCCAAGGACTAAAAACATGAAGAAAACGAGTCAACTGAAGTGGGCTCTTGGTGAAAACATGGCACCAGAGAAGGTAGACTTTGAAAACTGCAGAGACATAAGCGATTTGAAGCAATATGATAGTGACGAACCTGAATTAAGGTCACTTTCAAGCTGGATACAGAATGAGTTCAACAAGGCCTGTGAGCTAACTGATTCAGTCTGGATAGAGCTCGATGAAATTGGAGAGGACGTAGCCCCAATTGAGCACATTGCAAGCATGAGAAGGAATTATTTCACAGCAGAGGTGTCCCATTGTAGAGCCACTGAATACATAATGAAGGGGGTATACATTAACACTGCCCTGCTCAATGCATCCTGTGCAGCAATGGACGATTTTCAACTAATTCCCATGATAAGCAAGTGCAGAACTAAAGAGGGAAGGCGAAAAACCAATTTATATGGATTCATCATAAAGGGAAGATCTCATTTAAGGAATGACACAGACGTGGTAAATTTTGTGAGCATGGAGTTTTCTCTCACTGACCCGAGACTTGAGCCACATAAATGGGAGAAATACTGTGTCCTTGAGATAGGAGATATGTTACTAAGAAGTGCCATAGGCCAAATTTCAAGGCCTATGTTCTTGTATGTGAGGACAAACGGAACATCAAAGGTCAAAATGAAATGGGGAATGGAGATGAGACGTTGCCTCCTTCAGTCACTCCAGCAGATCGAGAGCATGATTGAAGCCGAGTCCTCGGTTAAAGAGAAAGACATGACCAAAGAGTTTTTTGAGAATAAATCAGAAGCATGGCCCATTGGGGAGTCCCCCAAGGGAGTGGAAGAAGGTTCCATTGGGAAAGTCTGTAGGACTCTATTGGCTAAGTCAGTATTCAATAGCCTGTATGCATCACCACAATTGGAAGGATTTTCAGCGGAGTCAAGAAAACTGCTCCTTGTTGTTCAGGCTCTTAGGGACAACCTCGAACCTGGGACCTTTGATCTTGGGGGGCTATATGAAGCAATTGAGGAGTGCCTGATTAATGATCCCTGGGTTTTGCTCAATGCGTCTTGGTTCAACTCCTTCCTGACACATGCATTAAAATAG
    ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAACAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCAAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGCAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAACGGAACAAGCTCTGCTTGCATAAGGAGATCTAATAACAGTTTCTTTAGTAGATTGAATTGGTTGACCCACTTAAAATTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAAAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAATGACCAAATCTTCCTGTATGCTCAAGCATCAGGAAGAATCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGATCTAGACCCAGAGTAAGGAATATCCCCAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATCGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAATAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATAGGTTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTCGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACCAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGCGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATTTGA
    ATGGCGTCCCAAGGCACCAAACGGTCTTATGAACAGATGGAAACTGATGGGGATCGCCAGAATGCAACTGAGATTAGGGCATCCGTCGGGAAGATGATTGATGGAATTGGGAGATTCTACATCCAAATGTGCACTGAACTTAAACTCAGTGATCATGAAGGGCGGTTGATCCAGAACAGCTTGACAATAGAGAAAATGGTGCTCTCTGCTTTTGATGAAAGAAGGAATAAATACCTGGAAGAACACCCCAGCGCGGGGAAAGATCCCAAGAAAACTGGGGGGCCCATATACAGGAGAGTAGATGGAAAATGGATGAGGGAACTCGTCCTTTATGACAAAGAAGAAATAAGGCGAATCTGGCGCCAAGCCAACAATGGTGAGGATGCTACATCTGGTCTAACTCACATAATGATTTGGCATTCCAATTTGAATGATGCAACATACCAGAGGACAAGAGCTCTTGTTCGAACTGGAATGGATCCCAGAATGTGCTCTCTGATGCAGGGCTCGACTCTCCCTAGAAGGTCCGGAGCTGCAGGTGCTGCAGTCAAAGGAATCGGGACAATGGTGATGGAACTGATCAGAATGGTCAAACGGGGGATCAACGATCGAAATTTTTGGAGAGGTGAGAATGGGCGGAAAACAAGAAGTGCTTATGAGAGAATGTGCAACATTCTTAAAGGAAAATTTCAAACAGCTGCACAAAGAGCAATGGTGGATCAAGTGAGAGAAAGTCGGAACCCAGGAAACGCTGAGATCGAAGATCTCATATTTTTAGCAAGATCTGCATTGATATTGAGAGGATCAGTTGCTCACAAATCTTGCCTACCTGCCTGTGCGTATGGACCTGCAGTATCCAGTGGGTACGACTTCGAAAAAGAGGGATATTCCTTGGTGGGAATAGACCCTTTCAAACTACTTCAAAATAGCCAAATATACAGCTTAATCAGACCTAACGAGAATCCAGCACACAAGAGTCAGCTGGTGTGGATGGCATGCCATTCTGCTGCATTTGAAGATTTAAGATTGTTAAGCTTCATCAGAGGGACAAAAGTATCTCCTCGGGGGAAACTGTCAACTAGAGGAGTACAAATTGCTTCAAATGAGAACATGGATAATATGGGATCGAGCACTCTTGAACTGAGAAGCGGGTACTGGGCCATAAGGACCAGGAGTGGAGGAAACACTAATCAACAGAGGGCCTCCGCAGGCCAAACCAGTGTGCAACCTACGTTTTCTGTACAAAGAAACCTCCCATTTGAAAAGTCAACCATCATGGCAGCATTCACTGGAAATACGGAGGGAAGAACTTCAGACATGAGGGCAGAAATCATAAGAATGATGGAAGGTGCAAAACCAGAAGAAGTGTCATTCCGGGGGAGGGGAGTTTTCGAGCTCTCAGACGAGAAGGCAACGAACCCGATCGTGCCCTCTTTTGATATGAGTAATGAAGGATCTTATTTCTTCGGAGACAATGCAGAAGAGTACGACAATTAA
    ATGAATCCAAATCAAAAGATAATAACGATTGGCTCTGTTTCTCTCACCATTTCCACAATATGCTTCTTCATGCAAATTGCCATCTTGATAACTACTGTAACATTGCATTTCAAGCAATATGAATTCAACTCCCCCCCAAACAACCAAGTGATGCTGTGTGAACCAACAATAATAGAAAGAAACATAACAGAGATAGTGTATCTGACCAACACCACCATAGAGAAGGAAATATGCCCCAAACTAGCAGAATACAGAAATTGGTCAAAGCCGCAATGTGACATTACAGGATTTGCACCTTTTTCTAAGGACAATTCGATTAGGCTTTCCGCTGGTGGGGACATCTGGGTGACAAGAGAACCTTATGTGTCATGCGATCCTGACAAGTGTTATCAATTTGCCCTTGGACAGGGAACAACACTAAACAACGTGCATTCAAATGACACAGTACGTGATAGGACCCCTTATCGGACCCTATTGATGAATGAGTTAGGTGTTCCTTTTCATCTGGGGACCAAGCAAGTGTGCATAGCATGGTCCAGCTCAAGTTGTCACGATGGAAAAGCATGGCTGCATGTTTGTATAACGGGGGATGATAAAAATGCAACTGCTAGCTTCATTTACAATGGGAGGCTTGTAGATAGTATTGTTTCATGGTCCAAAGAAATCCTCAGGACCCAGGAGTCAGAATGCGTTTGTATCAATGGAACTTGTACAGTAGTAATGACTGATGGGAGTGCTTCAGGAAAAGCTGATACTAAAATACTATTCATTGAGGAGGGGAAAATCGTTCATACTAGCACATTGTCAGGAAGTGCTCAGCATGTCGAGGAGTGCTCCTGCTATCCTCGATATCCTGGTGTCAGATGTGTCTGCAGAGACAACTGGAAAGGCTCCAATAGGCCCATCGTAGATATAAACATAAAGGATCATAGCATTGTTTCCAGTTATGTGTGTTCAGGACTTGTTGGAGACACACCCAGAAAAAACGACAGCTCCAGCAGTAGCCATTGTTTGGATCCTAACAATGAAGAAGGTGGTCATGGAGTGAAAGGCTGGGCCTTTGATGATGGAAATGACGTGTGGATGGGAAGAACGATCAGCGAGAAGTCACGCTTAGGGTATGAAACCTTCAAAGTCATTGAAGGCTGGTCCAACCCTAAGTCCAAATTGCAGATAAATAGGCAAGTCATAGTTGACAGAGGTAATAGGTCCGGTTATTCTGGTATTTTCTCTGTTGAAGGCAAAAGCTGCATCAATCGGTGCTTTTATGTGGAGTTGATAAGGGGAAGAAAAGAGGAAACTGAAGTCTTGTGGACCTCAAACAGTATTGTTGTGTTTTGTGGCACCTCAGGTACATATGGAACAGGCTCATGGCCTGATGGGGCGGACATCAATCTCATGCCTATATAA
    ATGAGCCTTCTAACCGAGGTCGAAACGTATGTTCTCTCTATCGTTCCATCAGGCCCCCTCAAAGCCGAGATCGCGCAGAGACTTGAAGATGTCTTTGCTGGGAAAAACACAGATCTTGAGGCTCTCATGGAATGGCTAAAGACAAGACCAATTCTGTCACCTCTGACTAAGGGGATTTTGGGGTTTGTGTTCACGCTCACCGTGCCCAGTGAGCGAGGACTGCAGCGTAGACGCTTTGTCCAAAATGCCCTCAATGGGAATGGAGATCCAAATAACATGGACAAAGCAGTTAAACTGTATAGGAAACTTAAGAGGGAGATAACGTTCCATGGGGCCAAAGAAATAGCTCTCAGTTATTCTGCTGGTGCACTTGCCAGTTGCATGGGCCTCATATACAATAGGATGGGGGCTGTAACCACTGAAGTGGCATTTGGCCTGGTATGTGCAACATGTGAGCAGATTGCTGACTCCCAGCACAGGTCTCATAGGCAAATGGTGGCAACAACCAATCCATTAATAAGACATGAGAACAGAATGGTTTTGGCCAGCACTACAGCTAAGGCTATGGAGCAAATGGCTGGATCAAGTGAGCAGGCAGCGGAGGCCATGGAGATTGCTAGTCAGGCCAGGCAGATGGTGCAGGCAATGAGAGCCATTGGGACTCATCCTAGTTCCAGTACTGGTCTAAGAGATGATCTTCTTGAAAATTTGCAGACCTATCAGAAACGAATGGGGGTGCAGATGCAACGATTCAAGTGACCCGCTTGTTGTTGCCGCGAATATCATTGGGATCTTGCACTTGATATTGTGGATTCTTGATCGTCTTTTTTTCAAATGCGTCTATCGACTCTTCAAACACGGCCTTAAAAGAGGCCCTTCTACGGAAGGAGTACCTGAGTCTATGAGGGAAGAATATCGAAAGGAACAGCAGAATGCTGTGGATGCTGACGACAGTCATTTTGTCAGCATAGAGTTGGAGTAA
    ATGGATTCCAACACTGTGTCAAGTTTCCAGGTAGATTGCTTTCTTTGGCATATCCGGAAACAAGTTGTAGACCAAGAACTGAGTGATGCCCCATTCCTTGATCGGCTTCGCCGAGATCAGAGGTCCCTAAGGGGAAGAGGCAATACTCTCGGTCTAGACATCAAAGCAGCCACCCATGTTGGAAAGCAAATTGTAGAAAAGATTCTGAAAGAAGAATCTGATGAGGCACTTAAAATGACCATGGTCTCCACACCTGCTTCGCGATACATAACTGACATGACTATTGAGGAATTGTCAAGAAACTGGTTCATGCTAATGCCCAAGCAGAAAGTGGAAGGACCTCTTTGCATCAGAATGGACCAGGCAATCATGGAGAAAAACATCATGTTGAAAGCGAATTTCAGTGTGATTTTTGACCGACTAGAGACCATAGTATTACTAAGGGCTTTCACCGAAGAGGGAGCAATTGTTGGCGAAATCTCACCATTGCCTTCTTTTCCAGGACATACTATTGAGGATGTCAAAAATGCAATTGGGGTCCTCATCGGAGGACTTGAATGGAATGATAACACAGTTCGAGTCTCTAAAAATCTACAGAGATTCGCTTGGAGAAGCAGTAATGAGAATGGGGGACCTCCACTTACTCCAAAACAGAAACGGGAAATGGCGAGAACAGCTAGGTCAAAAGTTTGAAGAGATAAGATGGCTAATTGAAGAAGTGAGACACAGATTAAAAACAACTGAAAATAGCTTTGAACAAATAACATTCATGCAAGCATTACAACTGCTGTTTGAAGTGGAACAGGAGATAAGAACTTTCTCATTTCAGCTTATTTAA
    I'm interested in expert panflu damage estimates
    my current links: [url]http://bit.ly/hFI7H[/url] ILI-charts: [url]http://bit.ly/CcRgT[/url]

    Comment


    • #3
      Re: H3n2

      evolution of H3N2 genomes since 2007






      ---------edit--------------------------------------
      4 groups in Texas JMM Dec.2012 ,18+4+12+8 viruses
      see below

      differences to EI-NA
      CZ--:104=24+13+16+19+08+14+04+06
      4er-:103=23+14+12+22+08+13+04+07
      ?---:087=18+20+09+15+05+12+04+04
      reas:151=43+28+14+24+12+10+09+11

      differences to US-2007
      CZ--:161=32+24+23+34+11+21+07+09
      4er-:161=33+25+17+38+11+20+07+10
      ?---:145=28+33+14+29+08+19+07+07
      reas:173=36+28+21+36+15+17+12+08
      Index_reas_11:110=25+22+11+27+04+08+07+06
      Index_EI_2011:106=14+18+14+22+10+16+07+05
      EI-NA:61=10+13+07+15+03+07+03+03
      EI---:63=10+13+07+15+03+09+03+03
      Attached Files
      I'm interested in expert panflu damage estimates
      my current links: [url]http://bit.ly/hFI7H[/url] ILI-charts: [url]http://bit.ly/CcRgT[/url]

      Comment


      • #4
        Re: H3n2

        the earliest appearance of the now (since 2007) dominating human
        H3N2 strain was in Kolkata(Calcutta) September,2006.

        the earliest with A565C,C729T (the two most prevalent mutations) was
        in Cheongju,Sept.2007
        Attached Files
        I'm interested in expert panflu damage estimates
        my current links: [url]http://bit.ly/hFI7H[/url] ILI-charts: [url]http://bit.ly/CcRgT[/url]

        Comment


        • #5
          Re: H3n2

          It seems that we are getting H3N2 this season in USA and Europe.
          There is still not much H3N1 from USA 2010/11 at genbank,
          which is unusual.
          But we have many sequences from Japan's last season.
          This showed basically 2 slightly different strains last season.
          All recent public viruses descend from the new strain that appeared
          in 2006/7 ("Brisbane"-like)

          But it's not yet public what will come this season,
          we have only 2 HAs since May.

          It would be interesting to see, what H3N2 India and China
          had this summer.

          http://magictour.free.fr/panflu/h3_12ak.GIF


          http://www.flutrackers.com/forum/sho...d.php?p=434930
          Six genetic groups for the HA gene can be seen in circulating H3N2 viruses.
          Within the A/Perth/16/2009 genetic clade there are two genetic groups defined by amino acid substitutions:
          (1) P162S, I260M & R261Q, e.g. A/Victoria/210/2009
          some E50K, e.g. A/Norway/1186/2011, or N81D, e.g. A/Niigata/510/2011;

          (2) N133D , R142G, T212A &V213A, not recent

          Four groups, in A/Victoria/208/2009 (K62E, K144N & T212A).

          (3) V223I often with N145S, e.g. A/Johannesburg/73/2011
          a) N144D , e.g. A/Stockholm/18/2011
          b) A198S often with S45, T48I and N312S, e.g. A/Hong Kong/3969/2011;

          (4) N312S, e.g. A/Brisbane/11/2010, many T48A & K92R, e.g. A/Rhode Island/01/2010 and A Massachusetts/08/2011

          (5) D53N, Y94H, I230V & E280A, e.g. A/Perth/10/2010, some I192T, e.g. A/Athens/108/2011

          (6) D53N, Y94H, I230V & E280A, as in (5) but with S199A, e.g. A/Iowa/19/2010, some S45N e.g. A/Hong Kong/3951/2011;

          cluster with S45N in South Africa, e.g. A/Johannesburg/114/2011; some L3F & L59I , e.g. A Norway/685/2011;
          (1) with E50K,
          (3) with 144, or N145S



          frequency of the most common mutations:
          A522C,684
          C729T,525
          A565C,514
          C318A,412
          C660A,373
          G232A,362
          T480A,360
          T615A,358
          T615G,329
          A682G,326
          C483T,326
          T686C,166
          A983G,128
          G205A,118
          T328C,118
          A736G,114
          A108G,109
          C690T,109
          A887C,108
          T291C,108
          G540A,104
          G830A,095
          G837A,092
          A555G,089
          A712C,088
          A828G,077
          G382A,077
          A672G,076
          A939G,075
          C186T,071
          C532T,070
          G182A,065
          A479G,047
          G196A,046
          T643G,044
          A445G,040
          A190G,036
          A521G,036
          C543T,035
          A721G,034
          C447T,031
          C393T,029
          A231G,026
          I'm interested in expert panflu damage estimates
          my current links: [url]http://bit.ly/hFI7H[/url] ILI-charts: [url]http://bit.ly/CcRgT[/url]

          Comment


          • #6
            Re: H3n2

            35 H3N2-genomes from Boston, 2010/2011 season at genbank

            basically 2 strains, both reassorted

            2.) Egypt/Iowa in segments 1,2,3,4,5,7,8 with a different segment 6,
            I haven't found that one elsewhere since 2007, but I haven't looked
            much. It's probably still a descendent from the new 2007-H3N2
            10/10,12/13,7/7,15/15,3/3,2/4,3/3,3/3
            1.) Egypt/Iowa in segments 3,4,5,7 . Segments 2,6 are still
            a bit like Egypt/Iowa - an early variation. Segments 1,8 diverged
            early in 2006/7 . I don't remember having seen
            these segments 1,2,6,8 before.
            ---segment 1 was in Bogota,Mexico City some months before)
            In the 8 segments it has mutations in common with Egypt/Iowa:
            1/10,6/13,7/7,15/15,3/3,2/4,3/3,0/3

            Code:
            >Index/USA-2007 (Brisbane-like)     ............................................................................ ...................................................................... -....................................................... ........................................................- ......................................---- .................................................- ..................... ................... 
            >Index/2009/Egypt/Iowa              ....G....G........G....G..A.....C..G..A...A...G............................. .G..G.G........G..................G....A........CAA.A......A......A..G -..C...C....AA..................A..............T...G.... ..........A....TCC.G..AG....T.....A.A..G....AT........AG- .....A....CG..........................---- .........A.......G...............................- ..C....GA............ ........A.G....G... 
            >Index/Perth-like/2009              ......C...........G.......A........G..A...A......................A....G..... ...TG.............................GT..............A...A.T.........A... -......C..G......A...A.......G.G...................A.A.. ........A.....A.CC.A........T..........G....AT.......TAG- .....A..............A..............ACT---- .....G..AA.......G.....A........GG...............- ..C....GA...AT....... ..............T.... 
            >A/DC/WRAIR0301/2010/11/23          ......C...........G.......A........G..A...A........C.............A....G..... ...TG...A...........G.....CG....C.GT..............A...A.A.........A... .......C..G......A...AT......GCG.............G.....A.A.G ...A....A.....A.CC.A...GC...T..........G....AT.C......AG. ...G.A.....G.......AA..............A.T...- .....G..AA.......G..A..A.........G.............T.. .ACT.A.GA...AT.A..... ..............T.... 
            >A/Boston/DOA71/2011/03/05          ..........A...TGT.G........A...A...............C.......CG.AT..A......A..C... .G..G.G........G..................G....A........CAA.A......A......A..G ...C...C....AA..................A....A.........T...G.... ........A.....A.CC.A....C...T..........G....AT.......TAG. .....A....CG...........................ATA C....G...A.......G....T.............AC....GT....C. ..C..A.GAA......CT... C.....C...........G 
            >index1(4CA+18BOS+IL+TX+DC)         T....A.A..A.T.T.TAGA..A....A...AA......C...A..........ACG.AT.C.......A..CA.. CG..G..A.....A..CGA..........TA..CG..A...T........A......C......TAAAGG ...C...C....AA..C..T............A........TA....T...G.... ..G...A..CA.C..TCC.G.GAG..T.TG.C..AAA..GG...ATC...G.A.AG. ....TA....CG.............................. .........A.......G....T.............ACT....T....C. .ACT.A.GAA........... C...T.C....T....G.G 
            >A/DC/WRAIR0300/2010/11/17          T....A.A..A.......G..T.GT.A.A.A.C..G..A...A...G....C.......................T .G..G.G........G..........CG....C.G....A........CAA.A...A..A..T...A..G ...CG..CG...AA.C.........T....C.A..............T...G..C. ....A.....A....TCC.G..AG....T.....A.A..G....AT.C......AG. ..T.TA....CG..............T........A.....- C.T......A.......G....T..T..........AC.....T....C. AACT.A.GA.....C.C.... ........A.G....G... 
            >A/Boston/DOA52/2011/02/18          ....G....G........G..T.GT.A.A.A.C..G..A...A...G............................T .G..G.G........G......A.........C.G....A........CAA.A......A..T...A..G ...CG..CG...AA.C................A..............T...G..C. ....A.....A....TCC.G..AG....T.....A.A..G....AT........AG. ..T..A....TG..............T.C.T....A...... C.T......A.A.....G....T..T..........AC....GT....C. A.C....GA.....C.C.... ........A.G....G... 
            >index2(17BOS+SC)                   ...TG....G........G....G..A.....C..G..A...A..CG................G..........C. .G..G.G........GC...........C.....G....ATAA.....CAAAA.....AA......A... ...C...C....AA......A...GTGG....A...G..........T..AG.... C....G.T..AG...TCC.G..AG....T....GA.A.AG...AAT........AG. T....A....CGA.C...A....A.T......C........- ...GA....A.....A.GTA..T....A.......AAC.G.A.T....C. ..C...CGA.TG........G ...A...AA.G....G...
            Attached Files
            I'm interested in expert panflu damage estimates
            my current links: [url]http://bit.ly/hFI7H[/url] ILI-charts: [url]http://bit.ly/CcRgT[/url]

            Comment


            • #7
              Re: H3n2

              http://www.ncbi.nlm.nih.gov/pmc/arti...7/?tool=pubmed

              In contrast, nucleotide sequences of NS gene of A/KOL/536/2007(H1N1),
              A/KOL/596/2007(H1N1), A/KOL/968/2007(H1N1), A/KOL/230/2009(H1N1)
              and A/KOL/2086/2009(H1N1) were nearly identical with A/Puerto Rico/8/34,
              differing at only few nucleotide positions

              5 strains [A/KOL/507/2007(H1N1), A/KOL/536/2007(H1N1), A/KOL/596/2007(H1N1),
              A/KOL/611/2007(H1N1) and A/KOL/968/2007(H1N1)] clustered with H3N2 strains in group I,
              whereas, 6 strains clustered with pH1N1/2009 strains in sub-group 2

              To verify possible cross contamination, BLAST search of HA, NA, M1 and NS1 gene
              sequences showed only NS1 having sole identity with A/PR/8/34(H1N1). Thus, a chance
              of cross contamination with laboratory PR8 strain was ruled out. Though the frequency
              of vaccination in India is very low but since the WHO approved vaccines with PR8 backbone
              are used, possibility of reassortment with the vaccine strain can not be ruled out.

              Of 166 influenza A positive samples, 55 samples were picked randomly (31 H1N1 and 24 H3N2)
              for sequencing of PB1-F2 and NS genes. For confirmation, total PB1 gene segment was sequenced
              in 19 strains chosen randomly.

              Accession Numbers for nucleotide sequences
              Accession numbers of all newly reported sequences obtained for full length non-structural
              (NS) gene, full length polymerase basic protein 1 (PB1) gene, PB1-F2 gene and
              matrix (M1) gene in this study are:
              HQ853495,HQ853549,HM460507,HM460510,HQ154076,HQ154 078,HQ154084,HQ853550
              HQ853552,HQ853555,HQ853556,HQ853557,HQ853559,HQ853 567,HQ853571,HQ853573
              HQ853574,HQ853579,HQ853586,HQ853589,HQ853591,HQ853 551,HQ853553,HQ853554
              HQ853558,HQ853560,HQ853566,HQ853568,HQ853570,HQ853 572,HQ853575,HQ853578
              HQ853580,HQ853585,HQ853587,HQ853588,HQ853590,HQ853 592,HQ853595,HM460508
              HM460509,HM460511,HQ154075,JF903566,JF903570

              ------------------------------------------------------------------

              I think the PR8 is contamination, although they "ruled that out"
              The reassortment is hardly verified with just 2 segments.
              How do they know what is H1N1 and what H3N2 without sequencing segments 4 and 6 ?
              I think it's important enough to sequence at least one of the reassortants fully in all 8 segments



              ---------------------------------------------------------------
              segment 2: 4 groups, group 3 reassorted ? H3-PB2 in H1N1 sequences

              Code:
                                                             0001 
                                                             0237 
                                                             9754 
                                                             9973 
              -codon-position--------------------------------     
              ---Index---------------------------------------ATAT 
                 1 >A/******/index/2009/02/01                ....        0      0 ,      0      0       1:>A/******/index/2009/02/01                
                 2 >A/KOL/927/2009,2009/08/,H1N1,HQ154084    GCGC        4      4 ,      4      4       2:>A/KOL/927/2009,2009/08/,H1N1,HQ154084    
                 3 >A/KOL/2086/2009,2009//,H1N1,HM460507     GC.C        3      3 ,      3      3       3:>A/KOL/2086/2009,2009//,H1N1,HM460507     
                 4 >A/KOL/2449/2009,2009//,H1N1,HM460510     GC.C        3      3 ,      3      3       4:>A/KOL/2449/2009,2009//,H1N1,HM460510     
                 5 >A/KOL/2465/2009,2009//,H1N1,HM460511     GC.-        3      3 ,      2      2       5:>A/KOL/2465/2009,2009//,H1N1,HM460511     
                 6 >A/KOL/230/2009,2009/08/,H1N1,HQ154078    G..C        2      2 ,      2      2       6:>A/KOL/230/2009,2009/08/,H1N1,HQ154078    
                 7 >A/KOL/2482/2009,2009/09/,H1N1,HQ154075   G..-        2      2 ,      1      1       7:>A/KOL/2482/2009,2009/09/,H1N1,HQ154075

              Code:
                                                             0000000000000000000000000000000000011111111111111111111111111222222222222222 
                                                             1111111222222222333344445556788999900011123345666677788889999000001122222222 
                                                             1455589111122478001423483490413001304523744577678856926891235012595600112377 
                                                             1101338367923398065502730143701692361021955638847954470497550108217008010734 
              -codon-position--------------------------------   1     1  1           21         1      1     1         2         1 2  22  
              ---Index---------------------------------------ACAGATTTACAGGCTACCCGCAAGGGACGAGACAGGGATTAGTTAAGTCAAGATCACAAATCACAACACGAATTGA 
                 1 >A/Brisbane/59/2007/07/01(H1N1)           ............................................................................        0      0 ,      0      0       1:>A/Brisbane/59/2007/07/01(H1N1)           
                 4 >A/KOL/2172/2009,2009//,H1N1,HM460508     G....G.......AC.------------------------------------------------------------       64     64 ,      4      4       4:>A/KOL/2172/2009,2009//,H1N1,HM460508     
                15 >A/KOL/958/2007,2007/07/,H1N1,HQ853565    G....G..C.....--------------------------------------------------------------       65     65 ,      3      3      15:>A/KOL/958/2007,2007/07/,H1N1,HQ853565    
                16 >A/KOL/2218/2009,2009//,H1N1,HM460509     G....G..CT....C.------------------------------------------------------------       65     65 ,      5      5      16:>A/KOL/2218/2009,2009//,H1N1,HM460509     
                17 >A/KOL/1065/2009,2009/08/,H1N1,HQ154077   G....G..CT....--------------------------------------------------------------       66     66 ,      4      4      17:>A/KOL/1065/2009,2009/08/,H1N1,HQ154077   
                18 >A/KOL/301/2009,2009/08/,H1N1,HQ154079    G....G..CT....--------------------------------------------------------------       66     66 ,      4      4      18:>A/KOL/301/2009,2009/08/,H1N1,HQ154079    
                19 >A/KOL/449/2009,2009/08/,H1N1,HQ154080    G....G..CT....--------------------------------------------------------------       66     66 ,      4      4      19:>A/KOL/449/2009,2009/08/,H1N1,HQ154080    
                20 >A/KOL/642/2009,2009/08/,H1N1,HQ154083    G....G..CT....--------------------------------------------------------------       66     66 ,      4      4      20:>A/KOL/642/2009,2009/08/,H1N1,HQ154083    
                21 >A/KOL/1048/2009,2009/08/,H1N1,HQ154085   G....G..CT....--------------------------------------------------------------       66     66 ,      4      4      21:>A/KOL/1048/2009,2009/08/,H1N1,HQ154085   
                22 >A/KOL/1182/2009,2009/08/,H1N1,HQ154086   G....G..CT....--------------------------------------------------------------       66     66 ,      4      4      22:>A/KOL/1182/2009,2009/08/,H1N1,HQ154086   
                23 >A/KOL/1299/2009,2009/08/,H1N1,HQ154088   G....G..CT....--------------------------------------------------------------       66     66 ,      4      4      23:>A/KOL/1299/2009,2009/08/,H1N1,HQ154088   
                24 >A/KOL/105/2009,2009/08/,H1N1,HQ154090    G....G..CT....--------------------------------------------------------------       66     66 ,      4      4      24:>A/KOL/105/2009,2009/08/,H1N1,HQ154090    
                25 >A/KOL/536/2009,2009/08/,H1N1,HQ154081    G....G..CTG...--------------------------------------------------------------       67     67 ,      5      5      25:>A/KOL/536/2009,2009/08/,H1N1,HQ154081    
                26 >A/KOL/1225/2009,2009/08/,H1N1,HQ154087   G....G..CTG...--------------------------------------------------------------       67     67 ,      5      5      26:>A/KOL/1225/2009,2009/08/,H1N1,HQ154087   
                27 >A/KOL/561/2009,2009/08/,H1N1,HQ154082    G....GC.CT....--------------------------------------------------------------       67     67 ,      5      5      27:>A/KOL/561/2009,2009/08/,H1N1,HQ154082    
                28 >A/KOL/1421/2009,2009/08/,H1N1,HQ154089   G....GC.CT....--------------------------------------------------------------       67     67 ,      5      5      28:>A/KOL/1421/2009,2009/08/,H1N1,HQ154089   
                34 >A/KOL/46/2009,2009/07/,H1N1,HQ154076     G....GC.CT........TA......G......GAA..CC...C..A..G.AG....TG.........A.......       21     21 ,     21     21      34:>A/KOL/46/2009,2009/07/,H1N1,HQ154076     
                35 >A/KOL/781/2009,2009/08/,H1N1,HQ853571    G....GC.CT........TA......G......GAA..CC...C..A..G.AG....TG.........A.......       21     21 ,     21     21      35:>A/KOL/781/2009,2009/08/,H1N1,HQ853571    
              
                30 >A/KOL/526/2007,2007/05/,H1N1,HQ853551    G.CCC.........--------------------------------------------------------------       66     66 ,      4      4      30:>A/KOL/526/2007,2007/05/,H1N1,HQ853551    
                31 >A/KOL/565/2007,2007/06/,H1N1,HQ853553    G.CCC.........--------------------------------------------------------------       66     66 ,      4      4      31:>A/KOL/565/2007,2007/06/,H1N1,HQ853553    
                32 >A/KOL/918/2007,2007/07/,H1N1,HQ853557    G.CCC.........C...................AA.GC......G......................A.......       11     11 ,     11     11      32:>A/KOL/918/2007,2007/07/,H1N1,HQ853557    
                33 >A/KOL/929/2007,2007/07/,H1N1,HQ853559    G.............C...................AA.GC......G......................A.......        8      8 ,      8      8      33:>A/KOL/929/2007,2007/07/,H1N1,HQ853559    
                 5 >A/KOL/919/2007,2007/07/,H1N1,HQ853558    G.............--------------------------------------------------------------       63     63 ,      1      1       5:>A/KOL/919/2007,2007/07/,H1N1,HQ853558    
                 6 >A/KOL/936/2007,2007/07/,H1N1,HQ853560    G.............--------------------------------------------------------------       63     63 ,      1      1       6:>A/KOL/936/2007,2007/07/,H1N1,HQ853560    
                 7 >A/KOL/937/2007,2007/07/,H1N1,HQ853561    G.............--------------------------------------------------------------       63     63 ,      1      1       7:>A/KOL/937/2007,2007/07/,H1N1,HQ853561    
                 8 >A/KOL/943/2007,2007/07/,H1N1,HQ853562    G.............--------------------------------------------------------------       63     63 ,      1      1       8:>A/KOL/943/2007,2007/07/,H1N1,HQ853562    
                 9 >A/KOL/951/2007,2007/07/,H1N1,HQ853563    G.............--------------------------------------------------------------       63     63 ,      1      1       9:>A/KOL/951/2007,2007/07/,H1N1,HQ853563    
                10 >A/KOL/956/2007,2007/07/,H1N1,HQ853564    G.............--------------------------------------------------------------       63     63 ,      1      1      10:>A/KOL/956/2007,2007/07/,H1N1,HQ853564    
                11 >A/KOL/964/2007,2007/07/,H1N1,HQ853566    G.............--------------------------------------------------------------       63     63 ,      1      1      11:>A/KOL/964/2007,2007/07/,H1N1,HQ853566    
                12 >A/KOL/975/2007,2007/07/,H1N1,HQ853568    G.............--------------------------------------------------------------       63     63 ,      1      1      12:>A/KOL/975/2007,2007/07/,H1N1,HQ853568    
                13 >A/KOL/985/2007,2007/07/,H1N1,HQ853569    G.............--------------------------------------------------------------       63     63 ,      1      1      13:>A/KOL/985/2007,2007/07/,H1N1,HQ853569    
                14 >A/KOL/990/2007,2007/07/,H1N1,HQ853570    G.............--------------------------------------------------------------       63     63 ,      1      1      14:>A/KOL/990/2007,2007/07/,H1N1,HQ853570    
                29 >A/KOL/578/2007,2007/06/,H1N1,HQ853554    GT....CG...A..--------------------------------------------------------------       67     67 ,      5      5      29:>A/KOL/578/2007,2007/06/,H1N1,HQ853554    
              
                 2 >A/Kansas/UR06-0068/2007(H1N1)            G.....CG...A....T...A..AA..TA..CT.AA..C.........A.C...T.....C....GT.A.GG..AG       26     26 ,     26     26       2:>A/Kansas/UR06-0068/2007(H1N1)            
                 3 >A/New Caledonia/20/1999///               GT....CG...AA..GTT...CG.AA...GACT.AAA.C.GAC.G..GA.C..C.GT..G.TGTG.TCAA..CCAG       44     44 ,     44     44       3:>A/New Caledonia/20/1999///               
                                                                                                                                          
              ---Index---------------------------------------ACAGATTTACAGGCTACCCGCAAGGGACGAGACAGGGATTAGTTAAGTCAAGATCACAAATCACAACACGAATTGA 
              -codon-position--------------------------------   1     1  1           21         1      1     1         2         1 2  22  
                                                             0000000000000000000000000000000000011111111111111111111111111222222222222222 
                                                             1111111222222222333344445556788999900011123345666677788889999000001122222222 
                                                             1455589111122478001423483490413001304523744577678856926891235012595600112377 
                                                             1101338367923398065502730143701692361021955638847954470497550108217008010734

              Code:
                                                            000000000000000011111111112222 
                                                            001111111133469902357778890122 
                                                            290024556969051855660253850903 
                                                            890531560527525111567696737304 
              -codon-position-------------------------------1 1   2 1 21 1  1    11     12 
              ---Index--------------------------------------CAAACCAGAAATACCACGTTGCGGTGGGCA 
                 1 >Index/USA-2007                          ..............................        0      0 ,      0      0       1:>Index/USA-2007                          
                 2 >2007/02/06,14278,AUS,A/Brisbane/10/07   A......A...C..T...C........A..        6      6 ,      6      6       2:>2007/02/06,14278,AUS,A/Brisbane/10/07   
                 3 >Index/Brisbane-like/2007                .............T..............A.        2      2 ,      2      2       3:>Index/Brisbane-like/2007                
                 5 >Index/2009/Egypt/Iowa                   ...G..G..G..G..G.A.CAAA...A.AG       13     13 ,     13     13       5:>Index/2009/Egypt/Iowa                   
              
                 6 >A/KOL/507/2007,2007/05/,H1N1,HQ853550   AG..A.....G.............C..A..        6      6 ,      6      6       6:>A/KOL/507/2007,2007/05/,H1N1,HQ853550   
                 7 >A/KOL/611/2007,2007/06/,H1N1,HQ853556   AG........G.............C..A..        5      5 ,      5      5       7:>A/KOL/611/2007,2007/06/,H1N1,HQ853556   
                 9 >A/KOL/596/2007,2007/06/,H1N1,HQ853555   AG......G...............C..A..        5      5 ,      5      5       9:>A/KOL/596/2007,2007/06/,H1N1,HQ853555   
                 8 >A/KOL/536/2007,2007/06/,H1N1,HQ853552   A.C.......G.............C..A..        5      5 ,      5      5       8:>A/KOL/536/2007,2007/06/,H1N1,HQ853552   
              
                10 >A/KOL/968/2007,2007/07/,H1N1,HQ853567   A....TG.................C..A..        5      5 ,      5      5      10:>A/KOL/968/2007,2007/07/,H1N1,HQ853567   
                 4 >Index/Perth-like/2009                   .....TG........GT....A.A.T..A.        8      8 ,      8      8       4:>Index/Perth-like/2009

              Code:
                                                             00000000000000000000001111111111111111111111122222 
                                                             01111112333344445677990001122245566677778889900002 
                                                             60445693346904567503785690815870636700250343901250 
                                                             05175854883057936125211457281199652147690655576520 
              -codon-position--------------------------------    2   2      1      12              11         1 
              ---Index---------------------------------------AACTAGAACGATATCTGCCGCACAGTTAGATTTATCCGCGTGGACGCAGC 
              
                18 >A/KOL/2312/2009,2009/09/,H3N2,HQ853589   .G..G.G.....GC.......G.C....A..CC....AAA.....AA.AA       17     17 ,     17     17      18:>A/KOL/2312/2009,2009/09/,H3N2,HQ853589   
                23 >A/KOL/2404/2009,2009/09/,H3N2,HQ853591   .G..G.G.....GC.......G.C....A..CC....AAA.....AA.AA       17     17 ,     17     17      23:>A/KOL/2404/2009,2009/09/,H3N2,HQ853591   
                19 >A/KOL/779/2009,2009/08/,H3N2,HQ853593    -G..G.G....---------------------------------------       96     43 ,      3      3      19:>A/KOL/779/2009,2009/08/,H3N2,HQ853593    
                20 >A/KOL/857/2009,2009/08/,H3N2,HQ853594    -G..G.G....---------------------------------------       96     43 ,      3      3      20:>A/KOL/857/2009,2009/08/,H3N2,HQ853594    
                21 >A/KOL/402/2009,2009/08/,H3N2,HQ853595    -G..G.G....---------------------------------------       96     43 ,      3      3      21:>A/KOL/402/2009,2009/08/,H3N2,HQ853595    
                22 >A/KOL/2321/2009,2009/09/,H3N2,HQ853590   -G..G.G....---------------------------------------       96     43 ,      3      3      22:>A/KOL/2321/2009,2009/09/,H3N2,HQ853590   
                24 >A/KOL/2309/2009,2009/09/,H3N2,HQ853588   -G..G.G...C---------------------------------------       97     44 ,      4      4      24:>A/KOL/2309/2009,2009/09/,H3N2,HQ853588   
                 5 >Index/2009/Egypt/Iowa                    .G..G.G.....G........G......A...C....AAA.....A...A       13     12 ,     13     12       5:>Index/2009/Egypt/Iowa                    
              
                25 >A/KOL/1691/2008,2008/06/,H3N2,HQ853582   -...G.....C---------------------------------------       95     42 ,      2      2      25:>A/KOL/1691/2008,2008/06/,H3N2,HQ853582   
                26 >A/KOL/1708/2008,2008/07/,H3N2,HQ853583   -...G......---------------------------------------       95     41 ,      2      1      26:>A/KOL/1708/2008,2008/07/,H3N2,HQ853583   
                32 >A/KOL/1687/2008,2008/06/,H3N2,HQ853581   -.T.G......---------------------------------------       96     42 ,      3      2      32:>A/KOL/1687/2008,2008/06/,H3N2,HQ853581   
                33 >A/KOL/1525/2009,2009/08/,H3N2,HQ853592   -...G.G....---------------------------------------       96     42 ,      3      2      33:>A/KOL/1525/2009,2009/08/,H3N2,HQ853592   
                15 >A/KOL/994/2007,2007/07/,H3N2,HQ853577    -...G......---------------------------------------       94     41 ,      1      1      15:>A/KOL/994/2007,2007/07/,H3N2,HQ853577    
                16 >A/KOL/600/2007,2007/06/,H3N2,HQ853572    -...G..G...---------------------------------------       95     42 ,      2      2      16:>A/KOL/600/2007,2007/06/,H3N2,HQ853572    
                17 >A/KOL/989/2007,2007/07/,H3N2,HQ853578    -...G..G...---------------------------------------       95     42 ,      2      2      17:>A/KOL/989/2007,2007/07/,H3N2,HQ853578    
                14 >A/KOL/1810/2008,2008/07/,H3N2,HQ853586   ....G.......G........GT...............A..A.......A        8      7 ,      8      7      14:>A/KOL/1810/2008,2008/07/,H3N2,HQ853586   
                 4 >Index/Perth-like/2009                    ..T.G................GT...............A..A.......A        8      7 ,      8      7       4:>Index/Perth-like/2009                    
              
                10 >A/KOL/1537/2008,2008/05/,H3N2,HQ853579   ..........C.......................................        1      1 ,      1      1      10:>A/KOL/1537/2008,2008/05/,H3N2,HQ853579   
                11 >A/KOL/1822/2008,2008/07/,H3N2,HQ853587   -.........C---------------------------------------       94     41 ,      1      1      11:>A/KOL/1822/2008,2008/07/,H3N2,HQ853587   
                27 >A/KOL/595/2007,2007/06/,H3N2,HQ853576    -..C.......---------------------------------------       94     41 ,      1      1      27:>A/KOL/595/2007,2007/06/,H3N2,HQ853576    
                28 >A/KOL/1075/2007,2007/08/,H3N2,HQ853575   -..C.......---------------------------------------       94     41 ,      1      1      28:>A/KOL/1075/2007,2007/08/,H3N2,HQ853575   
                12 >A/KOL/1690/2008,2008/06/,H3N2,HQ853580   -..........---------------------------------------       93     40 ,      0      0      12:>A/KOL/1690/2008,2008/06/,H3N2,HQ853580   
                13 >A/KOL/1762/2008,2008/07/,H3N2,HQ853585   -..........---------------------------------------       93     40 ,      0      0      13:>A/KOL/1762/2008,2008/07/,H3N2,HQ853585   
                 1 >Index/USA-2007                           ..................................................        0      0 ,      0      0       1:>Index/USA-2007                           
                 2 >2007/02/06,14278,AUS,A/Brisbane/10/07    ..................................................        6      0 ,      6      0       2:>2007/02/06,14278,AUS,A/Brisbane/10/07    
                 3 >Index/Brisbane-like/2007                 .................................................A        2      1 ,      2      1       3:>Index/Brisbane-like/2007                 
              
                31 >A/KOL/524/2007,2007/05/,H3N2,HQ853573    ....G......C..T...TAT.....C.AG...G..T...C.AGA..C..       16     16 ,     16     16      31:>A/KOL/524/2007,2007/05/,H3N2,HQ853573    
                30 >A/KOL/960/2007,2007/07/,H3N2,HQ853574    .....A.....C..T...TAT.....C.AG...G..T...C.AGA..C..       16     16 ,     16     16      30:>A/KOL/960/2007,2007/07/,H3N2,HQ853574    
                29 >A/KOL/1728/2008,2008/07/,H3N2,HQ853584   -....A.....---------------------------------------       94     41 ,      1      1      29:>A/KOL/1728/2008,2008/07/,H3N2,HQ853584   
                 6 >A/Wisconsin/67/2005/08/                  ..............T...T.T........G...G..T.....AG...C..       15      9 ,     15      9       6:>A/Wisconsin/67/2005/08/                  
                 7 >A/Index_Fujian/2002(H3N2)                C......GTA....TCATT.T...AC.G.GA..GCTT.....AG...C..       22     22 ,     22     22       7:>A/Index_Fujian/2002(H3N2)                
                 8 >A/Index_Fujian/USA/2003(H3N2)            C......GTA....TCATT.T...AC.G.GA..GCTT.....AG...C..       25     22 ,     25     22       8:>A/Index_Fujian/USA/2003(H3N2)            
                 9 >A/Index_Fujian_reass./2003/06(H3N2)      C....A.GTA....TCA.T.T...AC.G.GA..GCTT...C.AG......       62     22 ,     62     22       9:>A/Index_Fujian_reass./2003/06(H3N2)      
              
              ---Index---------------------------------------AACTAGAACGATATCTGCCGCACAGTTAGATTTATCCGCGTGGACGCAGC 
              -codon-position--------------------------------    2   2      1      12              11         1 
                                                             00000000000000000000001111111111111111111111122222 
                                                             01111112333344445677990001122245566677778889900002 
                                                             60445693346904567503785690815870636700250343901250 
                                                             05175854883057936125211457281199652147690655576520

              --------------------------------------------------------------

              segment 8:

              Code:
                                                             0000000000000000000000000000000000000000000000 
                                                             0000000001111122222333334444444566667777777788 
                                                             0555677890146701268234682223379134570134455914 
                                                             6089505835438190973707623682978538990750769290 
              -codon-position-------------------------------- 21221 1   2  2 1 1  2 1  2 1  2  211  2       
              ---Index---------------------------------------TAAACGAGCGAGATAACCGAAGAAGGAGCATTGAACGAGCGTGAGG 
                 1 >A/Brisbane/59/2007/07/01(H1N1)           ..............................................        0      0 ,      0      0       1:>A/Brisbane/59/2007/07/01(H1N1)           
                 2 >A/Kansas/UR06-0068/2007(H1N1)            ....T.....G....G........A......A....A.........        6      6 ,      6      6       2:>A/Kansas/UR06-0068/2007(H1N1)            
                 3 >A/New Caledonia/20/1999///               ....T...A....C..T.AG..G.......C..C.TA......G.A       13     13 ,     13     13       3:>A/New Caledonia/20/1999///               
              
                18 >A/KOL/46/2009,2009/07/,H1N1,HQ853516     ............................T.................        1      1 ,      1      1      18:>A/KOL/46/2009,2009/07/,H1N1,HQ853516     
                19 >A/KOL/781/2009,2009/08/,H1N1,HQ853518    ............................T.................        1      1 ,      1      1      19:>A/KOL/781/2009,2009/08/,H1N1,HQ853518    
                20 >A/KOL/927/2009,2009/08/,H1N1,HQ853519    ............................T.................        1      1 ,      1      1      20:>A/KOL/927/2009,2009/08/,H1N1,HQ853519    
              
                 4 >A/KOL/507/2007,2007/05/,H1N1,HQ853495    ....T...............................A.........        2      2 ,      2      2       4:>A/KOL/507/2007,2007/05/,H1N1,HQ853495    
                 5 >A/KOL/526/2007,2007/05/,H1N1,HQ853496    ..C.T...............................A..T......        4      4 ,      4      4       5:>A/KOL/526/2007,2007/05/,H1N1,HQ853496    
                32 >A/KOL/565/2007,2007/06/,H1N1,HQ853498    .TG.T..A............................A......G..        6      6 ,      6      6      32:>A/KOL/565/2007,2007/06/,H1N1,HQ853498    
                33 >A/KOL/578/2007,2007/06/,H1N1,HQ853499    ....T.........G......A..........A....G...C....        6      6 ,      6      6      33:>A/KOL/578/2007,2007/06/,H1N1,HQ853499    
                21 >A/KOL/611/2007,2007/06/,H1N1,HQ853501    ....T....................A....................        2      2 ,      2      2      21:>A/KOL/611/2007,2007/06/,H1N1,HQ853501    
                22 >A/KOL/2172/2009,2009/09/,H1N1,HQ853520   ....T......................T..................        2      2 ,      2      2      22:>A/KOL/2172/2009,2009/09/,H1N1,HQ853520   
                23 >A/KOL/990/2007,2007/07/,H1N1,HQ853515    ....T.....................C...........A.......        3      3 ,      3      3      23:>A/KOL/990/2007,2007/07/,H1N1,HQ853515    
              
                 6 >A/KOL/943/2007,2007/07/,H1N1,HQ853507    ..C.T.......................T.................        3      3 ,      3      3       6:>A/KOL/943/2007,2007/07/,H1N1,HQ853507    
                 7 >A/KOL/918/2007,2007/07/,H1N1,HQ853502    ....T......T................T.................        3      3 ,      3      3       7:>A/KOL/918/2007,2007/07/,H1N1,HQ853502    
                 8 >A/KOL/919/2007,2007/07/,H1N1,HQ853503    ....T......T................T.................        3      3 ,      3      3       8:>A/KOL/919/2007,2007/07/,H1N1,HQ853503    
                 9 >A/KOL/936/2007,2007/07/,H1N1,HQ853505    ....T.......................T...............A.        3      3 ,      3      3       9:>A/KOL/936/2007,2007/07/,H1N1,HQ853505    
                10 >A/KOL/937/2007,2007/07/,H1N1,HQ853506    C...T.......................T.................        3      3 ,      3      3      10:>A/KOL/937/2007,2007/07/,H1N1,HQ853506    
                11 >A/KOL/956/2007,2007/07/,H1N1,HQ853509    C...T.......................T.................        3      3 ,      3      3      11:>A/KOL/956/2007,2007/07/,H1N1,HQ853509    
                12 >A/KOL/951/2007,2007/07/,H1N1,HQ853508    C...TA......................T.................        4      4 ,      4      4      12:>A/KOL/951/2007,2007/07/,H1N1,HQ853508    
                13 >A/KOL/985/2007,2007/07/,H1N1,HQ853514    C...T.......G...............T.................        4      4 ,      4      4      13:>A/KOL/985/2007,2007/07/,H1N1,HQ853514    
                14 >A/KOL/2218/2009,2009/09/,H1N1,HQ853521   C...T............T..........T.................        4      4 ,      4      4      14:>A/KOL/2218/2009,2009/09/,H1N1,HQ853521   
                15 >A/KOL/2218/2009,2009//,H1N1,HM460502     C...T............T..........T.......----------       14     14 ,      4      4      15:>A/KOL/2218/2009,2009//,H1N1,HM460502     
                31 >A/KOL/975/2007,2007/07/,H1N1,HQ853513    C...T...............C.......T...........A.....        5      5 ,      5      5      31:>A/KOL/975/2007,2007/07/,H1N1,HQ853513    
                16 >A/KOL/958/2007,2007/07/,H1N1,HQ853510    ....T.......................T............C....        3      3 ,      3      3      16:>A/KOL/958/2007,2007/07/,H1N1,HQ853510    
                17 >A/KOL/964/2007,2007/07/,H1N1,HQ853511    ....T.......................T.....C...........        3      3 ,      3      3      17:>A/KOL/964/2007,2007/07/,H1N1,HQ853511    
                24 >A/KOL/2172/2009,2009//,H1N1,HM460501     ....T.G..A..................T.......----------       14     14 ,      4      4      24:>A/KOL/2172/2009,2009//,H1N1,HM460501     
                25 >A/KOL/2449/2009,2009//,H1N1,HM460503     ....T.G..A..................T.......----------       14     14 ,      4      4      25:>A/KOL/2449/2009,2009//,H1N1,HM460503     
                26 >A/KOL/2465/2009,2009//,H1N1,HM460504     ....T.G..A.............G....T.......----------       15     15 ,      5      5      26:>A/KOL/2465/2009,2009//,H1N1,HM460504     
                27 >A/KOL/2465/2009,2009/09/,H1N1,HQ853524   ....T.G..A.............G....T............C....        6      6 ,      6      6      27:>A/KOL/2465/2009,2009/09/,H1N1,HQ853524   
                28 >A/KOL/2449/2009,2009/09/,H1N1,HQ853523   ....T.G..A..................T............CT...        6      6 ,      6      6      28:>A/KOL/2449/2009,2009/09/,H1N1,HQ853523   
                29 >A/KOL/929/2007,2007/07/,H1N1,HQ853504    ..TTT.......................T.................        4      4 ,      4      4      29:>A/KOL/929/2007,2007/07/,H1N1,HQ853504    
                30 >A/KOL/2482/2009,2009/09/,H1N1,HQ853525   ....T..................G....TG................        4      4 ,      4      4      30:>A/KOL/2482/2009,2009/09/,H1N1,HQ853525   
                                                                                                            
              ---Index---------------------------------------TAAACGAGCGAGATAACCGAAGAAGGAGCATTGAACGAGCGTGAGG 
              -codon-position-------------------------------- 21221 1   2  2 1 1  2 1  2 1  2  211  2       
                                                             0000000000000000000000000000000000000000000000 
                                                             0000000001111122222333334444444566667777777788 
                                                             0555677890146701268234682223379134570134455914 
                                                             6089505835438190973707623682978538990750769290
              Code:
                                                             00000000000000 
                                                             01113444677777 
                                                             76788015603335 
                                                             93866463191581 
              -codon-position--------------------------------111 222 112  1 
              ---Index---------------------------------------CAGGTGACGATACC 
                 1 >Index/USA-2007                           ..............        0      0 ,      0      0       1:>Index/USA-2007                           
                 3 >2007/02/06,14278,AUS,A/Brisbane/10/07    ..............        1      0 ,      1      0       3:>2007/02/06,14278,AUS,A/Brisbane/10/07    
                 4 >Index/Brisbane-like/2007                 ..............        0      0 ,      0      0       4:>Index/Brisbane-like/2007                 
                 5 >Index/Perth-like/2009                    ..............        2      0 ,      2      0       5:>Index/Perth-like/2009                    
              
                10 >A/KOL/595/2007,2007/06/,H3N2,HQ853528    .G..........T.        2      2 ,      2      2      10:>A/KOL/595/2007,2007/06/,H3N2,HQ853528    
                11 >A/KOL/1075/2007,2007/08/,H3N2,HQ853532   .G..........T.        2      2 ,      2      2      11:>A/KOL/1075/2007,2007/08/,H3N2,HQ853532   
                12 >A/KOL/1728/2008,2008/07/,H3N2,HQ853538   .G..........T.        2      2 ,      2      2      12:>A/KOL/1728/2008,2008/07/,H3N2,HQ853538   
                13 >A/KOL/1691/2008,2008/06/,H3N2,HQ853536   .G.....T....T.        3      3 ,      3      3      13:>A/KOL/1691/2008,2008/06/,H3N2,HQ853536   
                14 >A/KOL/1822/2008,2008/07/,H3N2,HQ853540   .G.....T....T.        3      3 ,      3      3      14:>A/KOL/1822/2008,2008/07/,H3N2,HQ853540   
                15 >A/KOL/1537/2008,2008/05/,H3N2,HQ853533   .G.....T......        2      2 ,      2      2      15:>A/KOL/1537/2008,2008/05/,H3N2,HQ853533   
                16 >A/KOL/1687/2008,2008/06/,H3N2,HQ853534   .G.....T....T.        4      3 ,      4      3      16:>A/KOL/1687/2008,2008/06/,H3N2,HQ853534   
                17 >A/KOL/1690/2008,2008/06/,H3N2,HQ853535   .G...AGT...G..        5      5 ,      5      5      17:>A/KOL/1690/2008,2008/06/,H3N2,HQ853535   
                18 >A/KOL/1525/2009,2009/08/,H3N2,HQ853545   .....AG....G..        3      3 ,      3      3      18:>A/KOL/1525/2009,2009/08/,H3N2,HQ853545   
                19 >A/KOL/402/2009,2009/08/,H3N2,HQ853542    .....AG....G..        3      3 ,      3      3      19:>A/KOL/402/2009,2009/08/,H3N2,HQ853542    
                20 >A/KOL/779/2009,2009/08/,H3N2,HQ853543    .....AG....G..        3      3 ,      3      3      20:>A/KOL/779/2009,2009/08/,H3N2,HQ853543    
                21 >A/KOL/857/2009,2009/08/,H3N2,HQ853544    .....AG....G..        3      3 ,      3      3      21:>A/KOL/857/2009,2009/08/,H3N2,HQ853544    
                22 >A/KOL/2309/2009,2009/09/,H3N2,HQ853546   .....AG....G..        3      3 ,      3      3      22:>A/KOL/2309/2009,2009/09/,H3N2,HQ853546   
                23 >A/KOL/2312/2009,2009/09/,H3N2,HQ853547   .....AG....G..        3      3 ,      3      3      23:>A/KOL/2312/2009,2009/09/,H3N2,HQ853547   
                24 >A/KOL/2321/2009,2009/09/,H3N2,HQ853548   .....AG....G..        3      3 ,      3      3      24:>A/KOL/2321/2009,2009/09/,H3N2,HQ853548   
                25 >A/KOL/2404/2009,2009/09/,H3N2,HQ853549   .....AG....G..        3      3 ,      3      3      25:>A/KOL/2404/2009,2009/09/,H3N2,HQ853549   
              
                 6 >Index/2009/Egypt/Iowa                    .....AG....G..        3      3 ,      3      3       6:>Index/2009/Egypt/Iowa                    
              
                26 >A/KOL/1708/2008,2008/07/,H3N2,HQ853537   TG............        3      2 ,      3      2      26:>A/KOL/1708/2008,2008/07/,H3N2,HQ853537   
                27 >A/KOL/1762/2008,2008/07/,H3N2,HQ853539   T...C........T        3      3 ,      3      3      27:>A/KOL/1762/2008,2008/07/,H3N2,HQ853539   
                28 >A/KOL/1810/2008,2008/07/,H3N2,HQ853541   ....C.........        3      1 ,      3      1      28:>A/KOL/1810/2008,2008/07/,H3N2,HQ853541   
                29 >A/KOL/524/2007,2007/05/,H3N2,HQ853527    ....C...AGC...        4      4 ,      4      4      29:>A/KOL/524/2007,2007/05/,H3N2,HQ853527    
                30 >A/KOL/960/2007,2007/07/,H3N2,HQ853529    ....C...AGC...        4      4 ,      4      4      30:>A/KOL/960/2007,2007/07/,H3N2,HQ853529    
                31 >A/KOL/989/2007,2007/07/,H3N2,HQ853530    ....C...AGC...        4      4 ,      4      4      31:>A/KOL/989/2007,2007/07/,H3N2,HQ853530    
                32 >A/KOL/600/2007,2007/06/,H3N2,HQ853526    ..AA...TAGC...        6      6 ,      6      6      32:>A/KOL/600/2007,2007/06/,H3N2,HQ853526    
                33 >A/KOL/994/2007,2007/07/,H3N2,HQ853531    ..AA...TAGC...        6      6 ,      6      6      33:>A/KOL/994/2007,2007/07/,H3N2,HQ853531    
              
                 7 >A/Index_Fujian/2002(H3N2)                ........AGC...        3      3 ,      3      3       7:>A/Index_Fujian/2002(H3N2)                
                 8 >A/Index_Fujian/USA/2003(H3N2)            ........AGC...        3      3 ,      3      3       8:>A/Index_Fujian/USA/2003(H3N2)            
                 9 >A/Index_Fujian_reass./2003/06(H3N2)      ........AGCG.T       18      5 ,     18      5       9:>A/Index_Fujian_reass./2003/06(H3N2)      
                 2 >A/Wisconsin/67/2005/08/                  ........AGC...        4      3 ,      4      3       2:>A/Wisconsin/67/2005/08/                  
              
                                                                            
              ---Index---------------------------------------CAGGTGACGATACC 
              -codon-position--------------------------------111 222 112  1 
                                                             00000000000000 
                                                             01113444677777 
                                                             76788015603335 
                                                             93866463191581
              Code:
                                                             00000000000000000000000000000000000000000000000000000000000 
                                                             00000001111111112222222333333333344444455555556666667777888 
                                                             00366882334456790145679000113477711123313346991466782238023 
                                                             79634143184703468038431378781028904906822799493301007974338 
              -codon-position--------------------------------1   1   2    1 11       122 11  12 2 1 21  2 211 1121 21211 
              ---Index---------------------------------------TCCGTGTGGACTTGCGAGTTCTGCTTTGGTGGATCGGCAAGGAAAGACGAAATGAACGA 
                 8 >A/Brevig Mission/1/1918,1918//           ...........................................................        0      0 ,      0      0       8:>A/Brevig Mission/1/1918,1918//           
                 6 >A/Index/early human                      C.TAGA......C.....G...A......C....T..T.........A..GGC......       15     15 ,     15     15       6:>A/Index/early human                      
              
                 1 >A/KOL/536/2007,2007/06/,H1N1,HQ853497    CATAGA.A.G....A..AGGT.A..C.A.C....T..TGC.A.CT..AAGGGCA.T..G       33     33 ,     33     33       1:>A/KOL/536/2007,2007/06/,H1N1,HQ853497    
                 2 >A/KOL/596/2007,2007/06/,H1N1,HQ853500    CATAGA.A.G....A..AGGTCAA.C.A.C.A..T..TGC.A.....AAGGGCAGT.A.       35     35 ,     35     35       2:>A/KOL/596/2007,2007/06/,H1N1,HQ853500    
                 3 >A/KOL/968/2007,2007/07/,H1N1,HQ853512    CATAGA.A.G....A..AGGTCAA.C.A.C.A..T..TGC.A.....AAGGGCAGT.A.       35     35 ,     35     35       3:>A/KOL/968/2007,2007/07/,H1N1,HQ853512    
                 4 >A/KOL/230/2009,2009/08/,H1N1,HQ853517    CATAGA.A.G....A..AGGTCAA.C.A.C.A..T..TGC.A.....AAGGGCAGT.A.       35     35 ,     35     35       4:>A/KOL/230/2009,2009/08/,H1N1,HQ853517    
                 5 >A/KOL/2086/2009,2009/09/,H1N1,HQ853522   CATAGA.A.G....A..AGGTCAA.C.A.C.A..T..TGC.A.....AAGGGCAGT.A.       35     35 ,     35     35       5:>A/KOL/2086/2009,2009/09/,H1N1,HQ853522   
              
                11 >A/Puerto Rico/8/1934,1934//              CATAGA.A.G....A..AGGTCAA.C.A.C.A..T..TGC.A.....AAGGGCAGT.A.       35     35 ,     35     35      11:>A/Puerto Rico/8/1934,1934//              
                12 >A/Puerto Rico/8/1934,1934//              CATAGA.A.GT.CAA..AGGT.A..C.A.C....T..TGC.A.....AAGGGCA.T..G       34     34 ,     34     34      12:>A/Puerto Rico/8/1934,1934//              
              
                22 >A/Melbourne/1/1946,1946//                C.TAGA......C..AG.GG..A.C...ACA...TAAT.GA....ACA..GGC....A.       28     28 ,     28     28      22:>A/Melbourne/1/1946,1946//                
                20 >A/Phila/1935,1935//                      C.TAGA.AA...C.A...GG..A...G..C..G.T..TG.A......A.GGGC..GA.-       27     27 ,     26     26      20:>A/Phila/1935,1935//                      
              
                17 >A/Puerto Rico/8-1/1934,1934//            ..TAGA.A.G..C.A..AGGT.A..C.A.C....T..TGC.A.....AAGGGCA.T..G       30     30 ,     30     30      17:>A/Puerto Rico/8-1/1934,1934//            
                 7 >A/Puerto Rico/8-1/1934(H1N1)             ..TAGA.A.G..C.A..AGGT.A..C.A.C....T..TGC.A.....AAGGGCA.T..G       30     30 ,     30     30       7:>A/Puerto Rico/8-1/1934(H1N1)             
                10 >A/Puerto Rico/8/1934,1934//              CATAGA.A.G.CC.A..AGGT.A..C.A.C...AT..TGC.AG....AAGGGCA.T..G       35     35 ,     35     35      10:>A/Puerto Rico/8/1934,1934//              
                13 >A/Puerto Rico/8/34/Mount Sinai,1934//    CATAGA.A.G.CC.A..AGGT.A..C.A.C....T..TGC.AG....AAGGGCA.T...       33     33 ,     33     33      13:>A/Puerto Rico/8/34/Mount Sinai,1934//    
                15 >A/Puerto Rico/8/1934,1934//              CATAGA.A.GTCC.A..AGGT.A..C.A.C....T..TGC.AG....AAGGGCA.T..G       35     35 ,     35     35      15:>A/Puerto Rico/8/1934,1934//              
                11 >A/Puerto Rico/8/1934,1934//              CATAGA.A.G....A..AGGTCAA.C.A.C.A..T..TGC.A.....AAGGGCAGT.A.       35     35 ,     35     35      11:>A/Puerto Rico/8/1934,1934//              
                23 >A/Leningrad/1954/1,1954//                CATAGA.A.GT.CAA..AGGTCA..C.A.C....T..TGC.A.....AAGGGCA.T..G       35     35 ,     35     35      23:>A/Leningrad/1954/1,1954//                
                14 >A/Puerto Rico/8/1934,1934//              CATAGA.A.GT.CAA..AGGT.A..C.A.C....T..TGC.A.....AAGGGCA.T..G       34     34 ,     34     34      14:>A/Puerto Rico/8/1934,1934//              
                16 >A/Puerto Rico/8-SV14/1934,1934//         CATAGACA.GT.CAA..AGGT.A..C.A.C....T..TGC.A.....AAGGGCA.T..G       35     35 ,     35     35      16:>A/Puerto Rico/8-SV14/1934,1934//         
                18 >A/Puerto Rico/8-WG/1934,1934//           CATAGACA.GT.CAA..AGGT.A..C.A.C....T..TGC.A.....AAGGGCA.T..G       35     35 ,     35     35      18:>A/Puerto Rico/8-WG/1934,1934//           
                19 >A/Alaska/1935,1935//                     CATAGA.A.GT.CAA..AGGT.A..C.A.C....T..TGC.A.....AAGGGCA.T...       33     33 ,     33     33      19:>A/Alaska/1935,1935//                     
                21 >A/Henry/1936,1936//                      CATAGA.A.G..C.A...GG..A..C.A.C....T..TG........A.GGGCAGT...       27     27 ,     27     27      21:>A/Henry/1936,1936//                      
                                                                                                                         
              ---Index---------------------------------------TCCGTGTGGACTTGCGAGTTCTGCTTTGGTGGATCGGCAAGGAAAGACGAAATGAACGA 
              -codon-position--------------------------------1   1   2    1 11       122 11  12 2 1 21  2 211 1121 21211 
                                                             00000000000000000000000000000000000000000000000000000000000 
                                                             00000001111111112222222333333333344444455555556666667777888 
                                                             00366882334456790145679000113477711123313346991466782238023 
                                                             79634143184703468038431378781028904906822799493301007974338

              ---------------------------------------------------------------
              Pune India, 10 flu-outbreaks 1978-1990, 10 in Jun-Sep,3 in Mar-May,1 in Nov-Feb,2 in Feb-Mar
              ------------------------------------------------------------------


              A/KOL/968/2007/07(H1N1) segment 2 (H3N2-like)
              has C141T and A155G just as Perth-like/2009
              but also C28A,T1887C,G2193A just like the other KOL-H1N1 sequences.
              Looks like another "dirty-chromatogram"-pseudo recombination,presumably they
              had sequenced other Perth-like H3N2s before with that machine/procedure.



              A/KOL/1762/2008/07/(H3N2) and A/KOL/1819/2008/07(H3N2) had T386C in segment 8,
              like 3 of the other KOL-2007 sequences, which however were the old Wisconsin/2005 strain
              while the 2 former were the new 2007-strain.
              This could be another "dirty-chromatogram"-pseudo recombination, but less clear with
              just one mutation.

              A/KOL/1690/2008/06/(H3N2) has A163G and C453T in segment 8 like 4 of the other KOL
              non-Egypt/Iowa sequences from summer 2008, but then it also has the 3 Egypt/Iowa
              mutations G404A,A416G,A735G, so this looks like another clear "dirty chromatogram"-
              pseudo-recombination
              I'm interested in expert panflu damage estimates
              my current links: [url]http://bit.ly/hFI7H[/url] ILI-charts: [url]http://bit.ly/CcRgT[/url]

              Comment


              • #8
                Re: H3n2

                >12000 H3N2-HA at genbank. Lots from Malaysia since 1995 yesterday.

                trying to detect, where/when those mutations that are established today
                emerged first :

                Code:
                monthly appearances of current ("Egypt/Iowa") H3N2-HA mutations in quantity > 0.1&#37; of all mutations
                program 32s4db2.bas
                
                        CTCCCGCGCAAGATGGACAGTGGACGGAAAGAATGGGTTTTGCCCTTAGATTCGGTCGGTGGGAAAGCGGGCGTCCCAACGGAAGCTTGCCATCAACACAACAGTGGCGGGAAGCTGGGCGTTTGGGGATTATCCCTGCCGTATCCTTGCTCATAACAGCGGGCCAAACCCTCCATCGGAAGGACGACCATTCTTCGGGGGACCCTAGGTCTATATACGCTCGG
                        00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000111111111111111111111111111111111111111111111111111111111111111
                        00000000000000111111111111112222222222222223333333344444444444444444444444445555555555555555555666666666666666666777777777777777777777888888888888889999999999999000000001111111111222222222223333333334444444445555555555566666
                        03344445567999002233445789990011333467888990122599911112234455555677778888990111222222333366677001111222345666788001122222356777888999011233567777782233455666689013458892346788999000133357891233466780023477880124566778923467
                        91313782408369580189476432565989235643125269879703903780554701278725892349294468012347167845779460358356582089825252412467292278069128419813572356914706447038973519467928097389478059203945404058725463681636450278706587607280
                        TCATTCTAATGTGCAAGAGACATGTATGGGAGGAAAAGGCCAATACAGACAAAAACAAACAACTCTATAAATACTTTCCTAACTTACCATACATGGTGAGCTTTCAAAAAAGGATAAAAACCCAAATTGCCCATTACAAGACGCAACAAACTGCGCTGATAAAATGGGTAGCATGCTATGGACGTACTTGACTCCTAAAAAGTTTCGAACTCGAGAGTATCTAA
                        --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
                1968/01 00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
                1980/06 00000000000000000000000000000000000000000000000000101111110000010001011011001100010001000000001001100001000010000010000000011101000000101100001100110000000000000000000000000000000000000000000000000000000000000000000000000000
                1981/02 00000000000000000000000000000000000000000000000110101111110000011001011011001100010001000000001001100001000010000010000000111101000001100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
                1982/06 10011101010000101011000111101100011010111011000010101101110000010001111011000100010001000000111001100001000010001010000000011101001100101100001100110000001011010001001000001001100001000000100100110110110010101000001100100011
                1985/01 10011101110000101011000111101100011010111011000110101101110000010001011011011110010001010000111001100001000010001010000000011101101100101100001100111001001011010001001000001001101001000000100101110110110010101000001100100011
                1989/12 00011101110100101011110111111100011010111111001110101101110000010001011011011000010111010000111001100001000011001010000000011101101110101110011100111001101011111001001000001001101001000000100100110110110011101001001100100011
                1990/01 00011101110100101011110111111100011010111111001110101100110000010001011011011100010111010000111001100001000011001010000000011101101110101110011100111001101011111001001000001001101001000000100100110110110011101001001100100011
                1991/11 10111101110000101011010111101100011010111111001110111101110000110001011111111100011111010000111001100000000011101000000000011111101110101110111100111100101011111001001000001001101001000000100111110110110011101001001101100011
                1991/12 10111101110000101011010111101100011010111111001110111101110000110001011111111100011111010000111001100000000011101000000000011111101110101110111100111100101011111001001000001001101001000000100111110110110011101001001101100011
                1992/01 10111101110010101011010111101100011010111111001110111101110000110001011111111100011111010000111001100000000011101000000000011111101110101110111100111101101011111001001000001001101001000000100111110110110011101001001101100011
                1992/02 10111111110010101011010111101100011010111111001110101101110000110001011111111100010111010000111001100000000011101000000000011111101111101110011100111101101011111001001000001001101001000000100111110110110011101001001101100011
                1992/03 01101101110000101011010111101100011010111111001110111101110000110001011111111100011111010000111001100000000011101000000000011111101110101110111100111100101011111101001000001001101001000000100111110110110011101001001101100011
                1992/04 10111101110000101011010111101100011010111111001110111101110000110001011111111100011111010000111001100000000011101100000000011111101110101110111100111100101011111001001000001001101001000000100111110110110011101001001101100011
                1992/11 10111111110010101011010111101100011010111111001110101101110000110001011111111100010111010000111001111000000011101010000000011111101111101111011100111101101111111001001000001001101001000100100111111110110011101001001101100011
                1993/01 10111111110000101011010111101100011010111111001110101101110000010001011011111001010111010000111001111000000011101010000000011111101111101111011110111101101101111001001000001001101001000110100111111110110011101001001101100011
                1993/02 10111111110001101011010111101100011010111111001110101101110001110001011011111001010111010000111001111000000011101010000000011111101111101111011110111101101101111001001000001001101001000100100111111110110011101001001101100011
                1993/03 10111111110001101011010111101100011010111111001110101101110001110001011011111001010111010000111001111000000011101010000000011111101111101111011110111101101101111001001000001001101001000100100111111110110011101001001101100011
                1993/04 10111111110001101011010111101100011010111111001110101101110001110001011111111001011111010000111001111000000011101010000000011111101111101111111110111101101101111001001000001001101001000100100111111110110011101001001101100011
                1993/11 10111111110001101011010111101100011010111111001110111101110001110001011011111001010111010000111001111000000011101010000000011111101111101111011110111101101101111001001000001001101001000100100111111110110011101001001101100011
                1993/12 10111111110001101011010111101100011010111111001110111101110001110001011111111001010111010000111001111000000011101010000000011111101111101111011110111101101101111001001000001001101001000100100111111110110011101001001101100011
                1994/01 10111111110001101011010111101100011010111111001110101101110001110001011011111001010111010000111001111000000011101010000000011111101111101111011110111101101101110001001000001001101001000100100111111110110011101001001101100011
                1994/02 10111111110001101011010111101100011010111111001110101101110001110001011011111001010111010000111001111000000011101010000000011111101111101111011110111101101101110001001000001001101001000100100111111110110011101001001101100011
                1994/03 10111111110001101011010111101100011010111111001110101101110001110001011011111001010111010000111001111000000011101010000000011111101111101111011110111101101101110001001000001001101001000100100111111110110011101001001101100011
                1994/06 10111111110001101011010111101100011010111111001110101111110001110001011011111001010111010000111001111000000011101010000000011111101111101111011110111101101111111001001000001011101101000100100111111110110111101001001101100011
                1994/07 11111111110001001011010111101100011010111111001110101101110011110001011011111001010111010000111001111000100011101010000000010111101111101110011110111101101101110001001000001001101001010100100111111110110011101001001101100111
                1994/11 10111111110001001011010111101100011010111111011110101101110001110001011011111001010111010010111001111000000011101010000000011111101111101111011110111101101101110001001000001001101001000000100111111110110011101001001101100011
                1994/12 10111111110001101011010111101100011010111111001110111111110001110001011011111001010111010000111001111000000011101010000000011111101111101111011110111101101101111001001000001001101001000100100010111110110111101001001101100011
                1995/01 10111111110001101011010111101100011010111111001110111111110001110001011011111001010111011000111001111000000011101010000110011111111111101111011110111101101111111001001000001011101001000100100111111110110111101001001101100011
                1995/02 10111111110001101011010111101100011010111111001110111111110001110001011011111001010111011000111001111000000011101010000110011111111111101111011110111101101111111001001000001011101001000100100111111110110111101001001101100011
                1995/03 10111111110001101011010111101100011010111111001110111111110001110001011011111001010111010000111001111000000011101010000000011111101111101111011110111101101101111001001000001001101001000100100010111110110111101001001101100011
                1995/04 00000001110001101011010111101100011010111111001110111111110001110001011011111101010111010000111001111000000011101010000000011111101111101111011110111101101101111000000000000000000000000000000000000000000000000000000000000000
                1995/07 10101111110001101011010111101100011010111111001110111101110001110001011011111001010111011000111001111000000011101000000110011111111111101111010110111101101111111001001000001101101001000100100111011110110011101001001101100011
                1995/08 00000001111001101011110111101100011010111111001111111101110011110001011111111001010111011000111011111000000011101010000110111111111111101111011110111101101111111000000000000000000000000000000000000000000000000000000000000000
                1995/09 10111111111001101011110111101100111010111111001111111101110011110001011111111001010111011000111011111100100011101010000110111111111111101111011110111101101111111001001000001001101001000101100111111110110011101011001101100011
                1995/11 10111111110001101011010111101100011010111111001110111101110001110001011011111001010111011000101001111000000011101000000110011111111111101111010110111101101111111001001000001101101001000110100111011110110011101001001101100011
                1995/12 10111111110001101011010111101100011110111111001110111101110001110001011111111001010111011000111001111000000011101000000110011111111111101111010110111101101111111001001000001101101001000110100111011110110011101001001101100011
                1996/01 10111111111001101011110111101100011010111111001111111111110011110001011111111001010111011000111011111000000011101010000110111111111111101111011110111101101111111001001000001101101001000110100111011110110011101001001101100011
                1996/02 10111111111001101011110111101100011010111111001111111111110011110001011111111001010111011000111011111000000011101010000110111111111111101111010110111101101111111001001000001101101001000100100111011110110011101001001101100011
                1996/03 10111111111001101011110111101101011010111111001111111111110011110001011111111001011111111000111011111101000011101010000110111111111111101111011110111101101111111001001000001001101001000100100111111110110111101001001101100011
                1996/04 10111111111001101011110111101100011010111111001111111111110011110001011111111001010111011000111011111000000011101010000110111111111111101111011110111101101111111001001000001001101001000100100111111110110011101001001101100011
                1996/05 10111111111001101011110111101100011010111111001111111111110011110011011111111001010111011000111011111000000011101110000110111111111111101111011110111101101111111001001000001001101001000100100111111110110011101001001101100011
                1996/06 10111111111001101011110111101100011010111111001111111101110011110001011111111001010111011000111011111000000011101010000110111111111111101111011110111101101111111001001000001001101001000100100111111110110011101001001101100011
                1996/07 10111111111001101011110111101100011010111111001111111111110011110011011111111001010111011000111011111000000011101110000110111111111111101111011110111101101111111001001000001001101001000100101111111110110011101001001101110011
                1996/09 10111111111001101011110111101110111110111111011111111111110011111011111111111101110111011010111011111100100011101110000110111111111111101111011111111101101111111001011100001001101001001100111111111111111111101001001101110011
                1996/10 11111111111001101011110111101110111110111111011111111111110011111011111111111101110111011010111011111100100011101110000110111111111111101111011111111101101111111001011100001001101001001100111111111111111111101001001101110011
                1996/11 10111111111001101011110111101110011010111111001111111111110011110011011111111001010111011000111011111000000011101110000110111111111111101111011110111101101111111001001000001001101001000100101111111110110011101001001101110011
                1996/12 10111111111001101011110111101110011010111111001111111111110011110011011111111001010111011000111011111000000011101110000110111111111111101111011110111101101111111001001000001001101001000100101111111110110011101001001101110011
                1997/01 10111111111001101011110111101110011010111111001111111111110011110011011111111001010111011000111011111000000011101110000110111111111111101111011110111101101111111001001000001001101001000100100111111110110011101001001101100011
                1997/03 10111111111011111011110111101110111110111111011111111111110011111011111111111101110111011010111011111100100011101110000110111111111111101111111111111101101111111001011100001001101011001100111111111111111111101001001101110011
                1997/04 10111111111001101011110111101100011010111111001111111101110011110011011111111001010111011000111011111000000011101110000110111111111111101111010110111100101111111001001000001001101001000100100111111110110011101001001101100011
                1997/06 10111111111001101011110111101110111110111111011111111111110011111011111111111101110111011010111011111100100011101110000110111111111111101111011111111101101111111001011100001001101001101100111111111110111111101001001101110011
                1997/07 10111111111001101011110111101100111010111111011111111111110011110011011111111001010111011000111011111100100011101110000110111111111111101111011111111101101111111001001000001001101001000100111111111110110011101001001101110011
                1997/08 10111111111011111011110111101110111110111111011111111111110011111011111111111101110111011010111011111100100011101110000110111111111111101111111111111101101111111101011101001001101011001100111111111111111111101001001101110011
                1997/11 10111111111001101011110111101100111010111111011111111111110011110011111111111101110111011000111011111000100011101110000110111111111111101111011111111101101111111001001000001001101001001100111111111110111111101001001101110011
                1997/12 10111111111001101011110111101100111010111111011111111111110011110011111111111101110111011000111011111000100011101110000110111111111111101111011111111101101111111001001000001001101001001100111111111110111111101001001101110011
                1998/01 10111111111001101011110111101100111010111111011111111111110011110011111111111101110111011000111011111000100011101110000110111111111111101111011111111101101111111001001100001001101001001100111111111110111111101001001101110011
                1998/02 10111111111001101011110111101100111010111111011111111111110011110011111111111101110111011000111011111000100011101110000110111111111111101111011111111101101111111001001000001001101001001100111111111110111111101001001101110011
                1998/03 10111111111001101011110111101100111010111111011111111111110011111011111111111101110111011000111011111000100011101110000110111111111111101111011111111101101111111001001000001001101001001100111111111110111111101001001101110011
                1998/04 00000001111001101011110111101100111010111111011111111111110011111011111111111101110111011000111011111000100011101110000110111111111111101111011111111101101111111000000000000000000000000000000000000000000000000000000000000000
                1998/05 10111111111001101011110111101100111010111111011111111111110011111011111111111101110111011000111011111000100011101110000110111111111111101111011111111101101111111001011100001001101001001100111111111110111111101001001101110011
                1998/06 10111111111001101011110111101100111010111111011111111111110011111011111111111101111111011000111011111000100011101110000110111111111111101111011111111101101111111001011100001001101001001100111111111110111111101001001101110011
                1998/07 10111111111001101011110111101100111010111111011111111111110011111011111111111101110111011000111011111000100011101110000110111111111111101111011111111101101111111001001000001001101001001100111111111110111111101001001101110011
                1998/08 10111111111001101011110111101100111010111111011111111111110011111011111111111101110111011000111011111000100011101110000110111111111111101111011111111101101111111001001000001001101001001100111111111110111111101001001101110011
                1998/09 10111111111001101011110111101100111010111111011111111111110011111011111111111101110111011000111011111000100011101110000110111111111111101111011111111101101111111001001000001001101001001100111111111110111111101001001101110011
                1998/10 00000001111001101011110111101100111010111111011111111111110011111011111111111101110111011000111011111000100011101110000110111111111111101111011111111101101111111000000000000000000000000000000000000000000000000000000000000000
                1998/11 10111111111001101111110111101110111010111111011111111111110011111011111111111101110111011000111011111000100011101110000110111111111111101111011111111101101111111001011100001001101001001100111111111110111111101001001101110011
                1998/12 10111111111011101011110111101110111110111111011111111111110011111011111111111101110111011010111011111100100011101110000110111111111111101111011111111101101111111001011100001001101001001100111111111111111111101001001101110011
                1999/01 10111111111011101011110111101110111110111111011111111111110011111011111111111101110111011010111011111100100011101110000110111111111111101111011111111101101111111001011100001001101001001100111111111111111111101001001101110011
                1999/02 10111111111011101011110111101110111110111111011111111111110011111011111111111101110111011010111011111100100011101110000110111111111111101111011111111101101111111001011100001001101001001100111111111111111111101001001101110011
                1999/03 10111111111011101011110111101110111110111111011111111111110011111011111111111101110111011010111011111100100011101110000110111111111111101111011111111101101111111001011100001001101001001100111111111111111111101001001101110011
                1999/04 10111111111011101011110111101110111110111111011111111111110011111011111111111101110111011010111011111100100011101110000110111111111111101111011111111101101111111001011100001001101001001100111111111111111111101001001101110011
                1999/05 10111111111001101011110111101110111010111111011111111111110011111011111111111101110111011000111011111000100011101100000110111111111111101111011111111101101111111001010100001001101001001100111111111110111111101011001101110011
                1999/06 10111111111001101011110111101110111010111111011111111111110011111011111111111101110111011000111011111000100011101100000110111111111111101111011111111101101111111001010100001001101001001100111111111110111111101001001101110011
                1999/07 10111111111001101011110111101110111010111111011111111111110011111011111111111101110111011000111011111000100011101100000110111111111111101111011111111101101111111001010100001001101001001100111111111110111111101001001101110011
                1999/08 10111111111001101011110111101110111110111111011111111111110011111011111111111101110111011010111011111100100111101110000110111111111111101111011111111101101111111001010100001001101001001100111111111110111111101011001101110011
                1999/09 10111111111011101011110111101110111110111111011111111111110011111011111111111101110111011010111111111100100011101110000110111111111111101111011111111101101111111001011100001011101001001100111111111111111111101001001101110011
                1999/10 10111111111011101011110111101110111110111111011111111111110011111011111111111101110111111010111011111100100011101110000110111111111111101111011111111101101111111001011100001001101001101100111111111111111111101001001101110011
                1999/11 10111111111001101011110111101110111110111111011111111111110011111011111111111101110111011010111011111100100011101110000110111111111111101111011111111101101111111001011100001001101001101100111111111110111111101001001101110011
                1999/12 10111111111001101011110111101110111110111111011111111111110011111011111111111101110111011010111011111100100011101110000110111111111111101111011111111101101111111001011100001001101001101100111111111110111111101001001101110011
                2000/01 10111111111001101011110111101110111110111111011111111111110011111011111111111101110111011010111011111100100011101110000110111111111111101111011111111101101111111001011100001001101001101100111111111110111111101001001101110011
                2000/02 10111111111001101011110111101110111110111111011111111111110011111011111111111101110111011010111011111100100011101110000110111111111111101111011111111101101111111001011100001001101001101100111111111110111111101001001101110011
                2000/03 10111111111011111011110111101110111110111111011111111111110011111011111111111101110111011010111011111100100011101110000110111111111111101111111111111101101111111001011100001001101001101100111111111110111111101001001101110011
                2000/04 00000001111011111011110111101110111110111111011111111111110011111011111111111101110111011010111011111100100011101110001111111111111111101111111111111101101111111000000000000000000000000000000000000000000000000000000000000000
                2000/05 10111111111011111011110111111110111110111111011111111111110011111011111111111101110111111010111011111100100011101110001110111111111111101111111111111101101111111101011000001001101001101100111111111110111111101001001101110011
                2000/06 00000001111001101011110111101110111110111111011111111111110011111011111111111101110111011010111011111100100011101110000110111111111111101111011111111101101111111000000000000000000000000000000000000000000000000000000000000000
                2000/07 10111111111011111011110111111110111110111111011111111111110011111011111111111101110111111110111011111100100011101110001110111111111111101111111111111101101111111001011100001001101011011100111111111111111111101001001101110011
                2000/08 10111111111011111011110111111110111110111111011111111111110011111011111111111101110111111010111011111100100011101110001110111111111111101111111111111101101111111001011100011001101011001110111111111111111111101001001101110011
                2000/09 10111111111011101011110111111110111110111111011111111111110011111011111111111101110111111010111011111100100011101110000110111111111111101111011111111101101111111001011100011001101001101110111111111111111111101001001101110011
                2000/10 10111111111011101011110111111110111110111111011111111111110011111011111111111101110111111010111011111100100011101110000110111111111111101111011111111101101111111001011100011001101001001110111111111111111111100001001101110011
                2000/11 10111111111011101011110111111110111110111111011111111111110011111011111111111101110111111010111011111100100011101110000110111111111111101111011111111101101111111001011100011001101001001110111111111111111111100001001101110011
                2001/01 10111111111011111011110111111110111110111111011111111111110011111011111111111101110111111010111111111100100011101110000110111111111111101111011111111101101111111001010100001001101001001100111011111111111111101001001101110011
                2001/02 00111111111011111011110111111110111110111111011111111111110011111011111111111101110111111010111111111100100011101110001110111111111111101111011111111101101111111000000000000000000000000000000000000000000000000000000000000000
                2001/03 10111111111011101011110111111110111110111111011111111111110011111011111111111101110111111010111011111100100011101110000110111111111111101111011111111101101111111001011100011001101001001100111111111111111111101001001101110011
                2001/04 10111111111011111011110111111110111110111111011111111111110011111011111111111101110111111010111011111100100011101110001110111111111111101111111111111101101111111001011100011001101011011110111111111111111111101001001101110011
                2001/05 10111111111011111011110111111110111110111111011111111111110011111011111111111101110111111010111011111100100011101110001110111111111111101111111111111101101111111001011110011001101011111110111111111111111111101011001101110011
                2001/07 10111111111011111011110111111110111110111111011111111111110011111011111111111101110111111010111011111100100011101110001110111111111111101111111111111101101111111001011100011001101011011110111111111111111111101011001101110011
                2001/08 10111111111011111011110111111110111110111111011111111111110011111011111111111101110111111010111111111100100011101110001110111111111111101111111111111101101111111001011100001001101011011100111111111111111111101001001101110011
                2001/09 10111111111011111011110111111110111110111111011111111111110011111011111111111101110111111010111111111100100011101110000110111111111111101111111111111101101111111011010100001001101001001100111011111111111111101001001101110011
                2001/10 10111111111011111011110111111111111110111111011111111111110011111011111111111111110111111110111111111100101011101111101111111111111111101111111111111101101111111011010100001001101001001100111011111111111111101001001101110011
                2001/11 10111111111111111011111111111111111110111111011111111111110011111011111111111101110111111110111111111100101011101111001110111111111111101111111111111101101111111001010100001001101001001100111011111111111111101001001101110011
                2001/12 10111111111111111011111111111111111110111111011111111111110011111011111111111101110111111110111111111100101011101111001110111111111111101111111111111101101111111001010100001001101001001100111011111111111111101001001101110011
                2002/01 10111111111111111011111111111111111110111111011111111111110011111011111111111101110111111110111111111100101011101111001110111111111111101111111111111101101111111001010100001001101001001100111011111111111111101001001101110011
                2002/02 10111111111011101011111111101110111110111111011110111111110011111011011111111101110111011010111111111100100011101110000110111111111111101111011111111101101111111001010100001001101001001100111011111111111111101001001101110011
                2002/03 10111111111011101011111111101110111110111111011110111111110011111011011111111101110111011010111111111100100011101110000110111111111111101111011111111101101111111001010100001001101001001100111011111111111111101001001101110011
                2002/04 10111111111011101011111111101110111110111111011110111111110011111011011111111101110111011110111111111100100011101110000110111111111111101111011111111101101111111001010100001001101001001100111011111111111111101001001101110011
                2002/05 10111111111111111011111111111111111110111111011111111111110011111011111111111101110111111110111111111100101011101111001110111111111111101111111111111101101111111001010100001001101001001100111011111111111111101001001101110011
                2002/06 10111111111111111011111111111111111110111111011111111111110011111011011111111101110111111110111111111100101011101111001110111111111111101111111111111101101111111001010100001001101001001100111011111111111111101001001101110011
                2002/07 10111111111111111011111111111111111110111111011111111111110011111011111111111101110111111110111111111100101011101111001110111111111111101111111111111101101111111001010100001001101001001100111011111111111111101001001101110011
                2002/08 10111111111111111111111111111111111111111111011111111111110011111011111111111101110111111110111111111100111011101111001110111111111111101111111111111101101111111001010100001001101001001100111011111111111111101001001101110011
                2002/09 10111111111111111111111111111111111111111111011111111111110011111011111111111101110111111110111111111100111011101111001110111111111111101111111111111101101111111001010100001001101001001100111011111111111111101001001101110011
                2002/10 11111111111111111111111111111111111111111111011111111111110011111011111111111101110111111110111111111100111011101111001110111111111111101111111111111101101111111011111100011001101011111100111111111111111111101011001101111111
                2002/11 00000001111111111111111111111111111111111111011111111111110011111011111111111111110111111110111111111100111011101111001110111111111111101111111111111101101111111010000000000000000000000000000000000000000000000000000000000000
                2002/12 00000001111111111111111111111111111111111111011111111111110011111011111111111111110111111110111111111100111011101111001110111111111111101111111111111101101111111010000000000000000000000000000000000000000000000000000000000000
                2003/01 01111111111111111111111111111111111111111111011111111111110011111011111111111111110111111110111111111100111011101111001110111111111111101111111111111101101111111010000000000000000000000000000000000000000000000000000000000000
                2003/02 10111111111111111111111111111111111111111111011111111111110011111011111111111111110111111110111111111100111011101111001110111111111111101111111111111101101111111011010100001001101001001100111011111111111111000001001101110011
                2003/03 00000001111111111111111111111111111111111111011111111111110011111011111111111111110111111110111111111100111011101111001110111111111111101111111111111101101111111010000000000000000000000000000000000000000000000000000000000000
                2003/04 10111111111111111111111111111111111111111111011111111111110011111011111111111111110111111110111111111100111011101111001111111111111111101111111111111101101111111011010100001001101001001100111011111111111111001001001101110011
                2003/05 11111111111111111111111111111111111111111111011111111111110011111011111111111111110111111110111111111101111011101111001111111111111111101111111111111101101111111011111100011001101011111100111111111111111111101011001101111111
                2003/06 11111111111111111111111111111111111111111111011111111111110011111011111111111111110111111110111111111100111011101111001110111111111111101111111111111101101111111011111100011001101011111100111111111111111111101011001101111111
                2003/07 11111111111111111101111111111111111111111111011111111111110011111011111111111111110111111110111111111100111011101111001110111111111111101111111111111101101111111011111100011001101011111100111111111111111111101011001101111111
                2003/08 11111111111111111111111111111111111111111111011111111111110011111011111111111111110111111110111111111100111011101111001111111111111111101111111111111101101111111011111100011001101011111100111111111111111111101011001101111111
                2003/09 11111111111111111111111111111111111111111111011111111111110011111011111111111111110111111110111111111100111011101111001111111111111111101111111111111101101111111011111100011001101011111100111111111111111111101011001101111111
                2003/10 11111111111111111111111111111111111111111111011111111111110011111011111111111111110111111110111111111100111011101111001110111111111111101111111111111101101111111011111100011001101011111100111111111111111111101011001101111111
                2003/11 11111111111111111111111111111111111111111111011111111111110011111011111111111111110111111110111111111100111011101111001110111111111111101111111111111101101111111011111100011001101011111100111111111111111111101011001101111111
                2003/12 11111111111111111111111111111111111111111111011111111111110011111011111111111111110111111110111111111100111011101111001111111111111111101111111111111101101111111011111100011001101011111100111111111111111111101011001101111111
                2004/01 01111111111111111111111111111111111111111111011111111111111011111011111111111111110111111110111111111100111011101111001111111111111111101111111111111101101111111011111100010000000000000000000000000000000000000000000000000000
                2004/02 01111111111111111111111111111111111111111111011111111111111011111011111111111111110111111110111111111100111011101111001111111111111111101111111111111101101111111011110000000000000000000000000000000000000000000000000000000000
                2004/03 11111111111111111111111111111111111111111111011111111111111011111011111111111111110111111110111111111100111011101111001111111111111111101111111111111101101111111011111100011001101011111100111111111111111111101011001101111111
                2004/04 11111111111111111111111111111111111111111111011111111111111011111011111111111111110111111110111111111100111011101111001111111111111111101111111111111101101111111011111100011001101011111100111111111111111111101011001101111111
                2004/05 11111111111111111111111111111111111111111111011111111111111011111011111111111111110111111110111111111100111011101111001111111111111111101111111111111101101111111011111100011001101011111100111111111111111111101011001101111111
                2004/06 11111111111111111111111111111111111111111111011111111111111011111011111111111111110111111110111111111100111011101111001111111111111111101111111111111101101111111011111100011001101011111100111111111111111111101011001101111111
                2004/07 11111111111111111111111111111111111111111111011111111111111011111011111011111111110111111110111111111100111011101111001111111111111111101111111111111101101111111011111100011001101011111100111111111111111111101011001101111111
                2004/08 11111111111111111111111111111111111111111111011111111111111011111011111011111111110111111110111111111100111011101111001111111111111111101111111111111101101111111011111111111011101111111100111111111111111111101011001101111111
                2004/09 11111111111111111111111111111111111111111111011111111111111011111011111011111111110111111110111111111100111011101111001111111111111111101111111111111101101111111011111111111011101111111100111111111111111111101011001101111111
                2004/10 11111111111111111111111111111111111111111111011111111111111011111011111011111111110111111110111111111100111011101111001111111111111111101111111111111101101111111011111111111011101111111100111111111111111111101011001101111111
                2004/11 11111111111111111111111111111111111111111111011111111111111011111011111011111111110111111110111111111100111011101111001111111111111111101111111111111101101111111011111111111011101111111100111111111111111111101011001101111111
                2004/12 11111111111111111111111111111111111111111111011111111111111011111011111011111111110111111110111111111100111011101111001111111111111111101111111111111101101111111011111111111011101111111100111111111111111111101011001101111111
                2005/01 11111111111111111111111111111111111111111111011111111111111011111011111011111111110111111110111111111100111011101111001111111111111111101111111111111101101111111011111111111011101111111100111111111111111111101011001101110111
                2005/02 01111111111111111111111111111111111111111111011111111111111011111011111011111111110111111110111111111100111011101111001111111111111111101111111111111101101111111011101100011001101011111100111111111111111111101011001101110111
                2005/03 11111111111111111111111111111111111111111111011111111111111011111011111011111111110111111110111111111100111011101111001111111111111111101111111111111101101111111011111101011011101111111100111111111111111111101011001101111111
                2005/04 11111111111111111111111111111111111111111111011111111111111011111011111011111111110111111111111111111111111011101111111111111111111111111111111111111101101111111011111111111011101111111100111111111111111111101011001101111111
                2005/05 11111111111111111111111111111111111111111111011111111111111011111011111011111111110111111110111111111111111011101111111111111111111111111111111111111101101111111011111111111111101111111100111111111111111111111011011101111111
                2005/06 11111111111111111111111111111111111111111111011111111111111011111011111011111111110111111111111111111111111011101111111111111111111111111111111111111101101111111011111111111111101111111100111111111111111111111011011101111111
                2005/07 11111111111111111111111111111111111111111111011111111111111011111011111011111111110111111111111111111111111011101111111111111111111111111111111111111101101111111011111111111111101111111100111111111111111111111011011101111111
                2005/08 11111111111111111111111111111111111111111111011111111111111011111011111011111111110111111111111111111111111011101111111111111111111111111111111111111101101111111011111111111011101111111100111111111111111111101011001101111111
                2005/09 00011111111111111111111111111111111111111111011111111111111011111011111011111111110111111111111111111111111011101111111111111111111111111111111111111101101111111011110000000000000000000000000000000000000000000000000000000000
                2005/10 11111111111111111111111111111111111111111111011111111111111011111011111011111111110111111110111111111111111011101111111111111111111111111111111111111101101111111011111111111011101111111100111111111111111111101011001101111111
                2005/11 01111111111111111111111111111111111111111111011111111111111011111011111011111111110111111110111111111111111011101111111111111111111111111111111111111101101111111010000000000000000000000000000000000000000000000000000000000000
                2005/12 00000001111111111111111111111111111111111111011111111111111011111011111011111111110111111111111111111111111011101111111111111111111111111111111111111101101111111011100000000000000000000000000000000000000000000000000000000000
                2006/01 00000001111111111111111111111111111111111111011111111111111011111011111011111111110111111111111111111111111011101111111111111111111111111111111111111101101111111010000000000000000000000000000000000000000000000000000000000000
                2006/02 01111111111111111111111111111111111111111111011111111111111011111011111011111111110111111110111111111111111011101111111111111111111111111111111111111101101111111010000000000000000000000000000000000000000000000000000000000000
                2006/03 11111111111111111111111111111111111111111111011111111111111011111011111011111111110111111110111111111111111011101111111111111111111111111111111111111101101111111011111111111111101111111100111111110111111111111011011101110111
                2006/04 11111111111111111111111111111111111111111111011111111111111011111011111011111111110111111111111111111111111011101111111111111111111111111111111111111101101111111011111111111111101111111100111111111111111111111011011101110111
                2006/05 00000001111111111111111111111111111111111111011111111111111111111011111011111111110111111110111111111111111011101111111111111111111111111111111111111101111111111010000000000000000000000000000000000000000000000000000000000000
                2006/06 00000001111111111111111111111111111111111111011111111111111111111011111011111111110111111110111111111111111011101111111111111111111111111111111111111101111111111011110000000000000000000000000000000000000000000000000000000000
                2006/07 00000001111111111111111111111111111111111111011111111111111011111011111011111111110111111110111111111111111011101111111111111111111111111111111111111101111111111010000000000000000000000000000000000000000000000000000000000000
                2006/08 00000001111111111111111111111111111111111111011111111111111111111011111011111111110111111110111111111111111011101111111111111111111111111111111111111101111111111010000000000000000000000000000000000000000000000000000000000000
                2006/09 00000001111111111111111111111111111111111111011111111111111111111011111011111111110111111110111111111111111011101111111111111111111111111111111111111101111111111011100000000000000000000000000000000000000000000000000000000000
                2006/10 00000001111111111111111111111111111111111111011111111111111111111011111011111111110111111111111111111111111011101111111111111111111111111111111111111101111111111011111110000000000000000000000000000000000000000000000000000000
                2006/11 00000001111111111111111111111111111111111111011111111111111111111011111011111111110111111111111111111111111011101111111111111111111111111111111111111101111111111010000000000000000000000000000000000000000000000000000000000000
                2006/12 00000001111111111111111111111111111111111111011111111111111111111111111011111111110111111111111111111111111011101111111111111111111111111111111111111111111111111010000000000000000000000000000000000000000000000000000000000000
                2007/01 11111111111111111111111111111111111111111111011111111111111111111111111011111111110111111111111111111111111011101111111111111111111111111111111111111111111111111011111111111111101111111100111111111111111111111010111101111111
                2007/02 11111111111111111111111111111111111111111111011111111111111111111111111011111111110111111111111111111111111011101111111111111111111111111111111111111111111111111011111111111111101111111111111111111111111111111111111101111111
                2007/03 11111111111111111111111111111111111111111111011111111111111111111111111011111111110111111111111111111111111011101111111111111111111111111111111111111111111111111011111111111111101111111111111111111111111111111111111101111111
                2007/04 11111111111111111111111111111111111111111111011111111111111111111111111011111111110111111110111111111111111011101111111111111111111111111111111111111111111111111011111111111111101111111110111111111111111111111111111101111111
                2007/05 11111111111111111111111111111111111111111111011111111111111111111111111011111111110111111110111111111111111011101111111111111111111111111111111111111111111111111011111111111111101111111111111111111111111111111111111101111111
                2007/06 11111111111111111111111111111111111111111111011111111111111111111111111011111111110111111110111111111111111011101111111111111111111111111111111111111111111111111011111111111111101111111111111111111111111111111111111101111111
                2007/07 11111111111111111111111111111111111111111111011111111111111111111111111011111111110111111110111111111111111011101111111111111111111111111111111111111111111111111011111111111111101111111111111111111111111111111111111101111111
                2007/08 11111111111111111111111111111111111111111111011111111111111111111111111011111111110111111110111111111111111011101111111111111111111111111111111111111111111111111011111111111111101111111111111111111111111111111111111101111111
                2007/09 11111111111111111111111111111111111111111111011111111111111111111111111011111111110111111111111111111111111011101111111111111111111111111111111111111111111111111011111111111111101111111111111111111111111111111111111101111111
                2007/10 11111111111111111111111111111111111111111111011111111111111111111111111011111111110111111111111111111111111011101111111111111111111111111111111111111111111111111011111111111111101111111111111111111111111111111111111101111111
                2007/11 11111111111111111111111111111111111111111111011111111111111111111111111011111111110111111111111111111111111011101111111111111111111111111111111111111111111111111011111111111111101111111111111111111111111111111111111101111111
                2007/12 11111111111111111111111111111111111111111111011111111111111111111111111011111111110111111111111111111111111011101111111111111111111111111111111111111111111111111011111111111111101111111111111111111111111111111111111101111111
                2008/01 11111111111111111111111111111111111111111111011111111111111111111111111011111111110111111111111111111111111011101111111111111111111111111111111111111111111111111011111111111111101111111111111111111111111111111111111101111111
                2008/02 11111111111111111111111111111111111111111111011111111111111111111111111011111111110111111111111111111111111011101111111111111111111111111111111111111111111111111011111111111111101111111111111111111111111111111111111101111111
                2008/03 11111111111111111111111111111111111111111111011111111111111111111111111011111111110111111111111111111111111011101111111111111111111111111111111111111111111111111011111111111111101111111111111111111111111111111111111101111111
                2008/04 11111111111111111111111111111111111111111111011111111111111111111111111011111111110111111111111111111111111011101111111111111111111111111111111111111111111111111011111111111111101111111111111111111101111111111111011101110111
                2008/05 11111111111111111111111111111111111111111111011111111111111111111111111011111111110111111111111111111111111011101111111111111111111111111111111111111111111111111011111111111111101111101110111111111111111111111111111101111111
                2008/06 00000001111111111111111111111111111111111111011111111111111111111111111011111111110111111111111111111111111011101111111111111111111111111111111111111111111111111011111000000000000000000000000000000000000000000000000000000000
                2008/07 00000001111111111111111111111111111111111111011111111111111111111111111011111111110111111111111111111111111011101111111111111111111111111111111111111111111111111011111000000000000000000000000000000000000000000000000000000000
                2008/08 11111111111111111111111111111111111111111111011111111111111111111111111011111111110111111111111111111111111011101111111111111111111111111111111111111111111111111011111111111111111111111111111111111111111111111111111111111111
                2008/09 11111111111111111111111111111111111111111111011111111111111111111111111011111111110111111111111111111111111011101111111111111111111111111111111111111111111111111011111111111111101111111111011111111111101111111111111101111111
                2008/10 00000001111111111111111111111111111111111111011111111111111111111111111011111111110111111111111111111111111011101111111111111111111111111111111111111111111111111011111111111111111111111111111111110111111111111111111111111111
                2008/11 00000001111111111111111111111111111111111111011111111111111111111111111011111111110111111111111111111111111011101111111111111111111111111111111111111111111111111011111111111111111111111111111111110111111111111111111111111111
                2008/12 11111111111111111111111111111111111111111111011111111111111111111111111011111111110111111111111111111111111011101111111111111111111111111111111111111111111111111011111111111111111111111111111111111111111111111111111111111111
                2009/01 00000111111111111111111111111111111111111111011111111111111111111111111011111111110111111111111111111111111011101111111111111111111111111111111111111111111111111011111010000000000000000000000000000000000000000000000000000000
                2009/02 11111111111111111111111111111111111111111111011111111111111111111111111011111111110111111111111111111111111011101111111111111111111111111111111111111111111111111011111111111111111111111111111111111111111111111111111111111111
                2009/03 11111111111111111111111111111111111111111111011111111111111111111111111011111111110111111111111111111111111011101111111111111111111111111111111111111111111111111011111111111111111111111111111111111111111111111111111111111111
                2009/04 11111111111111111111111111111111111111111111011111111111111111111111111011111111111111111111111111111111111011101111111111111111111111111111111111111111111111111011111111111111111111111111111111111111111111111111111111111111
                2009/05 11111111111111111111111111111111111111111111011111111111111111111111111011111111111111111111111111111111111011101111111111111111111111111111111111111111111111111011111111111111111111111111111111111111111111111110111111111111
                2009/06 11111111111111111111111111111111011111111111011111111111111111111111111011111111111111111111111111101111111011101111111111111111111111111111111111111111111111111011111111111111111111111111111111111111111111111110111111111111
                2009/07 11111111111111111111111111111111011111111111011111111111111111111111111011111111111111111111111111101111111011101111111111111111111111111111111111111111111111111011111111111111111111111111111111111111111111111110111111111111
                2009/08 11111111111111111111111111111111111111111111011111111111111111111111111011111111111111111111111111111111111011101111111111111111111111111111111111111111111111111011111111111111111111111111111111111111111111111110111111111111
                2009/09 11111111111111111111111111111111011111111111011111111111111111111111111011111111111111111111111111101111111011101111111111111111111111111111111111111111111111111011111111111111111111111111111111111111111111111110111111111111
                2009/10 11111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111110111111111111
                2009/11 11111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111
                2009/12 11111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111
                2010/01 11111111111111111111111111111111111111111111011111111111111111111111111011111111110111111111111111111111111011101111111111111111111111111111111111111111111101111011111111111111111111111111111111111111111111111111111111111111
                2010/02 00000000001111111111111111111110111111111111111111111111111111111111111111111111111111111111111000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
                2010/03 11111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111
                2010/04 11111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111
                2010/05 11111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111100000000000000000000000000000000000000000000
                2010/06 11111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111
                2010/07 11111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111
                2010/08 11111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111110111111111111
                2010/09 11111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111
                2010/10 11111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111
                2010/11 11111111111111101111111111110111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111
                2010/12 11111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111
                2011/01 11111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111
                2011/02 01111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111
                2011/03 11111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111
                2011/04 11111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111
                2011/07 10111111111001100110110111110110011000111111111111111111111111110101011011111011111111010000111111111001000011101010000110111111111111101111110011111101000111101101001000001001110001100101000111111110010011111001001101100011
                2011/08 10111111111001100110110111110110011000111111111111111111111111110101011011111011111111010000111111111001000011101010000110111111111111101111110011111101000011101101000000000000000000000000000000000000000000000000000000000000
                2011/10 10111111111001100110110111100110011000111111111011111111111111110101011011111011111111010000111111111001000011101010000110111111111111101111110011111101000111101101001000001001110001000101000111111110010011111001001101100011
                2011/11 11111111111001100110110111100110011000111111111011111111111111110101011011111011111111011000111111111001000011101110000110111111111111101111110011111101000111101101001000001001110001000101000111111110010011111001001101100011
                2011/12 11111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111100000000000000000000000000000000000000000000
                2012/01 11111111111111111111111111111111111111111111111111111111111111111111110111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111100000000000000000000000000000000000000000000
                2012/02 11111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111100000000000000000000000000000000000000000000
                2012/03 11111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111100000000000000000000000000000000000000000000

                first appearances of >02 new mutations (of the current Egypt/Iowa strain)

                Code:
                   107 >1970/06/14,A/Bcm/1/1970,USA, 5 ,G139A,C183T,G235A,T285C,G762A
                   172 >1973/01/15,A/Bcm/1/1973,USA, 19 ,A174G,T281G,T282C,C413A,G417A,T420C,G479A,A610G,G668A,G678A,C705T,G772A,C804T,A872G,T873C,T879C,A957G,C963T,G969A
                   191 >1974/09/09,A/Bcm/1/1974,USA, 4 ,C121A,C425A,G478A,C1039A
                   210 >1975/01/11,A/Bcm/3/1975,USA, 9 ,A120G,A138G,G195T,A205G,C296A,G482A,C613A,T819C,C987T
                   253 >1977/12/30,A/Bcm/3/1977,USA, 14 ,G105A,G192A,A209G,T233A,C309T,A457T,G484A,T489C,G521A,A579G,T759A,G778T,G828A,T867C
                   262 >1978/01/03,A/Bcm/1/1978,USA, 3 ,G264A,C527A,T786C
                   290 >1980/02/26,A/Bcm/1/1980,USA, 6 ,G418A,G435A,C475T,C504T,T732C,C936T
                   293 >1980/12/01,A/Netherlands/209/1980,Netherlands, 26 ,C9T,C41T,C43T,G47C,G52A,T99C,C660A,G1005A,G1011A,A1087G,C1167A,T1189C,C1194T,G1209A,T1320C,T1347C,C1362T,G1386A,A1428G,C1473T,A1484G,G1500A,A1566G,T1575A,G1668A,G1670A
                   339 >1982/04/01,A/Netherlands/233/1982,Netherlands, 10 ,G390A,T567A,C577T,A685G,T789C,A791C,A968G,C1284T,G1374A,G1406A
                   408 >1984/01/  ,A/Taiwan/VGHYM0109-12/1984,Taiwan, 2 ,A357G,C499T
                   455 >1985/01/01,A/Netherlands/330/1985,Netherlands, 7 ,C54A,T536C,A780G,G924A,G1198T,T1338C,G1596A
                   456 >1985/02/01,A/Netherlands/333/1985,Netherlands, 2 ,G993A,G1485A
                   533 >1988/02/05,A/Siena/3/1988,Italy, 3 ,T329A,A523T,T1548C
                   535 >1988/12/  ,A/Taiwan/VGHYM1220-03/1988,Taiwan, 3 ,C492T,G669A,C831A
                   681 >1989/01/28,A/Beijing/57/1989,China, 4 ,T144C,G147A,G292A,A944G
                   746 >1990/10/  ,A/Taiwan/VGHYM1001-06/1990,Taiwan, 2 ,A618C,G777T
                   811 >1991/09/15,A/England/260/1991,United Kingdom, 6 ,C33A,A96G,C798T,C1335T,T1476C,C1587T
                   824 >1991/12/17,A/Stockholm/20/1991,Sweden, 2 ,T31C,G855A
                   956 >1992/11/01,A/Stockholm/12/1992,Sweden, 7 ,C48T,C518T,T792A,C875A,A960C,G1239A,G1365A
                  1125 >1993/02/03,A/New York/758/1993,USA, 2 ,T531C,C1527T
                  1165 >1993/03/26,A/New York/757/1993,USA, 2 ,G451A,C833G
                  1281 >1994/01/02,A/New York/723/1994,USA, 2 ,G450A,A1230G
                  1328 >1994/06/01,A/Hong Kong/1/1994,Hong Kong, 2 ,A1188G,C1446T
                  1333 >1994/07/29,A/New York/715/1994,USA, 2 ,T635C,C1642T
                  1334 >1994/08/02,A/Hong Kong/56/1994,Hong Kong, 5 ,G702A,C724A,G726C,T881A,A1089G
                  1335 >1994/11/03,A/New York/654/1994,USA, 3 ,A514C,G520A,C1275T
                  1336 >1994/11/17,A/New York/655/1994,USA, 2 ,T327C,C564A
                  1337 >1994/12/02,A/New York/657/1994,USA, 4 ,A219G,T399A,C1044T,G1403A
                  1458 >1995/01/06,A/New York/671/1995,USA, 2 ,G537A,A1578G
                  1508 >1995/04/06,A/Guangxi/42/1995,China, 4 ,A78G,A393C,G452C,C606T
                  1519 >1995/09/27,A/Malaysia/07832/1995,Malaysia, 2 ,A232G,C623T
                  1526 >1995/12/02,A/Netherlands/271/1995,Netherlands, 2 ,G524T,C1173T
                  1709 >1996/04/  ,A/Fujian/124/1996,China, 4 ,T410A,T447C,G472A,C927A
                  1719 >1996/05/20,A/Fujian/152/1996,China, 2 ,G218A,G444A
                  1735 >1996/08/26,A/Malaysia/10675/1996,Malaysia, 8 ,G246A,A458C,C876A,A1056G,C1233T,A1290G,C1431T,C1620T
                  1930 >1997/03/14,A/Malaysia/12106/1997,Malaysia, 2 ,G108A,A1205G
                  1981 >1997/12/20,A/Malaysia/14712/1997,Malaysia, 2 ,A1200G,A1557G
                  2238 >1998/08/31,A/Hong Kong/CUHK18036/1998,Hong Kong, 2 ,A60T,C1092T
                  2839 >2000/03/01,A/Hong Kong/CUHK22072/2000,Hong Kong, 2 ,A196G,G722A
                  2903 >2000/09/14,A/Canterbury/75/2000,New Zealand, 2 ,T1149C,T1314A
                  3053 >2001/07/19,A/Hong Kong/CUHK24749/2001,Hong Kong, 4 ,G93T,C538T,G652A,T1637C
                  3087 >2001/10/14,A/Guangzhou/1237/2001,China, 2 ,G714A,T727C
                  3088 >2001/10/23,A/Okinawa/208/2001,Japan, 2 ,A516C,A604G
                  3606 >2002/06/01,A/Hong Kong/CUHK24044/2002,Hong Kong, 4 ,G156T,T273G,G648A,T712A
                  5071 >2003/12/30,A/Hong Kong/CUHK83422/2003,Hong Kong, 2 ,C1128A,G1212C
                  5595 >2004/03/11,A/Jeonnam/336/2004,South Korea, 4 ,A625T,G626T,G721A,C811A
                  7264 >2005/10/  ,A/Kolkata/43/2005,India, 3 ,A467T,T930C,T954C
                  8243 >2006/12/08,A/Colorado/05/2006,USA, 2 ,A1254C,T1512C
                  9280 >2007/07/24,A/LangSon/LS218/2007,Viet Nam, 4 ,A565C,C1130G,G1197A,T1560A
                 11140 >2009/04/10,A/Nanjing/1/2009,China, 5 ,C318A,C483T,A522C,A615G,A682G
                Attached Files
                I'm interested in expert panflu damage estimates
                my current links: [url]http://bit.ly/hFI7H[/url] ILI-charts: [url]http://bit.ly/CcRgT[/url]

                Comment


                • #9
                  Re: H3n2

                  we have 2 major strains in H3-HA, both descending from Egypt/Iowa/2009

                  2 out of 405 viruses are not Egypt/Iowa, but both are Perth/~2008


                  > Index USA/2007 (H3N2)

                  >Index/Brisbane-like/2007,1,1-1701,1,
                  A622G

                  >Index/Perth-like/2009,12,1-1701,12,
                  G232A,T480A,A522C,A565C,T615A,C729T
                  T1130G,G1197A,C1296T,C1548T,C1560A,A1578G

                  >Index/2009/Egypt/Iowa,15,1-1701,15,
                  C318A,C483T,A522C,A565C,T615G,C660A
                  A682G,C729T,G1005A,C1053A,T1130G,G1197A
                  C1296T,C1560A,A1578G

                  --------------------------------------------------------

                  Germany,2011/12
                  group 3(85&#37
                  3C: 51% A/HK/3969/2011 S45N,T48I,A198S,V223I,N312S (Victoria/361/2011)
                  3B: 24% A/England/259/2011 N145S,A198S,V223I,N312S,D487N
                  3A: 10% A/Stockholm/18/2011 N145S,V223I,D487N (add 16 to get the real positions)


                  2: A/Norway/1330/2010 N133D,R142G,T212A,V213A
                  1: A/Victoria/210/2009 P162S,I260M,R261Q {C532T,A828G,G830A}
                  4: A/Serbia/71/2011 N312S
                  5: A/Perth/10/2011 D53N,Y94H,I230V,E280A
                  6: A/Iowa/19/2010 D53N,Y94H,S199A,I230V,E280A
                  7: A/Alabama/04/2011 S45N


                  (these viruses are not at genbank)
                  I can't find the separation into groups ("3A,3B,3C,6,5,..."), what mutations determine those groups
                  ------------------
                  found it on page 8 here: http://www.nimr.mrc.ac.uk/documents/...t-feb-2012.pdf
                  Attached Files
                  I'm interested in expert panflu damage estimates
                  my current links: [url]http://bit.ly/hFI7H[/url] ILI-charts: [url]http://bit.ly/CcRgT[/url]

                  Comment


                  • #10
                    Re: H3n2

                    ahh, Egypt/Iowa(2009) had reassorted with another virus that I hadn't
                    seen before. That virus could still have been a descendent from
                    the USA/2007-index to which all current human H3N2 (except H3N2v)
                    goes back to. Or close to that one, maybe mrcat=2006

                    that virus contributed segments 1,2,6,8 while a descendent
                    of Egypt/Iowa contributed 3,4,5,7

                    we have particularly few mutations in segment 5 since 2007


                    besides that reassortant we have another H3N2 that could be a descendent
                    of Egypt/Iowa/2009 in all segments except 6 (NA)
                    that NA also goes back to the the 2007-USA-index

                    we no longer have descendents from the Wisconsin/2005 vaccine strain
                    or similar

                    --------------------------------------
                    I forgot what I had written before here: Feb.28.2011
                    http://www.flutrackers.com/forum/showpost.php?p=396272
                    Attached Files
                    I'm interested in expert panflu damage estimates
                    my current links: [url]http://bit.ly/hFI7H[/url] ILI-charts: [url]http://bit.ly/CcRgT[/url]

                    Comment


                    • #11
                      Re: H3n2

                      comparing 2012 with 2003 :

                      http://www.flutrackers.com/forum/att...2&d=1357328326
                      Attached Files
                      I'm interested in expert panflu damage estimates
                      my current links: [url]http://bit.ly/hFI7H[/url] ILI-charts: [url]http://bit.ly/CcRgT[/url]

                      Comment


                      • #12
                        Re: H3n2

                        bump----------------------

                        > that virus contributed segments 1,2,6,8 while a descendent
                        > of Egypt/Iowa contributed 3,4,5,7


                        it's a pity that we have no recent H3N2 at genbank.
                        The last is from Czechia last season

                        we need India,China
                        what had Australia last season ?

                        Just one genome would be fine
                        And not only HA, I feel that it's not HA that is responsible
                        for this bad flu-season in USA

                        --------------------------------------------------

                        http://www.ncbi.nlm.nih.gov/pubmed/23201458

                        http://www.flutrackers.com/forum/att...9&d=1354703360

                        --------------------------------------------------
                        file 3212c7 , 2012.09.12 , m=5450 n=1703
                        file 3212c7.iow , 2012.09.12 , m=1468 , n=1703
                        file 3212s1 , 2012.09.11 , m=1092 , n=2282
                        file 3212i , 2012.09. m=361 , n=2282+2276+2153+1703+1499+1412+984+840
                        file 3213 , 2013.01.05 m=5461 , n=2350+2353+
                        file 3213v , 2013.01.05 , m=992 , n=2282+2276+2153+1703+1499+1412+984+840
                        I'm interested in expert panflu damage estimates
                        my current links: [url]http://bit.ly/hFI7H[/url] ILI-charts: [url]http://bit.ly/CcRgT[/url]

                        Comment


                        • #13
                          Re: H3n2

                          here the 2 strains that were circulating in 2011
                          (and uploaded to genbank)

                          Code:
                          >Index/H3N3-2011-reassortedEI/2011(H3N2)
                          ATGGAAAGAATAAAAGAATTACGGAATCTGATGTCGCAGTCTCGCACTCGCGAGATACTGACAAAAACCACAGTGGACCATATGGCCATAATTAAGAAGTACACATCGGGGAGACAGGAAAAGAACCCGTCACTTAGGATGAAATGGATGATGGCAATGAAATACCCAATCACTGCTGACAAAAGGATAACAGAAATGGTTCCAGAGAGAAATGAACAAGGACAAACTCTATGGAGTAAAATAAGTGATGCTGGATCAGATAGAGTGATGGTATCACCTTTGGCTGTAACATGGTGGAATAGAAATGGACCCGTGACAAGTACGGTCCATTACCCAAAAGTGTACAAAACTTATTTCGACAAAGTCGAAAGGTTAAAACATGGAACCTTTGGCCCTGTTCATTTTAGAAATCAAGTCAAGATACGCAGAAGAGTAGACATAAATCCTGGTCATGCAGACCTCAGTGCCAAAGAGGCACAAGATGTAATTATGGAAGTTGTTTTTCCCAATGAAGTGGGAGCCAGGATACTAACATCAGAATCACAATTAACAATAACTAAAGAGAAAAAAGAAGAACTCCGAGATTGTAAAATTTCTCCCTTGATGGTTGCATACATGTTAGAGAGAGAACTTGTACGAAAAACAAGATTTCTCCCAGTTTCTGGAGGAACAAGCAGTATATACATTGAAGTTTTACATTTGACTCAGGGAACGTGTTGGGAACAAATGTACACTCCAGGTGGAGGAGTGAGGAATGACGATATTGACCAAAGCCTAATTATTGCGGCCAGGAACATAGTAAGAAGAGCCGCAGTATCAGCAGATCCACTAGCATCTTTATTGGAAATGTGCCACAGCACACAAATTGGCGGGACAAAGATGGTGGACATTCTTAGACAGAACCCGACTGAAGAACAAGCTGTGGATATATGCAAGGCTGCAATGGGATTGAGAATCAGCTCATCATTCAGCTTTGGTGGATTTACATTTAAAAGAACAAGCGGGTCATCAGTCAAAAAAGAAGAAGAGGTGCTTACAGGCAATCTCCAAACATTGAAAATAAGAGTACATGAGGGGTATGAGGAGTTCACAATGGTGGGGAAAAGAGCAACAGCTATACTAAGAAAAGCAACCAGAAGATTGGTTCAGCTCATAGTGAGTGGAAGAGACGACCAGTCAATAGCCGAAGCAATAATCGTGGCCATGGTGTTTTCACAAGAGGATTGCATGATAAAAGCAGTTAGAGGTGACCTGAATTTCGTCAACAGAGCAAATCAGCGGTTAAACCCCATGCATCAGCTTTTAAGGCATTTTCAGAAAGATGCGAAAGTGCTTTTTCAAAATTGGGGAGTTGAACACATCGACAGTGTGATGGGAATGATTGGAGTATTACCAGATATGACTCCAAGCACAGAGATGTCAATGAGAGGAATAAGAGTCAGCAAAATGGGTGTGGATGAATACTCCAGTACAGAGAGGGTGGTGGTTAGCATTGATCGGTTTTTGAGAGTTCGAGACCAACGTGGGAATGTATTATTATCTCCTGAGGAGGTCAGTGAAACACAGGGAACTGAGAGACTGACAATAACTTATTCATCGTCGATGATGTGGGAGATTAACGGTCCTGAATCGGTTCTGGTCAATACCTATCAGTGGATCATCAGAAATTGGGAAGCTATTAAAATTCAATGGTCTCAGAATCCTGCAATGTTGTACAACAAAATGGAATTTGAACCATTTCAATCCTTAGTCCCCAAGGCCATTAGAAGCCAATACAGTGGGTTTGTCAGAACTCTATTCCAACAAATGAGAGACGTACTTGGGACATTTGACACCACCCAGATAATAAAGCTTCTCCCTTTTGCAGCTGCTCCACCAAAGCAAAGCAGAATGCAGTTCTCTTCACTGACTGTGAATGTGAGGGGATCAGGGATGAGAATACTTGTAAGGGGCAATTCTCCTGTATTCAACTACAACAAGACCACTAAAAGACTAACAATTCTCGGAAAAGATGCCGGCACTTTAATTGAAGACCCAGATGAAAGCACATCCGGAGTGGAATCCGCCGTCTTGAGAGGGTTTCTCATTATAGGTAAGGAAGACAGAAGATACGGACCAGCATTAAGCATCAATGAACTGAGCAACCTTGCAAAAGGGGAAAAGGCTAATGTGCTAATAGGGCAAGGAGACGTGGTGTTGGTAATGAAACGAAAACGGGACTCTAGCATACTTACTGACAGCCAGACAGCGACCAAAAGAATTCGGATGGCCATCAATTAA
                          ATGGATGTCAATCCGACTCTACTGTTCCTAAAGGTTCCAGCGCAAAATGCCATAAGCACAACATTCCCTTATACTGGAGACCCTCCATACAGCCATGGAACAGGGACAGGGTACACCATGGACACAGTCAACAGAACACACCAATATTCAGAGAGGGGGAAGTGGACGACAAATACAGAAACTGGGGCACCCCAACTAAACCCAATTGATGGACCACTACCTGAGGATAATGAACCAAGTGGATATGCACAAACAGACTGTGTCCTGGAGGCTATGGCCTTCCTTGAAGAATCCCACCCAGGTATCTTTGAGAACTCATGCCTTGAAACAATGGAAGCCGTTCAACAGACAAGGGTGGACAAACTAACCCAAGGTCGCCAAACTTATGATTGGACATTAAACAGAAATCAACCGGCAGCAACTGCATTAGCCAACACCATAGAAGTCTTTAGATCGAACGGATTGACAGCTAATGAATCAGGAAGACTAATAGATTTCCTCAAGGATGTGATGGAATCAATGGATAAAGAGGAAATGGAGATAACAACACACTTTCAAAGAAAAAGGAGAGTAAGGGACAACATGACCAAGAAAATGGTCACACAAAGAACAATAGGGAAGAAAAAACAAAGAGTGAATAAGAGAGGCTACCTAATAAGAGCTTTGACATTGAACACGATGACCAAAGATGCAGAGAGAGGCAAATTAAAAAGAAGGGCTATTGCAACACCCGGGATGCAAATTAGAGGGTTCGTGTACTTCGTTGAAACTTTAGCTAGAAGCATTTGTGAAAAGCTTGAACAGTCTGGACTTCCAGTTGGGGGTAATGAAAAGAAGGCCAAACTGGCAAATGTTGTGAGAAAAATGATGACTAATTCACAAGACACAGAGCTTTCTTTCACAATCACTGGGGACAACACTAAGTGGAATGAAAATCAAAACCCTCGAATGTTTCTGGCGATGATTACATACATCACAAAGAATCAACCTGAGTGGTTCAGAAACATCCTGAGCATCGCACCAATAATGTTCTCAAACAAAATGGCAAGACTGGGAAAAGGATACATGTTCGAGAGTAAGAAAATGAAGCTCCGGACACAAATACCTGCAGAAATGCTAGCAAGCATTGACCTGAAGTATTTCAATGAATCAACAAGGAAGAAAATTGAGAAAATAAGGCCTCTTCTAATAGATGGCACAGCATCATTGAGCCCTGGAATGATGATGGGCATGTTCAACATGCTAAGTACGGTTTTAGGAGTCTCGATACTGAATCTTGGACAAAAGAAATACACCAAGACAACATACTGGTGGGATGGGCTCCAATCCTCCGACGATTTTGCTCTCATAGTGAATGCACCAAATCATGAGGGAATACAAGCAGGAGTGGATAGATTCTACAGGACCTGCAAGTTAGTGGGAATCAACATGAGCAAAAAGAAGTCCTATATAAATAAAACAGGGACATTTGAATTCACTAGCTTTTTTTATCGATATGGATTTGTGGCTAATTTTAGCATGGAGCTGCCCAGTTTTGGAGTGTCTGGAATAAACGAGTCAGCTGATATGAGCATTGGAGTAACAGTGATAAAGAACAACATGATAAACAATGACCTTGGACCAGCAACAGCCCAAATGGCTCTCCAATTGTTCATCAAAGATTACAGATACACATATAGGTGCCATAGAGGAGACACACAAATCCAGACGAGAAGATCATTCGAGATAAAGAAGCTGTGGGATCAAACCCAATCAAGGGCAGGACTATTGGTATCAGATGGGGGACCAAACTTATACAATATCCGGAATCTTCACATCCCTGAAGTCTGCTTAAAGTGGGAGCTGATGGATGAGAATTATCGGGGAAGACTTTGTAATCCCCTGAATCCCTTTGTCAGCCATAAAGAAATTGAGTCTGTAAACAATGCTGTAGTAATGCCAGCCCATGGTCCGGCCAAAAGTATGGAATATGATGCCGTTGCAACCACACACTCCTGGATTCCCAAGAGGAACCGCTCTATTCTAAACACAAGCCAAAGGGGAATTCTTGAGGATGAACAGATGTACCAGAAGTGCTGCAACTTGTTCGAGAAATTTTTCCCTAGTAGTTCATATAGGAGACCTATTGGAATTTCTAGCATGGTGGAGGCAATGGTGTCTAGGGCCCGGATTGATGCCAGAATTGACTTCGAGTCTGGAAGGATTAAGAAAGAGGAGTTCTCTGAGATCATGAGGATCTGTTCCACCATTGAAGAACTCAGACGGCAAAAATAA
                          ATGGAAGATTTTGTGCGACAATGCTTCAACCCGATGATTGTCGAACTTGCAGAAAAAGCAATGAAAGAGTATGGGGAGGATCTGAAAATTGAAACCAACAAATTTGCAGCAATATGCACTCACTTGGAGGTGTGTTTCATGTATTCAGATTTCCATTTCATCAATGAACAAGGCGAATCAATAGTGGTAGAACTTGACGATCCAAATGCACTGTTAAAGCACAGATTTGAAATAATCGAGGGGAGAGACAGAACAATGGCCTGGACAGTAGTAAACAGTATCTGCAACACTACTGGAGCTGGAAAACCGAAGTTTCTACCAGATTTGTATGATTACAAAGAGAACAGATTCATCGAAATTGGAGTGACAAGGAGAGAAGTCCACATATATTACCTTGAAAAGGCCAACAAGATTAAATCTGAGAACACACACATTCACATTTTCTCATTCACTGGGGAGGAAATGGCCACAAAGGCAGACTACACTCTTGACGAGGAAAGCAGGGCTAGGATTAAGACCAGGCTGTTTACCATAAGACAAGAAATGGCCAACAGAGGCCTCTGGGATTCCTTTCGTCAGTCCGAAAGAGGCGAAGAAACAATTGAAGAAAAATTTGAAATCACAGGAACTATGCGTAGGCTTGCCGACCAAAGTCTCCCACCGAACTTCTCCTGCCTTGAGAATTTTAGAGCCTATGTGGATGGATTCGAACCGAACGGCTGCATTGAGGGCAAGCTTTCTCAAATGTCCAAAGAAGTGAATGCCCAAATTGAACCTTTTCTGAAGACAACACCAAGACCAATCAAACTTCCGAATGGACCTCCTTGTTATCAGCGGTCCAAATTCCTCCTGATGGATGCTTTAAAATTGAGCATTGAAGACCCAAGTCACGAAGGAGAAGGGATCCCATTATATGATGCGATCAAGTGCATAAAAACATTCTTTGGATGGAAAGAACCTTATATAGTCAAACCACACGAAAAGGGAATAAATTCAAATTACCTGCTGTCATGGAAGCAAGTACTGTCAGAATTGCAGGACATTGAAAATGAGGAGAAGATTCCAAGAACTAAAAACATGAAGAAAACGAGTCAACTGAAGTGGGCTCTTGGTGAAAACATGGCACCAGAGAAGGTAGACTTTGAAAACTGCAGAGACATAAGCGATTTGAAGCAATATGATAGTGACGAACCTGAATTAAGGTCACTTTCAAGCTGGATACAGAATGAGTTCAACAAGGCCTGTGAGCTAACTGATTCAGTCTGGATAGAGCTCGATGAAATTGGAGAGGATGTAGCCCCAATTGAGCACATTGCAAGCATGAGAAGAAATTATTTCACAGCAGAGGTGTCCCATTGTAGAGCTACTGAATACATAATGAAGGGGGTATACATTAACACTGCCCTGCTCAATGCATCCTGTGCAGCAATGGACGATTTTCAACTAATTCCCATGATAAGCAAGTGCAGAACTAAAGAGGGAAGGCGAAAAACCAATTTATATGGATTCATCATAAAGGGAAGATCTCATTTAAGGAATGACACAGACGTGGTAAATTTTGTGAGCATGGAGTTTTCTCTCACTGACCCGAGACTTGAGCCACATAAATGGGAGAAATACTGTGTCCTTGAGATAGGAGATATGTTACTAAGAAGTGCCATAGGCCAAATTTCAAGGCCGATGTTCTTGTATGTGAGGACAAACGGAACATCAAAGGTCAAAATGAAATGGGGAATGGAGATGAGACGTTGCCTCCTTCAGTCACTCCAGCAGATCGAGAGCATGATTGAAGCCGAGTCCTCGGTTAAAGAGAAAGACATGACCAAAGAGTTTTTTGAGAATAAATCAGAAGCATGGCCCATTGGGGAGTCCCCCAAGGGAGTGGAAGAAGGTTCCATTGGGAAAGTCTGTAGGACTCTATTGGCTAAGTCAGTATTCAATAGCCTGTATGCATCACCACAATTGGAAGGATTTTCAGCGGAGTCAAGAAAACTGCTCCTTGTTGTTCAGGCTCTTAGGGACAACCTCGAACCTGGGACCTTTGATCTTGGGGGGCTATATGAAGCAATTGAGGAGTGCCTGATTAATGATCCCTGGGTTTTGCTCAATGCGTCTTGGTTCAACTCCTTCCTGACACATGCATTAAAATAG
                          ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAACAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTGCCAAACGGAACGATAGTGAAAACAATCACGAATGACCAAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTGAAATATGCAACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAACAAGAAATGGGACCTTTTTGTTGAACGAAGCAAAGCCCACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAACGGAACAAGCTCTGCTTGCATAAGGAGATCTAATAATAGTTTCTTTAGTAGATTGAATTGGTTGACCCACTTAAACTTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAAGGACCAAATCTTCCTGTATGCTCAAGCATCAGGAAGAATCACAGTATCTACCAAAAGAAGCCAACAAGCTGTAATTCCGAATATCGGATCTAGACCCAGAGTAAGGAATATCCCTAGCAGAGTAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAATTCTGCATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGAATGAGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATAGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAAGGGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATAGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTCGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACACACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTGTACAGAGATGAAGCATTAAACAACCGATTCCAGATCAAGGGAGTTGAGCTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATTTGA
                          ATGGCGTCCCAAGGCACCAAACGGTCTTATGAACAGATGGAAACTGATGGGGATCGCCAGAATGCAACTGAGATTAGGGCATCCGTCGGGAAGATGATTGATGGAATTGGGAGATTCTACATCCAAATGTGCACTGAACTTAAACTCAGTGATCATGAAGGGCGTTTGATCCAGAACAGCTTGACAATAGAGAAAATGGTACTCTCTGCTTTTGATGAAAGAAGGAATAAATACCTGGAAGAACACCCCAGCGCGGGGAAAGATCCCAAGAAAACTGGGGGGCCCATATACAGGAGAGTCGATGGGAAATGGATGAGGGAACTCGTCCTTTATGACAAAGAAGAAATAAGGCGAATCTGGCGCCAAGCCAACAATGGTGAGGATGCTACATCTGGTCTAACTCACATAATGATTTGGCATTCCAATTTGAATGATGCAACATACCAGAGGACAAGAGCTCTTGTTCGAACTGGAATGGATCCCAGAATGTGCTCTCTGATGCAGGGCTCGACTCTCCCTAGAAGGTCCGGAGCTGCAGGTGCTGCAGTCAAAGGAATCGGGACAATGGTGATGGAACTGATCAGAATGGTCAAACGGGGGATCAACGATCGAAATTTTTGGAGAGGTGAGAATGGGCGGAAAACAAGAAGTGCTTATGAGAGAATGTGCAACATTCTTAAAGGAAAATTTCAAACAGCTGCACAAAGAGCAATGGTGGATCAAGTGAGAGAAAGTCGGAACCCAGGAAACGCTGAGATCGAAGATCTCATATTTTTAGCAAGATCTGCATTGATATTGAGAGGATCAGTTGCTCACAAATCTTGCCTACCTGCCTGTGCGTATGGACCTGCAGTATCCAGTGGGTACGACTTCGAAAAAGAGGGATATTCCTTGGTGGGAATAGACCCTTTCAAACTACTTCAAAATAGCCAAATATACAGCTTAATCAGACCTAACGAGAATCCAGCACACAAGAGTCAGCTGGTGTGGATGGCATGCCATTCTGCTGCATTTGAAGATTTAAGATTGTTAAGCTTCATCAGAGGGACAAAAGTATCTCCTCGGGGGAAACTGTCAACTAGAGGAGTACAAATTGCTTCAAATGAGAACATGGATAATATGGGATCGAGCACTCTTGAACTGAGAAGCGGGTACTGGGCCATAAGGACCAGGAGTGGAGGAAACACTAATCAACAGAGGGCCTCCGCAGGCCAAACCAGTGTGCAACCTACGTTTTCTGTACAAAGAAACCTCCCATTTGAAAAGTCAACCATCATGGCAGCATTCACTGGAAATACGGAGGGAAGAACTTCAGACATGAGGGCAGAAATCATAAGAATGATGGAAGGTGCAAAACCAGAAGAAGTGTCATTCCGGGGGAGGGGAGTTTTCGAGCTCTCAGACGAGAAGGCAACGAACCCGATCGTGCCCTCTTTTGATATGAGTAATGAAGGATCTTATTTCTTCGGAGACAATGCAGAAGAGTACGACAATTAA
                          ATGAATCCAAATCAAAAGATAATAACGATTGGCTCTGTTTCTCTCACCATTTCCACAATATGCTTCTTCATGCAAATTGCCATCTTGATAACTACTGTAACATTGCATTTCAAGCAATATGAATTCAACTCCCCCCCAAACAACCAAGTGATGCTGTGTGAACCAACAATAATAGAAAGAAACATAACAGAGATAGTGTATCTGACCAACACCACCATAGAGAAGGAAATATGCCCCAAACTAGCAGAATACAGAAATTGGTCAAAGCCGCAATGTGACATTACAGGATTTGCACCTTTTTCTAAGGACAATTCGATTAGGCTTTCCGCTGGTGGGGACATCTGGGTGACAAGAGAACCTTATGTGTCATGCGATCCTGACAAGTGTTATCAATTTGCCCTTGGACAGGGAACAACACTAAACAACGTGCATTCAAATAACACAGTACGTGATAGGACCCCTTATCGGACCCTATTGATGAATGAGTTAGGTGTTCCTTTTCATCTGGGGACCAAGCAAGTGTGCATAGCATGGTCCAGCTCAAGTTGTCACGATGGAAAAGCATGGCTGCATGTTTGTATAACGGGGGATGATAAAAATGCAACTGCTAGCTTCATTTACAATGGGAGGCTTGTAGATAGTGTTGTTTCATGGTCCAAAGAAATCCTCAGGACCCAGGAGTCAGAATGCGTTTGTATCAATGGAACTTGTACAGTAGTAATGACTGATGGGAGTGCTTCAGGAAAAGCTGATACTAAAATACTATTCATTGAGGAGGGGAAAATCGTTCATACTAGCACATTGTCAGGAAGTGCTCAGCATGTCGAGGAGTGCTCTTGCTATCCTCGATATCCTGGTGTCAGATGTGTCTGCAGAGACAACTGGAAAGGCTCCAATAGGCCCATCGTAGATATAAACATAAAGGATCATAGCATTGTTTCCAGTTATGTGTGTTCAGGACTTGTTGGAGACACACCCAGAAAAAACGACAGCTCCAGCAGTAGCCATTGTTTGGATCCTAACAATGAAGAAGGTGGTCATGGAGTGAAAGGCTGGGCCTTTGATGATGGAAATGACGTGTGGATGGGAAGAACGATCAACGAGACGTCACGTTTAGGGTATGAAACCTTCAAAGTCATTGAAGGCTGGTCCAACCCTAAGTCCAAATTGCAGATAAATAGGCAAGTCATAGTTGACAGAGGTAATAGGTCCGGTTATTCTGGTATTTTCTCTGTTGAAGGCAAAAGCTGCATCAATCGGTGCTTTTATGTGGAGTTGATTAGGGGAAGAAAAGAGGAAACTGAAGTCTTGTGGACCTCAAACAGTATTGTTGTGTTTTGTGGCACCTCAGGTACATATGGAACAGGCTCATGGCCTGATGGGGCGGACCTCAATCTCATGCCTATATAA
                          ATGAGCCTTCTAACCGAGGTCGAAACGTATGTTCTCTCTATCGTTCCATCAGGCCCCCTCAAAGCCGAGATCGCGCAGAGACTTGAAGATGTCTTTGCTGGGAAAAACACAGATCTTGAGGCTCTCATGGAATGGCTAAAGACAAGACCAATTCTGTCACCTCTGACTAAGGGGATTTTGGGGTTTGTGTTCACGCTCACCGTGCCAAGTGAGCGAGGACTGCAGCGTAGACGCTTTGTCCAAAATGCCCTCAATGGGAATGGAGACCCAAATAATATGGACAAAGCAGTTAAACTGTATAGGAAACTTAAGAGAGAGATAACGTTCCATGGGGCCAAAGAAATAGCTCTCAGTTATTCTGCTGGTGCACTTGCCAGTTGCATGGGCCTCATATACAATAGGATGGGGGCTGTAACCACTGAAGTGGCATTTGGCCTGGTATGTGCAACATGTGAGCAGATTGCTGACTCCCAGCACAGGTCTCATAGGCAGATGGTGGCAACAACCAATCCATTAATAAAACATGAGAACAGAATGGTTTTGGCAAGCACTACAGCTAAGGCTATGGAGCAAATGGCTGGATCAAGTGAGCAGGCAGCGGAGGCCATGGAGATTGCTAGTCAGGCCAGGCAGATGGTGCAGGCAATGAGAGCCATTGGGACTCATCCTAGTTCCAGTACTGGTCTAAGAGATGATCTTCTTGAAAATTTGCAGACCTATCAGAAACGAATGGGGGTGCAGATGCAACGATTCAAGTGACCCGCTTGTTGTTGCCGCGAATATCATTGGGATCTTGCACTTGATATTGTGGATTCTTGATCGTCTTTTTTTCAAATGCGTCTATCGACTCTTCAAACACGGCCTTAAAAGAGGCCCTTCTACGGAAGGAGTACCTGAGTCTATGAGGGAAGAATATCGAAAGGAACAGCAGAATGCTGTGGATGCTGACGACAGTCATTTTGTCAGCATAGAGTTGGAGTAA
                          ATGGACTCCAACACTGTGTCAAGTTTCCAGGTAGATTGCTTTCTTTGGCATATCCGGAAACAAGTTGTAGACCAAGAACTGAGTGATGCCCCATTCCTTGATCGGCTTCGCCGAGATCAGAGGTCCCTAAGGGGAAGAGGCAATACTCTTGGTCTAGACATCAAAGCAGCCACCCATGTTGGAAAGCAAATTGTAGAAAAGATTCTGAAAGAAGAATCTGATGAGGCACTTAAAATGACCATGGTCTCCACACCTGCTTCGCGATACATAACTGACATGACTATTGAGGAATTGTCAAGAAACTGGTTCATGCTAATGCCCAAGCAGAAAGTGGAAGGACCTCTTTGCATCAGAATGGACCAGGCAATCATGGAGAAAAACATCACGTTGAAAGCGAATTTCAGTGTGATTTTTGACCGACTAGAGACTATAGTATTACTAAGGGCTTTCACCGAAGAGGGAGCAATTGTTGGCGAAATCTCACCATTGCCTTCTTTTCCAGGACATACTATTGAGGATGTCAAAAATGCAATTGGGGTCCTCATCGGAGGACTTGAATGGAATGATAACACAGTTCGAGTCTCTAAAAATCTACAGAGATTCGCTTGGAGAAGCAGTAATGAGAATGGGGGACCTCCACTTACTCCAAAACAGAAACGGGAAATGGCGAGAACAGCTAGGTCAAAAGTTTGAAGAGATAAGATGGCTAATTGAAGAAGTGAGACACAGATTAAAAACAACTGAAAGTAGCTTTGAACAAATAACATTCATGCAAGCATTACAACTGCTGTTTGAGGTGGAACAGGAGATAAGAACTTTCTCATTTCAGCTTATTTAA
                          >Index/H3N2-2011-normalEI/2011(H3N2)
                          ATGGAAAGAATAAAAGAACTACGGAATCTGATGTCGCAGTCTCGCACTCGCGAGATACTGACAAAAACCACAGTGGACCATATGGCCATAATTAAGAAGTACACATCGGGGAGACAGGAAAAGAACCCGTCACTTAGGATGAAATGGATGATGGCAATGAAATATCCAATCACTGCTGACAAAAGGGTAACAGAAATGGTTCCGGAGAGAAATGAACAAGGACAAACTCTATGGAGTAAAATGAGTGATGCTGGATCAGATAGAGTGATGGTATCACCTTTGGCTGTAACATGGTGGAATAGGAATGGACCCGTGACAAGTACGGTCCATTACCCAAAAGTGTACAAGACTTATTTCGACAAAGTCGAAAGGTTAAAACATGGAACCTTTGGCCCTGTTCATTTTAGAAATCAAGTCAAGATACGCAGAAGAGTAGACATAAACCCTGGTCATGCAGACCTCAGTGCCAAAGAGGCACAAGATGTAATTATGGAAGTTGTTTTTCCCAATGAAGTGGGAGCCAGGATACTAACATCAGAATCACAATTAACAATAACTAAAGAGAAAAAAGAAGAACTCCGAGATTGCAAAATTTCTCCCTTGATGGTTGCATACATGTTAGAGAGAGAACTTGTACGAAAAACAAGATTTCTCCCAGTTGCTGGCGGAACAAGCAGTATATACATTGAAGTTTTACATTTGACTCAGGGAACGTGTTGGGAACAAATGTACACTCCAGGTGGAGGAGTGAGGAATGACGATGTTGACCAAAGCCTAATTATTGCGGCCAGGAACATAGTAAGAAGAGCCGCAGTATCAGCAGATCCACTAGCATCTTTATTGGAGATGTGCCACAGCACGCAAATTGGCGGAACAAGGATGGTGGACATTCTTAGACAGAACCCGACTGAAGAACAAGCTGTGGATATATGCAAGGCTGCAATGGGATTGAGAATCAGCTCATCCTTCAGCTTTGGTGGCTTTACATTTAAAAGAACAAGCGGGTCATCAGTCAAAAAAGAAGAAGAGGTGCTTACAGGCAATCTCCAAACATTGAGAATAAGAGTACATGAGGGGTATGAGGAGTTCACAATGGTGGGGAAAAGAGCAACAGCTATACTAAGAAAAGCAACCAGAAGATTGGTTCAACTCATAGTGAGTGGAAGAGACGAACAGTCAATAGCCGAAGCAATAATCGTGGCCATGGTGTTTTCACAAGAAGATTGCATGATAAAAGCAGTTAGAGGTGACCTGAATTTCGTCAACAGAGCAAATCAGCGGTTGAACCCCATGCATCAGCTTTTAAGGCATTTTCAGAAAGATGCGAAAGTGCTCTTTCAAAATTGGGGAGTTGAACACATCGACAGTGTGATGGGAATGGTTGGAGTATTACCAGATATGACTCCAAGCACAGAGATGTCAATGAGAGGAATAAGAGTCAGCAAAATGGGTGTGGATGAATACTCCAGTACAGAGAGGGTGGTGGTTAGCATTGATCGGTTTTTGAGAGTTCGAGACCAACGTGGGAATGTATTATTATCTCCTGAGGAGGTCAGTGAAACACAGGGAACTGAGAGACTGACAATAACTTATTCATCGTCGATGATGTGGGAGATTAACGGTCCTGAGTCGGTTTTGGTCAATACCTATCAATGGATCATCAGAAATTGGGAAGCTGTCAAAATTCAATGGTCTCAGAATCCTGCAATGTTGTACAACAAAATGGAATTTGAACCATTTCAATCTTTAGTCCCCAAGGCCATTAGAAGCCAATACAGTGGGTTTGTCAGAACTCTATTCCAACAAATGAGAGACGTACTTGGGACATTTGACACCACCCAGATAATAAAGCTTCTCCCTTTTGCAGCTGCTCCACCGAAGCAAAGCAGAATGCAGTTCTCTTCACTGACTGTGAATGTGAGGGGATCAGGGATGAGAATACTTGTAAGGGGCAATTCTCCTGTATTCAACTACAACAAGACCACTAAAAGACTAACAATTCTCGGAAAAGATGCCGGCACTTTAATTGAAGACCCAGATGAAAGCACATCCGGAGTGGAGTCCGCCGTCTTGAGAGGGTTTCTCATTATAGGTAAGGAAGACAGAAGATACGGACCAGCATTAAGCATCAATGAACTGAGTAACCTTGCAAAAGGGGAAAAGGCTAATGTGCTAATCGGGCAAGGAGACGTGGTGTTGGTAATGAAACGAAAACGGGACTCTAGCATACTTACCGACAGCCAGACAGCGACCAAAAGAATTCGGATGGCCATCAATTAA
                          ATGGATGTCAATCCGACTCTACTGTTCCTAAAGGTTCCAGCGCAAAATGCCATAAGCACAACATTCCCTTATACTGGAGATCCTCCATACAGCCATGGAACAGGGACAGGGTACACCATGGACACAGTCAACAGAACACACCAATATTCAGAGAGGGGGAAGTGGACGACAAATACAGAAACTGGGGCACCCCAGCTCAACCCAATTGATGGACCACTACCTGAGGATAATGAACCAAGTGGATATGCACAAACAGACTGTGTCCTGGAGGCTATGGCCTTCCTTGAAGAATCCCACCCAGGTATCTTTGAGAACTCATGCCTTGAAACAATGGAAGCCGTTCAACAGACAAGGGTGGACAAACTAACCCAAGGTCGCCAGACTTATGATTGGACATTAAACAGGAATCAACCGGCAGCAACTGCATTAGCCAACACCATAGAAGTCTTTAGATCGAACGGATTAACAGCTAATGAATCAGGAAGGCTAATAGATTTCCTCAAGGATGTGATGGAATCAATGGATAAAGAGGAAATGGAGATAACAACACACTTTCAAAGAAAAAGGAGAGTAAGGGACAACATGACCAAGAAAATGGTCACACAAAGAACAATAGGGAAGAAAAAACAAAGAGTGAATAAGAGAGGCTACCTAATAAGAGCTTTGACATTGAACACGATGACCAAAGATGCAGAGAGAGGCAAATTAAAAAGAAGGGCTATTGCAACACCCGGGATGCAAATTAGAGGGTTCGTGTACTTCGTTGAAACTCTAGCTAGAAGCATTTGCGAAAAGCTTGAACAGTCTGGACTTCCGGTTGGGGGTAATGAAAAGAAGGCCAAACTGGCAAATGTTGTGAGAAAAATGATGACTAATTCACAAGACACAGAGCTTTCTTTCACAATCACTGGGGACAACACTAAGTGGAATGAAAATCAAAACCCTCGAATGTTTTTGGCGATGATTACATACATCACAAAGAATCAACCTGAGTGGTTCAGAAACATCCTGAGCATCGCACCAATAATGTTCTCAAACAAAATGGCAAGACTGGGAAAAGGATACATGTTCGAGAGTAAGAGAATGAAGCTCCGGACACAAATACCTGCAGAAATGCTAGCAAGCATTGACCTGAAGTATTTCAATGAATCAACAAGGAAGAAAATTGAGAAAATAAGGCCTCTTCTAATAGATGGCACAGCATCATTGAGCCCTGGAATGATGATGGGCATGTTCAACATGCTAAGTACAGTTTTAGGAGTCTCGATACTGAATCTTGGACAAAAGAAATACACCAAGACAACATACTGGTGGGATGGGCTCCAATCCTCCGACGATTTTGCACTCATAGTGAATGCACCAAATCATGAGGGAATACAAGCAGGAGTAGATAGATTCTACAGGACCTGCAAGTTAGTGGGAATCAACATGAGCAAAAAGAAGTCCTATATAAATAAAACAGGGACATTTGAATTCACTAGCTTTTTTTATCGATATGGATTTGTGGCTAATTTTAGCATGGAGCTGCCCAGTTTTGGAGTGTCTGGAATAAACGAGTCAGCTGACATGAGCATTGGAGTAACAGTGATAAAGAACAACATGATAAACAATGACCTTGGACCAGCAACAGCCCAAATGGCTCTCCAATTGTTCATCAAAGATTACAGATACACATATAGGTGCCATAGAGGAGACACACAAATCCAAACGAGAAGATCATTCGAGATAAAGAAGCTGTGGGATCAAACCCAATCAAAGACAGGACTATTGGTATCAGATGGGGGACCAAACTTATACAATATCCGGAATCTTCACATCCCTGAAGTCTGCTTAAAGTGGGAGCTGATGGATGAGAATTATCGGGGAAGACTTTGTAATCCCCTGAATCCCTTTGTCAGCCATAAAGAAATTGAGTCTGTAAACAATGCTGTAGTAATGCCAGCCCATGGTCCGGCCAAAAGTATGGAATATGATGCCGTTGCAACTACACACTCATGGATTCCCAAAAGGAACCGCTCTATTCTAAACACAAGCCAAAGGGGAATTCTTGAGGATGAACAGATGTACCAGAAGTGCTGCAACTTGTTCGAGAAATTTTTCCCTAGTAGTTCATATAGGAGACCGATTGGAATTTCTAGCATGGTGGAGGCCATGGTGTCTAGGGCCCGGATTGATGCCAGAATTGACTTCGAGTCTGGAAGGATTAAGAAGGAAGAGTTCTCTGAGATCATGAAGATCTGTTCCACCATTGAAGAACTCAGACGGCAAAAATAA
                          ATGGAAGATTTTGTGCGACAATGCTTCAACCCGATGATTGTCGAACTTGCAGAAAAAGCAATGAAAGAGTATGGGGAGGATCTGAAAATTGAAACCAACAAATTTGCAGCAATATGCACTCACTTGGAGGTGTGTTTCATGTATTCAGATTTCCATTTCATCAATGAACAAGGCGAATCAATAGTGGTAGAACTTGACGATCCAAATGCACTGTTAAAGCACAGATTTGAAATAATCGAGGGGAGAGACAGAACAATGGCCTGGACAGTAGTAAACAGTATCTGCAACACTACTGGAGCTGGAAAACCGAAGTTTCTACCAGATTTGTATGATTACAAAGAGAACAGATTCATCGAAATTGGAGTGACAAGGAGAGAAGTCCACATATATTACCTTGAAAAGGCCAATAAGATTAAATCTGAGAACACACACATTCACATTTTCTCATTCACTGGGGAGGAAATGGCCACAAAGGCAGACTACACTCTCGACGAGGAAAGCAGGGCTAGGATTAAAACCAGGCTGTTTACCATAAGACAAGAAATGGCCAACAGAGGCCTCTGGGATTCCTTTCGTCAGTCCGAAAGAGGCGAAGAAACAATTGAAGAAAAATTTGAAATCACAGGAACTATGCGTAGGCTTGCCGACCAAAGTCTCCCACCGAACTTCTCCTGCCTTGAGAATTTTAGAGCCTATGTGGATGGATTCGAACCGAACGGCTGCATTGAGGGCAAGCTTTCTCAAATGTCCAAAGAAGTGAATGCCCAAATTGAACCTTTTCTGAAGACAACACCGAGACCAATCAAACTTCCTAATGGACCTCCTTGTTATCAGCGGTCCAAATTCCTCCTGATGGATGCTTTAAAATTGAGCATTGAAGACCCAAGTCACGAAGGAGAAGGGATCCCATTATATGATGCGATCAAGTGCATAAAAACATTCTTTGGATGGAAAGAACCTTGTATAGTCAAACCACACGAAAAGGGGATAAATTCAAATTACCTGCTGTCATGGAAGCAAGTACTGTCAGAATTGCAGGACATTGAAAATGAGGAGAAGATTCCAAGAACTAAAAACATGAAGAAAACGAGTCAACTGAAGTGGGCTCTTGGTGAAAACATGGCACCAGAGAAGGTAGACTTTGAAAACTGCAGAGACATAAGCGATTTGAAGCAATATGATAGTGACGAACCTGAATTAAGGTCACTTTCAAGCTGGATACAGAGTGAGTTCAACAAGGCCTGTGAGCTAACTGATTCAGTCTGGATAGAGCTCGATGAAATTGGAGAGGACGTAGCCCCAATTGAGCACATTGCAAGCATGAGAAGGAATTATTTCACAGCAGAGGTGTCCCATTGTAGAGCTACTGAATACATAATGAAGGGGGTATACATTAACACTGCCCTGCTCAATGCATCCTGTGCAGCAATGGACGATTTTCAACTAATTCCCATGATAAGCAAGTGCAGAACTAAAGAGGGAAGGCGAAAAACCAATTTATATGGATTCATCATAAAGGGAAGATCTCATTTAAGGAATGACACAGACGTGGTAAATTTTGTGAGCATGGAGTTTTCTCTCACTGACCCGAGACTTGAGCCACATAAATGGGAGAAATACTGTGTCCTTGAGATAGGAGATATGTTACTAAGAAGTGCCATAGGCCAAATTTCAAGACCGATGTTCTTGTATGTGAGGACAAACGGAACATCAAAGGTCAAAATGAAATGGGGAATGGAGATGAGACGTTGCCTCCTTCAGTCACTCCAGCAGATCGAGAGCATGATTGAAGCCGAGTCCTCGGTTAAAGAGAAAGACATGACCAAAGAGTTTTTTGAGAATAAATCAGAAGCATGGCCCATTGGGGAGTCCCCCAAGGGAGTGGAAGAAGGTTCCATTGGGAAAGTCTGTAGGACTCTATTGGCTAAGTCAGTATTCAATAGCCTGTATGCATCACCACAATTGGAAGGATTTTCAGCGGAGTCAAGAAAACTGCTCCTTGTTGTTCAGGCTCTTAGGGACAACCTCGAACCTGGGACCTTTGATCTTGGGGGGCTATATGAAGCAATTGAGGAGTGCCTGATTAATGATCCCTGGGTTTTGCTCAATGCGTCTTGGTTCAACTCCTTCCTGACACATGCATTAAAATAG
                          ATGAAGACCATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAACAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCAAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAGCAGGTGAAATATGCGACAGTCCTCATCATATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGAAGCAGAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAACGGAACAAGCTCTGCTTGCATAAGGAGATCTAATAATAGTTTCTTTAGTAGATTGAATTGGTTGACCCACTTAAACTTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAAGGACCAAATCTTCCTGTATGCTCAAGCATCAGGAAGAATCACAGTATCTACCAAAAGAAGCCAACAAGCTGTAATCCCGAATATCGGATCTAGACCCAGAGTAAGGAATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAGCACTCTGAAATTGGCAACAGGAATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATAGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGATGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAAGAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGAAAGCTGAATAGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTCGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGCTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATTTGA
                          ATGGCGTCTCAAGGCACCAAACGGTCTTATGAACAGATGGAAACTGATGGGGATCGCCAGAATGCAACTGAGATTAGGGCATCCGTCGGGAAGATGATTGATGGAATTGGGAGATTCTACATCCAAATGTGCACTGAACTTAAACTCAGTGATCATGAAGGGCGGTTGATCCAGAACAGCTTGACAATAGAGAAAATGGTACTCTCTGCTTTTGATGAAAGAAGGAATAAATACCTGGAAGAACACCCCAGCGCGGGGAAAGATCCCAAGAAAACTGGGGGGCCCATATACAGGAGAGTCGATGGGAAATGGATGAGGGAACTCGTCCTTTATGACAAAGAAGAAATAAGGAGAATCTGGCGCCAAGCCAACAATGGTGAGGATGCTACATCTGGTCTAACCCACATAATGATTTGGCATTCCAATTTGAATGATGCAACATACCAGAGGACAAGAGCTCTTGTTCGAACTGGAATGGATCCCAGAATGTGCTCTCTGATGCAGGGCTCGACTCTCCCTAGAAGGTCCGGAGCTGCAGGTGCTGCAGTCAAAGGAATCGGAACAATGGTGATGGAACTGATCAGAATGGTCAAACGGGGGATCAACGATCGAAATTTTTGGAGAGGTGAGAATGGGCGGAAAACAAGAAGTGCTTATGAGAGAATGTGCAACATTCTTAAAGGAAAATTTCAAACAGCTGCACAAAGAGCAATGGTGGATCAAGTGAGAGAAAGTCGAAACCCAGGAAACGCTGAGATCGAAGATCTCATATTTTTAGCAAGATCTGCATTGATATTGAGAGGATCAGTTGCTCACAAATCTTGTCTACCTGCCTGTGCGTATGGACCTGCAGTATCCAGTGGGTACGACTTCGAAAAAGAGGGATATTCCTTGGTGGGAATAGACCCTTTCAAACTACTTCAAAATAGCCAAATATACAGCTTAATCAGACCTAACGAGAATCCAGCACACAAGAGTCAGCTGGTGTGGATGGCATGCCATTCTGCTGCATTTGAAGATTTAAGATTGTTAAGCTTCATCAGAGGGACAAAAGTATCTCCTCGGGGGAAACTGTCAACTAGAGGAGTACAAATTGCTTCAAATGAGAACATGGATAATATGGGATCGAGCACTCTTGAACTGAGAAGCGGGTACTGGGCCATAAGGACCAGGAGTGGAGGAAACACTAATCAACAGAGGGCCTCCGCAGGCCAAACCAGTGTGCAACCTACGTTTTCTGTACAAAGAAACCTCCCATTTGAAAAGTCAACCATCATGGCCGCATTCACTGGAAATACGGAGGGAAGAACTTCAGACATGAGGGCAGAAATCATAAGAATGATGGAAGGTGCAAAACCAGAAGAAGTGTCATTCCGGGGGAGGGGAGTTTTCGAGCTCTCAGACGAGAAGGCAACGAACCCGATCGTGCCCTCTTTTGATATGAGTAATGAAGGATCTTATTTCTTCGGAGACAATGCAGAAGAGTACGACAATTAA
                          ATGAATCCAAATCAAAAGATAATAACGATTGGCTCTGTTTCTCTCACCATTTCCACAATATGCTTCTTCATGCAAATTGCCATCTTGATAACTACTGTAACATTGCATTTCAAGCAATATGAATTCAACTCCCCCCCAAACAACCAAGTGATGCTGTGTGAACCGACAATAATAGAAAGAAACATAACAGAGATAGTGTATCTGACCAACACCACCATAGAGAAGGAAATATGCCCCAAACTAGCAGAATACAGAAATTGGTCAAAACCGCAATGTGACATTACAGGATTTGCACCTTTTTCTAAGGACAATTCGATTAGGCTTTCCGCTGGTGGGGACATCTGGGTGACAAGAGAACCTTATGTGTCATGCGATCCTGACAAGTGTTATCAATTTGCCCTTGGACAGGGAACAACACTAAACAACGTGCATTCAAATAACACAGTACGTGATAGGACCCCTTATCGGACCCTATTGATGAATGAGTTAGGTGTTCCTTTTCATCTGGGGACCAAGCAAGTGTGCATAGCATGGTCCAGCTCAAGTTGTCACGATGGAAAAGCATGGCTGCATGTTTGTATAACGGGGGATGATAAAAATGCAACTGCAAGCTTCATTTACAATGGGAGGCTTGTAGATAGTGTTGTTTCATGGTCCAAAGAAATTCTCAGGACCCAGGAGTCAGAATGCGTTTGTATCAATGGAACTTGTACAGTAGTAATGACTGATGGAAGTGCTTCAGGAAAAGCTGATACTAAAATACTATTCATTGAGGAGGGGAAAATCGTTCATACTAGCACATTGTCAGGAAGTGCTCAGCATGTCGAGGAGTGCTCTTGCTATCCTCGATATCCTGGTGTCAGATGTGTCTGCAGAGACAACTGGAAAGGCTCCAATAGGCCCATCGTAGATATAAACATAAAGGATCATAGCATAGTTTCCAGTTATGTGTGTTCAGGACTTGTTGGAGACACACCCAGAAAAAACGACAGCTCCAGCAGTAGCCATTGTTTGGATCCTAACAATGAAGAAGGTGGTCATGGAGTGAAAGGCTGGGCCTTTGATGATGGAAATGACGTGTGGATGGGAAGAACAATCAACGAGACGTCACGCTTGGGGTATGAAACCTTCAAAGTCATTGAAGGCTGGTCCAACCCTAAGTCCAAATTGCAGATAAATAGGCAAGTCATAGTTGACAAAGGTAATAGGTCCGGTTATTCTGGTATTTTCTCTGTTGAAGGCAAAAGCTGCATCAATCGGTGCTTTTATGTGGAGTTGATTAGGGGAAGAAAAGAGGAAACTGAAGTCTTGTGGACCTCAAACAGTATTGTTGTGTTTTGTGGCACCTCAGGTACATATGGAACAGGCTCATGGCCTGATGGGGCGGACCTCAATCTCATGCCTATATAA
                          ATGAGCCTTCTAACCGAGGTCGAAACGTATGTTCTCTCTATCGTTCCATCAGGCCCCCTCAAAGCCGAGATCGCGCAGAGACTTGAAGATGTCTTTGCTGGGAAAAACACAGATCTTGAGGCTCTCATGGAATGGCTAAAGACAAGACCAATTCTGTCACCTCTGACTAAGGGGATTTTGGGGTTTGTGTTCACGCTCACCGTGCCCAGTGAGCGAGGACTGCAGCGTAGACGCTTTGTCCAAAATGCCCTCAATGGGAATGGAGACCCAAATAACATGGACAAAGCAGTTAAACTGTATAGGAAACTTAAGAGGGAGATAACGTTCCATGGGGCCAAAGAAATAGCTCTCAGTTATTCTGCTGGTGCACTTGCCAGTTGCATGGGCCTCATATACAATAGGATGGGGGCTGTAACCACCGAAGTGGCATTTGGCCTGGTATGTGCAACATGTGAGCAGATTGCTGACTCCCAGCACAGGTCTCATAGGCAGATGGTGGCAACAACCAATCCATTAATAAAACATGAGAACAGAATGGTTTTGGCCAGCACTACTGCTAAGGCTATGGAGCAAATGGCTGGGTCAAGTGAGCAGGCAGCGGAGGCCATGGAGATTGCTAGTCAGGCCAGGCAGATGGTGCAGGCAATGAGAGCCATTGGGACTCATCCTAGTTCCAGTACTGGTCTAAGAGATGATCTTCTTGAAAATTTGCAGACCTATCAGAAACGAATGGGGGTGCAGATGCAACGATTCAAGTGACCCGCTTGTTGTTGCCGCGAATATCATTGGGATCTTGCACTTGATATTGTGGATTCTTGATCGTCTTTTTTTCAAATGCGTCTATCGACTCTTCAAACACGGCCTTAAAAGAGGCCCTTCTACGGAAGGAGTACCTGAGTCTATGAGGGAAGAATATCGAAAGGAACAGCAGAGTGCTGTGGATGCTGACGACAGTCATTTTGTCAGCATAGAGTTGGAGTAA
                          ATGGATTCCAACACTGTGTCAAGTTTCCAGGTAGATTGCTTTCTTTGGCATATCCGGAAACAAGTTGTAGACCAAGAAATGAGTGATGCCCCATTCCTTGATCGGCTTCGCCGAGATCAGAGGTCCCTAAGGGGAAGAGGCAATACTCTCGGTCTAGACATCAAAGCAGCCACCCATGTTGGAAAGCAAATTGTAGAAAAGATTCTGAAAGAAGAATCTGATGAGGCACTTAAAATGACCATGGTCTCCACACCTGCTTCGCGATACATAACTGACATGACTATTGAGGAATTGTCAAGAAACTGGTTCATGCTAATGCCCAAGCAGAAAGTGGAAGGACCTCTTTGCATCAGAATGGACCAGGCAATCATGGAGAAAAACATCATGTTAAAAGCGAATTTCAATGTGATTTTTGGCCGACTAGAGACCATAGTATTACTAAGGGCTTTCACCGAAGAGGGAGCAATTGTTGGCGAAATCTCACCATTGCCTTCTTTTCCAGGACATACTATTGAGGATGTCAAAAATGCAATTGGGGTCCTCATCGGAGGACTTGAATGGAATGATAACACAGTTCGAGTCTCTAAAAATCTACAGAGATTCGCTTGGAGAAGCAGTAATGAGAATGGGGGACCTCCACTTACTCCAAAACAGAAACGGGAAATGGCGAGAACAGCTAGGTCAAAAGTTTGAAGAGATAAGATGGCTAATTGAAGAAGTGAGACACAGATTAAGAACAACTGAAAATAGCTTTGAACAAATAACATTCATGCAAGCATTACAACTGCTGTTTGAAGTGGAACAGGAGATAAGAACTTTCTCATTTCAGCTTATTTAA
                          I'm interested in expert panflu damage estimates
                          my current links: [url]http://bit.ly/hFI7H[/url] ILI-charts: [url]http://bit.ly/CcRgT[/url]

                          Comment


                          • #14
                            Re: H3n2

                            summary, Jan.2013
                            -----------------------------

                            all current human H3N2 (except swinish H3N2v) goes back in all 8 segments to one ancester
                            from ~mid 2006 ("US-Index/2007" , one of the dominant strains in seasonal US-flu 2006/7)
                            similar to the "Brisbane" vax-strain.

                            Then we had the Perth-vax strain which was prevalent until Egypt/Iowa appeared
                            and is now no longer found.

                            then we had Egypt/Iowa which separated from Perth in most segments in ~2008,
                            was first seen in ~mid 2009 in Egypt,Kenya,Djibuti,Iowa and was dominant in ~2010

                            Egypt/Iowa has 63=10+13+7+15+3+9+3+3 mutations (as compared to US-Index/2007)
                            In NA,segment 6 we have a common ancestor from ~2009 with 7 mutations which later
                            reassorted with Egypt/Iowa to form the ancestor(~2010) of current human seasonal H3N2
                            ("Egypt_Iowa+NA")

                            In genbank 2011 we see basically 2 strains that emerged from US-Index/2007:
                            1.) Index1/2011 = normal Egypt_Iowa+NA with meanwhile 106=14+18+14+22+10+16+7+5
                            mutations as compared to US-Index/2007, including all the 61 of Egypt_Iowa+NA.
                            2.) Index2/2011 = reassortant Egypt-Iowa+NA in segments 3,4,5,6,7 plus one other new virus
                            from ~2007, also a descendent of US-Index/2007.
                            It has 110=25+22+11+27+4+8+7+6 mutations as compared toi US-Index/2007 including
                            all the 35=7+15+3+7+3 Egyt_Iowa+NA mutations from segments 3,4,5,6,7 and also
                            2+6+0 of the 10+13+3 Egypt/Iowa mutations from segments 1,2,8. So it separated from the
                            forming Egypt/Iowa in ~2008.
                            --------------edit--------------
                            3.) Index3/2011 = A/Czech Republik/121/2012/03/06(H3N2) -like , see below

                            Now as of Jan.2013 we have segments 4,6,7 from 2 recent H3N2 viruses from USA at genbank:
                            A/Georgia/3058/2012/09/26 and A/Oklahoma/3059/2012/10/05

                            GA3058 is a direct descendent of Index2/2011 in segments 4,6,7 (and in the other 5 segments too ?)
                            It has those 27+8+7 mutations plus 9+10+5 further,others mutations for a total of
                            36+18+12=66 (as compared to US-Index/2007, as usual)

                            OK3059 is a completely different virus, it descends from Egypt_Iowa+NA, but not from Index1/2011
                            nor from Index2/2011. It has 34+20+7 mutations in segments 4,6,7 including the 15+7+3
                            from Egypt_Iowa+NA and further 2+4+0 from Index1/2011 to which it is therefore a bit more related
                            then to Index2/2011

                            ================================================== ===============================
                            here the mentioned strains and their mutations:

                            Code:
                            21,>2007/02/06,14278,AUS,A/Brisbane/10/07
                              T735C(1),A1026G(1),G1029A(1),C1227T(1),T1794C(1)
                              C28A(2),G156A(2),T397C(2),C915T(2),T1365C(2),G2193A(2)
                              A1371G(3)
                              G46A(4),T60C(4),T903C(4)
                              A648G(5)
                              T935C(6),A1110G(6)
                              T354C(7),T540C(7)
                              A703G(8)
                            ------------------------------------------------------------
                             9,>Index/Brisbane-like/2007
                              
                              C652T(2),C2200A(2)
                              G129A(3),C1353T(3),A1377C(3)
                              A622G(4)
                              T27A(5),T513C(5),T1440G(5)
                            
                            
                            
                            --------------------------------------------------------------
                            8+8+8+12+5+7+5+2=55,>Index/Perth-like/2009
                              T228C(1),A708G(1),G873A(1),A1058G(1),G1149A(1),G1221A(1),G1920A(1),A2109G(1)
                              C141T(2),A155G(2),A981G(2),C1051T(2),C1726A(2),G1836A(2),G1953T(2),C2200A(2)
                              T153C(3),A303G(3),G456A(3),C561A(3),A1042G(3),A1060G(3),T1680A(3),G1689A(3)
                              G232A(4),T480A(4),A522C(4),A565C(4),T615A(4),C729T(4),T1130G(4),G1197A(4)
                                C1296T(4),C1548T(4),C1560A(4),A1578G(4)
                              G201A(5),G636A(5),G1348A(5),T1389C(5),C1488T(5)
                              A288G(6),G429A(6),G439A(6),A643G(6),C891A(6),A1029G(6),A1044G(6)
                              T267C(7),A492G(7),G521A(7),G591A(7),C685T(7)
                              G331A(8),C634T(8)
                            ----------------------------------------------------------------
                            10+13+7+15+3+9+3+3=63,>Index/2009/Egypt/Iowa
                              A187G(1),A303G(1),A708G(1),A861G(1),G873A(1),G981C(1),A1058G(1),G1149A(1)
                                G1221A(1),A1381G(1)
                              A105G(2),A155G(2),A195G(2),A405G(2),A981G(2),G1251A(2),T1566C(2),G1707A(2)
                                C1726A(2),G1759A(2),G2007A(2),C2200A(2),A2234G(2)
                              A96C(3),T153C(3),G339A(3),G363A(3),G1068A(3),C1365T(3),T1680G(3)
                              C318A(4),C483T(4),A522C(4),A565C(4),T615G(4),C660A(4),A682G(4),C729T(4)
                                G1005A(4),C1053A(4),T1130G(4),G1197A(4),C1296T(4),C1560A(4),A1578G(4)
                              G201A(5),A300C(5),A306G(5)
                              T77C(6),T78C(6),T85C(6),A119G(6),G439A(6),C471T(6),A643G(6),G1107A(6)
                                A1290G(6)
                              T267C(7),A492G(7),G521A(7)
                              G404A(8),A416G(8),A735G(8)
                            ------------------------------------------------------------------
                            10+13+7+15+3+7+3+3=61,>Index/2009/Egypt_Iowa+NA
                              A187G(1),A303G(1),A708G(1),A861G(1),G873A(1),G981C(1),A1058G(1),G1149A(1)
                                G1221A(1),A1381G(1)
                              A105G(2),A155G(2),A195G(2),A405G(2),A981G(2),G1251A(2),T1566C(2),G1707A(2)
                                C1726A(2),G1759A(2),G2007A(2),C2200A(2),A2234G(2)
                              A96C(3),T153C(3),G339A(3),G363A(3),G1068A(3),C1365T(3),T1680G(3)
                              C318A(4),C483T(4),A522C(4),A565C(4),T615G(4),C660A(4),A682G(4),C729T(4)
                                G1005A(4),C1053A(4),T1130G(4),G1197A(4),C1296T(4),C1560A(4),A1578G(4)
                              G201A(5),A300C(5),A306G(5)
                             G439A(6),A643G(6),C837T(6),G1100A(6),A1106C(6),A1281T(6),A1390C(6)
                              T267C(7),A492G(7),G521A(7)
                              G404A(8),A416G(8),A735G(8)
                            ------------------------------------------------------------------
                            vaccine strain A/Victoria/210/2009: 
                               P162S=P187S=C532T,I260M=I276M=A828G,R261Q=R277Q=G830A
                            -----------------------------------------------------------------
                            
                            25+22+11+27+4+8+7+6=110,>Index2/2011-reassortedEI/2011
                              C19T(1),G204A(1),G243A(1),G348A(1),C444T(1),C588T(1),G661T(1),C666A(1)
                                A708G(1),G763A(1),G846A(1),G878A(1),C966A(1),G981A(1),A1173C(1),G1284A(1)
                                G1629A(1),T1636C(1),A1653G(1),G1678A(1),C1680T(1),T1746C(1),G2061A(1),T2142C(1)
                                C2178A(1)
                              T81C(2),A105G(2),A155G(2),C198A(2),G381A(2),T447C(2),A465G(2),G486A(2)
                                C789T(2),G816A(2),T955C(2),A981G(2),G1082A(2),C1344T(2),C1726A(2),T1986C(2)
                                G2124T(2),C2151A(2),C2200A(2),G2211A(2),A2214G(2),A2234G(2)
                              A96C(3),T153C(3),G339A(3),G363A(3),T408C(3),C489T(3),G1068A(3),C1293T(3)
                                G1329A(3),C1365T(3),T1680G(3)
                              A108G(4),G205A(4),T291C(4),C318A(4),T328C(4),C483T(4),A522C(4),A565C(4)
                                T615G(4),C660A(4),A682G(4),C690T(4),C729T(4),A736G(4),A887C(4),G1005A(4)
                                C1009A(4),C1053A(4),T1130G(4),A1131G(4),G1197A(4),C1296T(4),T1353C(4),A1518G(4)
                                G1545A(4),C1560A(4),A1578G(4)
                              G165T(5),G201A(5),A300C(5),A306G(5)
                              G439A(6),A643G(6),C837T(6),G1100A(6),A1106C(6),C1113T(6),A1281T(6),A1390C(6)
                              C207A(7),T267C(7),C276T(7),G315A(7),A492G(7),G521A(7),C546A(7)
                              T6C(8),C150T(8),T386C(8),C429T(8),A747G(8),A796G(8)
                            -----------------------------------------------------------------
                            14+18+14+22+10+16+7+5=106,>Index1/2011-normalEIN/2011
                              C165T(1),A187G(1),A303G(1),A708G(1),A861G(1),G873A(1),G981C(1),A1058G(1)
                                G1149A(1),G1221A(1),T1335C(1),A1381G(1),A1878G(1),T2235C(1)
                              A105G(2),A155G(2),A195G(2),A405G(2),T447C(2),T772C(2),A981G(2),G1251A(2)
                                C1344A(2),G1389A(2),T1566C(2),G1707A(2),C1726A(2),G1757A(2),G1759A(2),C1995A(2)
                                G2007A(2),C2200A(2)
                              A96C(3),T153C(3),G339A(3),G363A(3),G516A(3),A795G(3),G813T(3),A962G(3)
                                A987G(3),G1068A(3),A1226G(3),C1365T(3),G1677A(3),T1680G(3)
                              T9C(4),A190G(4),G219T(4),C318A(4),A323G(4),C483T(4),A522C(4),A565C(4)
                                T615G(4),C660A(4),A682G(4),C729T(4),A983G(4),G1005A(4),C1053A(4),G1087A(4)
                                T1130G(4),G1185A(4),G1197A(4),C1296T(4),C1560A(4),A1578G(4)
                              C9T(5),G201A(5),A300C(5),A306G(5),C352A(5),T402C(5),G561A(5),G738A(5)
                                C825T(5),A1281C(5)
                              A165G(6),G267A(6),G439A(6),T609A(6),A643G(6),C666T(6),G732A(6),C837T(6)
                                T936A(6),G1095A(6),G1100A(6),A1106C(6),A1116G(6),G1199A(6),A1281T(6),A1390C(6)
                              T267C(7),T420C(7),A492G(7),G521A(7),A555T(7),A582G(7),A933G(7)
                              C79A(8),G390A(8),G404A(8),A416G(8),A735G(8)
                            -------------------------------------------------------------
                            34+20+7=61,>A/Oklahoma/3059/2012,2012/10/05
                            
                            
                            
                               C72T(4),A146G(4),G182A(4),C191T(4),C285T(4),C318A(4),A430G(4),C456T(4)
                                 A472G(4),A482G(4),C483T(4),G501A(4),A522C(4),A565C(4),T615G(4),G640T(4)
                                 C660A(4),A682G(4),G715A(4),C729T(4),T882G(4),A983G(4),G1005A(4),C1053A(4)
                                 G1087A(4),T1130G(4),A1195C(4),G1197A(4),C1254A(4),C1296A(4),A1524G(4),C1560A(4)
                                 A1578G(4),A1671G(4)
                            
                               A25T(6),C63T(6),T242C(6),G267A(6),A278G(6),T300C(6),G439A(6),C471T(6)
                                 A489G(6),A643G(6),C666T(6),G732A(6),G828A(6),C837T(6),G1095A(6),G1100A(6)
                                 A1106C(6),A1204G(6),A1281T(6),A1390C(6)
                               G180A(7),G189T(7),T267C(7),A441G(7),C468T(7),A492G(7),G521A(7)
                            
                            
                            -------------------------------------------------------------------
                            36+18+12=66,>A/Georgia/3058/2012,2012/09/26
                            
                            
                            
                            T9C(4),A33T(4),G39A(4),A52G(4),A70G(4),A108G(4),G205A(4),T291C(4)
                              C318A(4),T328C(4),C483T(4),A522C(4),A565C(4),T615G(4),C660A(4),A682G(4)
                              C690T(4),C729T(4),A736G(4),G765A(4),A887C(4),T975C(4),G1005A(4),C1009A(4)
                              C1053A(4),T1130G(4),A1131G(4),G1197A(4),C1296T(4),T1353C(4),C1509T(4),A1518G(4)
                              G1545A(4),G1557A(4),C1560A(4),A1578G(4)
                            
                            G204A(6),T242C(6),C399T(6),G439A(6),A643G(6),C837T(6),C903T(6),T945G(6)
                              A1016G(6),T1062C(6),G1100A(6),A1106C(6),C1113T(6),A1185G(6),A1204G(6),A1281T(6)
                              T1326C(6),A1390C(6)
                            C207A(7),T267C(7),C276T(7),G315A(7),G438A(7),C468T(7),A492G(7),G521A(7)
                              C546A(7),G839A(7),C859T(7),C874T(7),
                            -----------------------------------------------------


                            divide nucleotide-positions by 3 to get the amino-acid positions.

                            numbering the nucleotides of the coding region, other people often use
                            another numbering, e.g. substract 16 from the amino-acid positions to get the WHO numbering
                            mutations A<->G or C<->T at positions divisible by 3 are usually synonymous.

                            It would be useful to have a typical virus from the current outbreak with all 8 segments at genbank

                            -------------------------------------------------------------------------

                            there are currently 10 human HAs at genbank from June 2012 or later
                            3 are similar to GA3058 (Index2/2011,reassortant , 7 are similar to OK3059, new strain, now called "sgp11",
                            first seen in Singapore,July 2011 , see below
                            this could have led to reassortment between these 2

                            >A/Sao Paulo/49663/2012,2012/07/17
                            >A/Georgia/3058/2012,2012/09/26
                            >A/California/NHRC362744/2012,2012/11/06


                            >A/Guam/3049/2012,2012/08/08
                            >A/Guam/3050/2012,2012/06/15
                            >A/Guam/3057/2012,2012/08/24
                            >A/Japan/3060/2012,2012/10/17
                            >A/South Carolina/NHRC358725/2012,2012/08/24
                            >A/California/NHRC362154/2012,2012/10/25
                            >A/Oklahoma/3059/2012,2012/10/05

                            ----------------------------------------------------------------------------

                            sgp11 HAs at genbank:
                            Code:
                            >A/Singapore/TT430/2011,2011/07/29
                            >A/Singapore/GP1490/2011,2011/09/08
                            >A/Singapore/GP1503/2011,2011/09/13
                            >A/Singapore/KK398/2011,2011/09/19
                            >A/Singapore/TT654/2011,2011/10/04
                            >A/Singapore/GP1575/2011,2011/10/06
                            >A/Singapore/TT662 /2011,2011/10/11
                            >A/Singapore/TT663/2011,2011/10/11
                            >A/Singapore/KK445/2011,2011/10/17
                            >A/Singapore/GP1655/2011,2011/10/20
                            >A/Singapore/H2011.808bC/2011,2011/10/22
                            >A/Singapore/GP1669/2011,2011/10/24
                            >A/Singapore/KK459/2011,2011/10/24
                            >A/Singapore/TT717/2011,2011/11/01
                            >A/Singapore/GP1703/2011,2011/11/03
                            >A/Singapore/KK482/2011,2011/11/08
                            >A/Singapore/KK505/2011,2011/11/17
                            >A/Singapore/GP1760/2011,2011/11/18
                            >A/Singapore/GP1810/2011,2011/12/01
                            >A/Singapore/KK535/2011,2011/12/05
                            >A/Singapore/GP1846/2011,2011/12/09
                            >A/Singapore/TT815/2011,2011/12/13
                            >A/Singapore/TT827/2011,2011/12/13
                            >A/Singapore/GP1905/2011,2011/12/21
                            >A/Singapore/TT837/2011,2011/12/22
                            >A/Singapore/TT879/2011,2011/12/30
                            >A/Korea/AF2784/2012,2012/01/19
                            >A/Korea/AF2785/2012,2012/01/20
                            >A/Korea/AF2781/2012,2012/01/24
                            >A/Kyrgyzstan/3056/2012,2012/01/26
                            >A/Novosibirsk/RII09/2012,2012/01/29
                            >A/Novosibirsk/155/2012,2012/01/29
                            >A/Tyumen/03/2012,2012/01/30
                            >A/Moscow/02/2012,2012/02/01
                            >A/Novosibirsk/RII08/2012,2012/02/02
                            >A/Novosibirsk/13/2012,2012/02/02
                            >A/Pavia/81/2012,2012/02/07
                            >A/Pavia/95/2012,2012/02/09
                            >A/Krasnoyarsk/10/2012,2012/02/09
                            >A/Korea/AF2857/2012,2012/02/13
                            >A/Japan/AF2846/2012,2012/02/14
                            >A/Kyrgyzstan/3053/2012,2012/02/18
                            >A/Novosibirsk/26k/2012,2012/02/19
                            >A/Novosibirsk/22/2012,2012/02/20
                            >A/Korea/AF2856/2012,2012/02/21
                            >A/Novosibirsk/RII14/2012,2012/02/24
                            >A/Novosibirsk/16/2012,2012/02/24
                            >A/North Carolina/AF2843/2012,2012/02/28
                            >A/Korea/2970/2012,2012/03/01
                            >A/Nevada/3001/2012,2012/03/03
                            >A/Illinois/AF2867/2012,2012/03/05
                            >A/Saint Petersburg/RII16/2012,2012/03/05
                            >A/Huzhou/1113/2012,2012/03/05
                            >A/New York/AF2868/2012,2012/03/06
                            >A/Czech Republic/121/2012,2012/03/06
                            >A/Novosibirsk/RII25/2012,2012/03/06
                            >A/Kaliningrad/RII02/2012,2012/03/07
                            >A/Kyrgyzstan/3051/2012,2012/03/12
                            >A/Ohio/3029/2012,2012/03/14
                            >A/Ohio/3027/2012,2012/03/14
                            >A/Novosibirsk/59d/2012,2012/03/14
                            >A/Ekaterinburg/RII06/2012,2012/03/20
                            >A/Japan/2974/2012,2012/03/21
                            >A/Kyrgyzstan/3048/2012,2012/03/22
                            >A/Ohio/2992/2012,2012/03/26
                            >A/Ohio/3015/2012,2012/04/23
                            >A/Ohio/3016/2012,2012/04/23
                            >A/Guam/3050/2012,2012/06/15
                            >A/Guam/3049/2012,2012/08/08
                            >A/South Carolina/NHRC358725/2012,2012/08/24
                            >A/Guam/3057/2012,2012/08/24
                            >A/Oklahoma/3059/2012,2012/10/05
                            >A/Japan/3060/2012,2012/10/17
                            >A/California/NHRC362154/2012,2012/10/25
                            --------------------------------------------------------------------------

                            we had this HA in Russia, i.e. Novosibirsk , Feb.Mar 2012 , several viruses are at genbank
                            with segments 4,5,6,7,8 - 1,2,3 missing.
                            There are many mutations in that strain, at least 12,6,6,5,3 more than in Index1/2011
                            from which it seems to descend. Almost double as many as I'd expect in 1 year.

                            so it seems that USA now has this strain: (from which only segments 4,5,6,7,8 are available)
                            -------edit--------no, we have one virus with these mutations and all 8 segments at genbank !
                            It's A/Czech Republik/121/2012/03/06(H3N2) it has 156=28+27+23+33+10+19+10+6
                            mutations , descends from Egypt_Iowa+NA but not from Index1/2011 nor Index2/2011
                            and is similar to OK3059 in segments 4,6,7


                            A/Novosibirsk/RII08/2012,2012/02/02
                            A/Novosibirsk/RII09/2012,2012/01/29
                            A/Novosibirsk/13/2012,2012/02/02
                            A/Novosibirsk/155/2012,2012/01/29
                            A/Kaliningrad/RII02/2012,2012/03/07
                            A/Krasnoyarsk/10/2012,2012/02/09
                            A/Novosibirsk/RII14/2012,2012/02/24
                            A/Novosibirsk/22/2012,2012/02/20
                            A/Novosibirsk/16/2012,2012/02/24
                            A/Novosibirsk/26k/2012,2012/02/19
                            A/Novosibirsk/RII25/2012,2012/03/06
                            A/Saint Petersburg/RII16/2012,2012/03/05
                            A/Saint Petersburg/RII50/2012,2012/04/10
                            A/Moscow/02/2012,2012/02/01
                            A/Ekaterinburg/RII06/2012,2012/03/20
                            A/Tyumen/03/2012,2012/01/30,H3N2
                            A/Novosibirsk/59d/2012,2012/03/14




                            --------------------------------------------------------------------------

                            2013-01-25 : fludb uses the 5 available HAs for an antigenic analysis
                            A/Victoria/361/2011
                            A/Japan/3060/2012
                            A/Oklahoma/3059/2012
                            A/California/NHRC/362744/2012
                            A/California/NHRC/362154/2012
                            http://www.fludb.org/brcDocs/documen...content_v1.pdf
                            I'm interested in expert panflu damage estimates
                            my current links: [url]http://bit.ly/hFI7H[/url] ILI-charts: [url]http://bit.ly/CcRgT[/url]

                            Comment


                            • #15
                              Re: H3n2

                              82 H3N2-HAs from Canada, this season, today at genbank
                              (segment 4 only)

                              I count ~4(10) different introductions
                              82=7+32+11+32=7+(6+6+4+16)+(9+2)+(22+8+2)

                              7 are from the reassorted strain 2011-reassorted-EI, index2-2011
                              the other 75 are similar to CZ121 in HA, "index3-2011"

                              Code:
                                                                                 000000000000000000000000000000000000000000000000000000111111111111111111111111111111111 
                                                                                 000111111111222222222333444444555566666667777788889999000000001111222222333334555555666 
                                                                                 357023466889001446789224123578019900244990113625880188001134580139145699235671112347167 
                                                                                 952802625021589077651185900622181439203035456594273537591487671315554936383716384057321 
                              -codon-position------------------------------------ 1    2   2211  1     1 2 1 12 2    111    11 12 2  2  1     1   1         2  1    22   
                              ---Index-------------------------------------------GCCAGAATTGGCGAGCACTCTCTTGCACAAGTGTGGAGTCGTAGAGCGTATCATACATCCGGCTAACCCGCTGCTCCGGAAAGGTCA 
                                 1 >Index/2009/Egypt/Iowa                        .......................................................................................        0      0 ,      0      0       1:>Index/2009/Egypt/Iowa                        
                                 2 >Index/H3N3-2011-reassortedEI/2011(H3N2)      ...G........A.......C.C................T....G....C.....A........G.........C....G..A....       12     12 ,     12     12       2:>Index/H3N3-2011-reassortedEI/2011(H3N2)      
                                 3 >Index/H3N2-2011-normalEI/2011(H3N2)          ..............T.....................................G........A.........................        7      3 ,      7      3       3:>Index/H3N2-2011-normalEI/2011(H3N2)          
                                 4 >KC526210,A/Ontario/004/2013(H3N2)            ...G.G...A..A.......C.CC........A.....GT.CG.G....CC....A....T.T.G.........C.T..G..A.C..       24     24 ,     24     24       4:>KC526210,A/Ontario/004/2013(H3N2)            
                                 5 >KC535039,A/Quebec/016/2012(H3N2)             ...G.G...A..A.......C.CC........A....AGT.CG.G....CC....A....T.T.G.......---------------       38     35 ,     20     20       5:>KC535039,A/Quebec/016/2012(H3N2)             
                                 6 >KC535052,A/Quebec/030/2012(H3N2)             ...G.G...A..A.......C.CC........A....AGT.CG.G....CC....A....T.T.G........--------------       38     34 ,     21     20       6:>KC535052,A/Quebec/030/2012(H3N2)             
                                 7 >KC535043,A/Quebec/020/2012(H3N2)             ...G.G...A..A.......C.CC........A.....GT.CG.G....CC....A....T.T.G.......---------------       38     34 ,     20     19       7:>KC535043,A/Quebec/020/2012(H3N2)             
                                 8 >KC535060,A/Quebec/039/2012(H3N2)             ...G.G...A..A.......C.CC........A.....GT.CG.G....CC....A....T.T.G........--------------       37     33 ,     20     19       8:>KC535060,A/Quebec/039/2012(H3N2)             
                                 9 >KC539120,A/Alberta/054/2012(H3N2)            ...G.....A..A.......C.CC........A.....GT.CG.G....CC....A....T.T.G.........CYT..G..A.C..       26     24 ,     25     24       9:>KC539120,A/Alberta/054/2012(H3N2)            
                                10 >KC535055,A/Quebec/034/2012(H3N2)             ...G.G...A..A.......C.CC........A....AGT.CG.G....CC....A....T.T.G.....-----------------       43     37 ,     22     20      10:>KC535055,A/Quebec/034/2012(H3N2)             
                                11 >KC539119,A/Alberta/053/2012(H3N2)            ..T...G...AT.....T.........T..A......T.....A....G...G............C..A........A.....A..G       16     16 ,     16     16      11:>KC539119,A/Alberta/053/2012(H3N2)            
                                12 >KC539134,A/Alberta/068/2012(H3N2)            ..T...G...AT.....T.........T..A..C...T.....A....G...G............C..A........A.....A..G       17     17 ,     17     17      12:>KC539134,A/Alberta/068/2012(H3N2)            
                                13 >KC535022,A/British Columbia/023/2012(H3N2)   A.T...G...AT...............T..AC.....T.....A....G.C.G......T.A.C.C.TA...---------------       37     34 ,     19     19      13:>KC535022,A/British Columbia/023/2012(H3N2)   
                                14 >KC535045,A/Quebec/022/2012(H3N2)             A.T...G...AT...............T..AC.....T.....A....G.C.G......T.A.C.C.TA...---------------       37     34 ,     19     19      14:>KC535045,A/Quebec/022/2012(H3N2)             
                                15 >KC535046,A/Quebec/023/2012(H3N2)             A.T...G...AT...............T..AC.....T.....A....G.C.G......T.A.C.C.TA...---------------       38     34 ,     20     19      15:>KC535046,A/Quebec/023/2012(H3N2)             
                                16 >KC535042,A/Quebec/019/2012(H3N2)             A.T...G...AT...............T..AC.....T.....A....G...G......T.A.C.C.TA.-----------------       40     35 ,     20     18      16:>KC535042,A/Quebec/019/2012(H3N2)             
                                17 >KC526204,A/Ontario/030/2012(H3N2)            ..T...G.C.AT......CT.......T.GA......T..A..A....G...G...G..T.....C..AA........AGG....AG       25     25 ,     25     25      17:>KC526204,A/Ontario/030/2012(H3N2)            
                                18 >KC526209,A/Ontario/003/2013(H3N2)            ..T...G.C.AT......CT.......T.GA......T..A..A....G...G...G..T.....C..AA........AGG..----       29     27 ,     23     23      18:>KC526209,A/Ontario/003/2013(H3N2)            
                                19 >KC526212,A/Ontario/006/2013(H3N2)            ..T...G.C.AT......CT.......T.GA......T..A..A....G...G...G..T.....C..AA........AGG....AG       25     25 ,     25     25      19:>KC526212,A/Ontario/006/2013(H3N2)            
                                20 >KC535044,A/Quebec/021/2012(H3N2)             ..T...G.C.AT......CT.......T.GA......T..A..A....G...G...G..T.....C..AA..---------------       38     35 ,     20     20      20:>KC535044,A/Quebec/021/2012(H3N2)             
                                21 >KC535030,A/British Columbia/005/2013(H3N2)   ..T...G.C.AT......CT.......T.GA......T..A..A....G...G...G..T.....C..AA...--------------       38     34 ,     21     20      21:>KC535030,A/British Columbia/005/2013(H3N2)   
                                22 >KC526208,A/Ontario/002/2013(H3N2)            ..T...G.C.AT......CT.......T.GA......T..A..A....G...G...G..T.....C..AA..........G.....G       23     22 ,     23     22      22:>KC526208,A/Ontario/002/2013(H3N2)            
                                23 >KC535027,A/British Columbia/002/2013(H3N2)   ..T...G...AT.......T.......T.GA.A....T..A..A....G...G............C..A...---------------       35     31 ,     17     16      23:>KC535027,A/British Columbia/002/2013(H3N2)   
                                24 >KC535049,A/Quebec/026/2012(H3N2)             ..T...G...AT.......T.......T.GA...A..T..A..A....G...G.......A....C..A...---------------       37     32 ,     19     17      24:>KC535049,A/Quebec/026/2012(H3N2)             
                                25 >KC526207,A/Ontario/001/2013(H3N2)            ..T...G...AT.......T.......T.GA......T.....A....G...G............C..A..........GG.....G       21     17 ,     21     17      25:>KC526207,A/Ontario/001/2013(H3N2)            
                                26 >KC535061,A/Manitoba/001/2012(H3N2)           ..T...G...AT....G..T.......T.GA......T.....A....G...G.G..........C..A.T----------------       36     33 ,     17     17      26:>KC535061,A/Manitoba/001/2012(H3N2)           
                                27 >KC535062,A/Manitoba/002/2012(H3N2)           ..T...G...AT....G..T.......T.GA......T.....A....G...G.G..........C..A.T----------------       37     33 ,     18     17      27:>KC535062,A/Manitoba/002/2012(H3N2)           
                                28 >KC539115,A/Alberta/049/2012(H3N2)            ..T...G...AT....G..T.......T.GA......T.....A....G...G.G..........C..A.T.T......GGG....G       22     22 ,     22     22      28:>KC539115,A/Alberta/049/2012(H3N2)            
                                29 >KC539116,A/Alberta/050/2012(H3N2)            ..T...G...AT....G..T.......T.GA......T.....A....G...G.G..........C..A.T.T......GGG....G       22     22 ,     22     22      29:>KC539116,A/Alberta/050/2012(H3N2)            
                                30 >KC539117,A/Alberta/051/2012(H3N2)            ..T...G...AT....G..T.......T.GA......T.....A....G...G.G..........C..A.T.T......GGG...--       24     23 ,     21     21      30:>KC539117,A/Alberta/051/2012(H3N2)            
                                31 >KC539121,A/Alberta/055/2012(H3N2)            ..T...G...AT....G..T.......T.GA......T.....A....G...G.G..........C..A.T.T......GGG...--       24     23 ,     21     21      31:>KC539121,A/Alberta/055/2012(H3N2)            
                                32 >KC539122,A/Alberta/056/2012(H3N2)            ..T...G...AT....G..T.......T.GA......T.....A....G...G.G..........C..A.T.T......GGG....G       22     22 ,     22     22      32:>KC539122,A/Alberta/056/2012(H3N2)            
                                33 >KC539124,A/Alberta/058/2012(H3N2)            ..T...G...AT....G..T.......T.GA......T.....A....G...G.G..........C..A.T.T......GGG....G       22     22 ,     22     22      33:>KC539124,A/Alberta/058/2012(H3N2)            
                                34 >KC539127,A/Alberta/061/2012(H3N2)            ..T...G...AT....G..T.......T.GA......T.....A....G...G.G..........C..A.T.T......GGG....G       22     22 ,     22     22      34:>KC539127,A/Alberta/061/2012(H3N2)            
                                35 >KC539128,A/Alberta/062/2012(H3N2)            ..T...G...AT....G..T.......T.GA......T.....A....G...G.G..........C..A.T.T......GGG....G       23     22 ,     22     22      35:>KC539128,A/Alberta/062/2012(H3N2)            
                                36 >KC539130,A/Alberta/064/2012(H3N2)            ..T...G...AT....G..T.......T.GA......T.....A....G...G.G..........C..A.T.T......GGG....G       22     22 ,     22     22      36:>KC539130,A/Alberta/064/2012(H3N2)            
                                37 >KC539132,A/Alberta/066/2012(H3N2)            ..T...G...AT....G..T.......T.GA......T.....A....G...G.G..........C..A.T.T......GGG....G       22     22 ,     22     22      37:>KC539132,A/Alberta/066/2012(H3N2)            
                                38 >KC539133,A/Alberta/067/2012(H3N2)            ..T...G...AT....G..T.......T.GA......T.....A....G...G.G..........C..A.T.T......GGG....G       22     22 ,     22     22      38:>KC539133,A/Alberta/067/2012(H3N2)            
                                39 >KC539123,A/Alberta/057/2012(H3N2)            ..T...G...AT....G..T.......T.GA......T.....A....G...G.G..........C..A.T.T......GGG....G       23     22 ,     23     22      39:>KC539123,A/Alberta/057/2012(H3N2)            
                                40 >KC539131,A/Alberta/065/2012(H3N2)            ..T...G...AT....G..T.......T.GA......T.....A....G...G.G..........C..A.T.T......GGG....G       23     22 ,     23     22      40:>KC539131,A/Alberta/065/2012(H3N2)            
                                41 >KC539112,A/Alberta/046/2012(H3N2)            ..T...G...AT....G..T.......T.GA......T.....A....G...G.G..........C..A.T.T......GGG...--       25     23 ,     22     21      41:>KC539112,A/Alberta/046/2012(H3N2)            
                                42 >KC535026,A/British Columbia/001/2013(H3N2)   ..T...G...AT..A....T....A..T.GA......T.....A....G...G............C..A.-----------------       40     33 ,     19     16      42:>KC535026,A/British Columbia/001/2013(H3N2)   
                                43 >JX913034,A/Czech Republic/121/2012(H3N2)     ..T...G...AT............A..T..A......T.....A....G...G............C..A.................G       18     14 ,     18     14      43:>JX913034,A/Czech Republic/121/2012(H3N2)     
                                44 >KC535035,A/Quebec/012/2012(H3N2)             ..T...G...AT...T...T.......T.GA......T.....A.A..G..AG............C..A...---------------       37     32 ,     19     17      44:>KC535035,A/Quebec/012/2012(H3N2)             
                                45 >KC539118,A/Alberta/052/2012(H3N2)            ..T...G...AT...T...T.T.....T.GA......T.....A.A..G..AG............C..A....T......G.....G       21     21 ,     21     21      45:>KC539118,A/Alberta/052/2012(H3N2)            
                                46 >KC539135,A/Alberta/069/2012(H3N2)            ..T...G...AT...T...T.T.....T.GA......T.....A.A..G..AG............C..A....T......G.....G       21     21 ,     21     21      46:>KC539135,A/Alberta/069/2012(H3N2)            
                                47 >KC526213,A/Ontario/007/2013(H3N2)            ..T...G...AT...T...T.T.....T.GA......T.....A.A..G..AG............C..A....T......G.....G       22     21 ,     22     21      47:>KC526213,A/Ontario/007/2013(H3N2)            
                                48 >KC539113,A/Alberta/047/2012(H3N2)            ..T...G...AT...T...T.T.....T.GA......T.....A.A..G..AGC...........C..A....T......G.....G       22     22 ,     22     22      48:>KC539113,A/Alberta/047/2012(H3N2)            
                                49 >KC539114,A/Alberta/048/2012(H3N2)            ..T...G...AT...T...T.T.....T.GA......T.....A.A..G..AG............C..A....T......G.....G       22     21 ,     22     21      49:>KC539114,A/Alberta/048/2012(H3N2)            
                                50 >KC539125,A/Alberta/059/2012(H3N2)            ..T...G...AT...T...T.T.....T.GA......T.....A.A..G..AG............C..A....T......G.....G       22     21 ,     22     21      50:>KC539125,A/Alberta/059/2012(H3N2)            
                                51 >KC539136,A/Alberta/070/2012(H3N2)            ..T...GC..AT...T...T.......T.GA....T.T.....A.A..G..AG....C.......C..A...........G.....G       23     22 ,     23     22      51:>KC539136,A/Alberta/070/2012(H3N2)            
                                52 >KC535063,A/Manitoba/003/2012(H3N2)           ..T...GC..AT...T...T.......T.GA....T.T.....A.A..G..AG....C.......C.--------------------       49     39 ,     21     19      52:>KC535063,A/Manitoba/003/2012(H3N2)           
                                53 >KC539129,A/Alberta/063/2012(H3N2)            .AT...G...AT.GAT...T.......T.GA......T.....A.AA.G..AG............CT.A...........G.....G       24     24 ,     24     24      53:>KC539129,A/Alberta/063/2012(H3N2)            
                                54 >KC539126,A/Alberta/060/2012(H3N2)            .AT...G...AT.GAT...T.......T.GA......T.....A.AA.G..AG............CT.A......Y....G.....G       26     25 ,     26     25      54:>KC539126,A/Alberta/060/2012(H3N2)            
                                55 >KC526211,A/Ontario/005/2013(H3N2)            ..T...G...AT.......T......GTGGA......T.....A....G...G........A...C..A..A........G.....G       20     20 ,     20     20      55:>KC526211,A/Ontario/005/2013(H3N2)            
                                56 >KC526214,A/Ontario/008/2013(H3N2)            ..T...G...AT.......T......GTGGA......T.....A....G...G........A...C..A..A........G.....G       20     20 ,     20     20      56:>KC526214,A/Ontario/008/2013(H3N2)            
                                57 >KC535025,A/British Columbia/026/2012(H3N2)   ..T...G...AT.......T......GTGGA......T.....A....G...G........A...C..A.-----------------       38     34 ,     17     17      57:>KC535025,A/British Columbia/026/2012(H3N2)   
                                58 >KC535036,A/Quebec/013/2012(H3N2)             ..T...G...AT.......T......GTGGA......T.....A....G...G........A...C..A.-----------------       37     34 ,     17     17      58:>KC535036,A/Quebec/013/2012(H3N2)             
                                59 >KC535037,A/Quebec/014/2012(H3N2)             ..T...G...AT.......T......GTGGA......T.....A....G...G........A...C..A..----------------       36     33 ,     17     17      59:>KC535037,A/Quebec/014/2012(H3N2)             
                                60 >KC535038,A/Quebec/015/2012(H3N2)             ..T...G...AT.......T......GTGGA......T.....A....G...G........A...C..A..----------------       36     33 ,     17     17      60:>KC535038,A/Quebec/015/2012(H3N2)             
                                61 >KC535040,A/Quebec/017/2012(H3N2)             ..T...G...AT.......T......GTGGA......T.....A....G...G........A...C..A.-----------------       38     34 ,     17     17      61:>KC535040,A/Quebec/017/2012(H3N2)             
                                62 >KC535041,A/Quebec/018/2012(H3N2)             ..T...G...AT.......T......GTGGA......T.....A....G...G........A...C..A..----------------       36     33 ,     17     17      62:>KC535041,A/Quebec/018/2012(H3N2)             
                                63 >KC535047,A/Quebec/024/2012(H3N2)             ..T...G...AT.......T......GTGGA......T.....A....G...G........A...C..A..----------------       36     33 ,     17     17      63:>KC535047,A/Quebec/024/2012(H3N2)             
                                64 >KC535048,A/Quebec/025/2012(H3N2)             ..T...G...AT.......T......GTGGA......T.....A....G...G........A...C..A..A---------------       36     33 ,     18     18      64:>KC535048,A/Quebec/025/2012(H3N2)             
                                65 >KC535054,A/Quebec/033/2012(H3N2)             ..T...G...AT.......T......GTGGA......T.....A....G...G........A...C..A..A---------------       36     33 ,     18     18      65:>KC535054,A/Quebec/033/2012(H3N2)             
                                66 >KC535058,A/Quebec/037/2012(H3N2)             ..T...G...AT.......T......GTGGA......T.....A....G...G........A...C..A..----------------       36     33 ,     17     17      66:>KC535058,A/Quebec/037/2012(H3N2)             
                                67 >KC526205,A/Ontario/031/2012(H3N2)            ..T...G...AT.......T.....AGTGGA......T.....A....G...G........A...C..A..A........G.....G       21     21 ,     21     21      67:>KC526205,A/Ontario/031/2012(H3N2)            
                                68 >KC526206,A/Ontario/032/2012(H3N2)            ..T...G...AT.......T.....AGTGGA......T.....A....G...G........A...C..A..A........G.....G       21     21 ,     21     21      68:>KC526206,A/Ontario/032/2012(H3N2)            
                                69 >KC535034,A/Quebec/011/2012(H3N2)             ..T...G...AT.......T......GTGGA......T.....A....G...G........A...C..A..----------------       37     33 ,     18     17      69:>KC535034,A/Quebec/011/2012(H3N2)             
                                70 >KC535050,A/Quebec/028/2012(H3N2)             ..T...G...AT.......T......GTGGA.....GT.....A....G...G........A...C..A..A---------------       37     34 ,     19     19      70:>KC535050,A/Quebec/028/2012(H3N2)             
                                71 >KC535059,A/Quebec/038/2012(H3N2)             ..T...G...AT.......T......GTGGA.....GT.....A....G...G........A...C..A..----------------       37     34 ,     18     18      71:>KC535059,A/Quebec/038/2012(H3N2)             
                                72 >KC535051,A/Quebec/029/2012(H3N2)             ..T...G...AT.......T......GTGGA......T.....A....G...G........A...C..A..A---------------       37     33 ,     19     18      72:>KC535051,A/Quebec/029/2012(H3N2)             
                                73 >KC535053,A/Quebec/031/2012(H3N2)             ..T...G...AT.......T......GTGGA......T.....A....G...G........A...C..A..A---------------       37     33 ,     19     18      73:>KC535053,A/Quebec/031/2012(H3N2)             
                                74 >KC535064,A/Manitoba/004/2012(H3N2)           ..T...G...AT.......T......GTGGA......T.....A....G...G........A...C..A.-----------------       38     34 ,     18     17      74:>KC535064,A/Manitoba/004/2012(H3N2)           
                                75 >KC535056,A/Quebec/035/2012(H3N2)             ..T...G...AT.......T......GTGGA......T.....A...AG...G........A...C..A.-----------------       40     35 ,     19     18      75:>KC535056,A/Quebec/035/2012(H3N2)             
                                76 >KC535021,A/British Columbia/022/2012(H3N2)   ..T...G...AT.......T......GTGGA......T.....A....G...G............C..A..----------------       36     32 ,     17     16      76:>KC535021,A/British Columbia/022/2012(H3N2)   
                                77 >KC535028,A/British Columbia/003/2013(H3N2)   ..T.A.G...AT.......T......GTGGA......T.....A....G...GA....A......C..A..----------------       38     35 ,     19     19      77:>KC535028,A/British Columbia/003/2013(H3N2)   
                                78 >KC535032,A/British Columbia/007/2013(H3N2)   ..T.A.G...AT.......T......GTGGA......T.....A....G...GA....A.....-----------------------       57     40 ,     17     17      78:>KC535032,A/British Columbia/007/2013(H3N2)   
                                79 >KC535033,A/British Columbia/008/2013(H3N2)   ..T.A.G...AT.......T......GTGGA......T.....A....G...GA....A......C..A..----------------       38     35 ,     19     19      79:>KC535033,A/British Columbia/008/2013(H3N2)   
                                80 >KC535020,A/British Columbia/021/2012(H3N2)   ..T.A.G...AT.......T......GTGGA......T.....A....G...GA....A......C..A..----------------       39     35 ,     20     19      80:>KC535020,A/British Columbia/021/2012(H3N2)   
                                81 >KC535029,A/British Columbia/004/2013(H3N2)   ..T.A.G...AT.......T......GTGGA......T.....A....G...GA....A......C..A..----------------       39     35 ,     20     19      81:>KC535029,A/British Columbia/004/2013(H3N2)   
                                82 >KC535019,A/British Columbia/020/2012(H3N2)   -.T.A.G...AT.......T......GTGGA......T.....A....G...GA....A......C..A..A........G....--       28     24 ,     23     21      82:>KC535019,A/British Columbia/020/2012(H3N2)   
                                83 >KC535023,A/British Columbia/024/2012(H3N2)   ..T.A.G...AT.......T......GTGGA......T.....A....G...GA....A......C..A..----------------       40     35 ,     21     19      83:>KC535023,A/British Columbia/024/2012(H3N2)   
                                84 >KC535024,A/British Columbia/025/2012(H3N2)   ..T.A.G...AT.......T......GTGGA......T.....A...AG...GA....A......C..A.-----------------       42     37 ,     21     20      84:>KC535024,A/British Columbia/025/2012(H3N2)   
                                85 >KC535031,A/British Columbia/006/2013(H3N2)   ..T.......AT.......T......GTGGA......T.....A....G...G............C..A..----------------       37     31 ,     18     15      85:>KC535031,A/British Columbia/006/2013(H3N2)   
                                86 >KC535057,A/Quebec/036/2012(H3N2)             ..T...G...AT.......T......GTGGA..CA..T.....A....A...G............C..A..----------------       39     34 ,     20     18      86:>KC535057,A/Quebec/036/2012(H3N2)             
                                                                                                                                                                         
                              ---Index-------------------------------------------GCCAGAATTGGCGAGCACTCTCTTGCACAAGTGTGGAGTCGTAGAGCGTATCATACATCCGGCTAACCCGCTGCTCCGGAAAGGTCA 
                              -codon-position------------------------------------ 1    2   2211  1     1 2 1 12 2    111    11 12 2  2  1     1   1         2  1    22   
                                                                                 000000000000000000000000000000000000000000000000000000111111111111111111111111111111111 
                                                                                 000111111111222222222333444444555566666667777788889999000000001111222222333334555555666 
                                                                                 357023466889001446789224123578019900244990113625880188001134580139145699235671112347167 
                                                                                 952802625021589077651185900622181439203035456594273537591487671315554936383716384057321
                              amino acids:
                              (same positions-numeration as in the pdf from fludb above
                              but substract 16 to get the WHO-enumeration (in the first part) )

                              Code:
                                                                          000000000000000000000000000000000000000000000000
                                                                          000000000000011111111112222222223333333334445555
                                                                          124456666777800134456780113488990122677890290236
                                                                          963991469038348070481378459658468708324452745681
                                                                          ------------------------------------------------
                                                                          LTKQVSTEDSQEIVKYNSTRNLNIASVIRANEKTANVQSKGGKIDGIR
                              >Index/2009/Egypt/Iowa                      ................................................
                              >Index/H3N3-2011-reassortedEI/2011(H3N2)    ........N......H...........V...A................
                              >Index/H3N2-2011-normalEI/2011(H3N2)        ......A...H...R....................SM...........
                              >KC526210,A/Ontario/004/2013(H3N2)          ........N......H.........A.V...A..............T.
                              >KC535039,A/Quebec/016/2012(H3N2)           ........N......H........TA.V...A...........-----
                              >KC535052,A/Quebec/030/2012(H3N2)           ........N......H........TA.V...A...........-----
                              >KC535043,A/Quebec/020/2012(H3N2)           ...H....N......H.........A.V...A...........-----
                              >KC535060,A/Quebec/039/2012(H3N2)           ........N......H.........A.V...A.I.........-----
                              >KC539120,A/Alberta/054/2012(H3N2)          ........N......H.........A.V...A..D...........T-
                              >KC535055,A/Quebec/034/2012(H3N2)           ........N......Q........TA.V...A..........------
                              >KC539119,A/Alberta/053/2012(H3N2)          ...R.NI.................S.I...K....S.........E.-
                              >A/Victoria/361(vaccine-strain)/2011(H3N2)  .....NI.................S.I........S............
                              >KC539134,A/Alberta/068/2012(H3N2)          ...R.NI.................S.I...K....S.........E..
                              >KC535022,A/British Columbia/023/2012(H3N2) ...R.NI..............S..S.I...K....SM......-----
                              >KC535045,A/Quebec/022/2012(H3N2)           ...R.NI..............S..S.I...K....SM......-----
                              >KC535046,A/Quebec/023/2012(H3N2)           ...R.NI..............S..S.I...K....SM......-----
                              >KC535042,A/Quebec/019/2012(H3N2)           ...R.NI..............S..S.I...K....SM......-----
                              >KC526204,A/Ontario/030/2012(H3N2)          ...R.NI.............S...S.I...K....S........N...
                              >KC526209,A/Ontario/003/2013(H3N2)          ...R.NI.............S...S.I...K....S........N---
                              >KC526212,A/Ontario/006/2013(H3N2)          ...R.NI.............S...S.I...K....S........N...
                              >KC535044,A/Quebec/021/2012(H3N2)           ...R.NI.............S...S.I...K....S.......-----
                              >KC535030,A/British Columbia/005/2013(H3N2) ...R.NI....K........S...S.I...K....S.......-----
                              >KC526208,A/Ontario/002/2013(H3N2)          ...R.NI.............S...S.I...K....S............
                              >KC535027,A/British Columbia/002/2013(H3N2) ...R.NI.............S...S.I...K....S.......-----
                              >KC535049,A/Quebec/026/2012(H3N2)           ...R.NI.............S...S.I...K....S.......-----
                              >KC526207,A/Ontario/001/2013(H3N2)          ...R.NI.........S...S...S.I...K....S.......M....
                              >KC535061,A/Manitoba/001/2012(H3N2)         ...R.NI.....V.......S...S.I...K....S.......-----
                              >KC535062,A/Manitoba/002/2012(H3N2)         ...R.NI.....V.......S...S.I...K....S.......-----
                              >KC539115,A/Alberta/049/2012(H3N2)          ...R.NI.....V.......S...S.I...K....S............
                              >KC539116,A/Alberta/050/2012(H3N2)          ...R.NI.....V.......S...S.I...K....S............
                              >KC539117,A/Alberta/051/2012(H3N2)          ...R.NI.....V.......S...S.I...K....S...........-
                              >KC539121,A/Alberta/055/2012(H3N2)          ...R.NI.....V.......S...S.I...K....S...........-
                              >KC539122,A/Alberta/056/2012(H3N2)          ...R.NI.....V.......S...S.I...K....S............
                              >KC539124,A/Alberta/058/2012(H3N2)          ...R.NI.....V.......S...S.I...K....S............
                              >KC539127,A/Alberta/061/2012(H3N2)          ...R.NI.....V.......S...S.I...K....S............
                              >KC539128,A/Alberta/062/2012(H3N2)          ...R.NI.....V.......S...S.I...K....S...........-
                              >KC539130,A/Alberta/064/2012(H3N2)          ...R.NI.....V.......S...S.I...K....S...........-
                              >KC539132,A/Alberta/066/2012(H3N2)          ...R.NI.....V.......S...S.I...K....S...........-
                              >KC539133,A/Alberta/067/2012(H3N2)          ...R.NI.....V.......S...S.I...K....S............
                              >KC539123,A/Alberta/057/2012(H3N2)          ...R.NI.....V.......S...S.I...K....S...........-
                              >KC539131,A/Alberta/065/2012(H3N2)          ...R.NI.....V.......S...S.I...K....S............
                              >KC539112,A/Alberta/046/2012(H3N2)          ...R.NI.....V.......S...S.I...K....S...........-
                              >KC535026,A/British Columbia/001/2013(H3N2) ...R.NI..........N..S...S.I...K.R..S......------
                              >JX913034,A/Czech Republic/121/2012(H3N2)   ...R.NIK.........N....D.S.I...K....S............
                              >KC535035,A/Quebec/012/2012(H3N2)           ..ER.NI......I......S...S.I...K....S.......-----
                              >KC539118,A/Alberta/052/2012(H3N2)          ...R.NI.............S...S.I...K....S............
                              >KC539135,A/Alberta/069/2012(H3N2)          ...R.NI.............S...S.I...K....S...........-
                              >KC526213,A/Ontario/007/2013(H3N2)          ...R.NI.............S...S.I...K....S............
                              >KC539113,A/Alberta/047/2012(H3N2)          ...R.NI.............S...S.I...K....S............
                              >KC539114,A/Alberta/048/2012(H3N2)          .K.R.NI.............S...S.I...K....S............
                              >KC539125,A/Alberta/059/2012(H3N2)          ...R.NI.............S...S.I...K....S............
                              >KC539136,A/Alberta/070/2012(H3N2)          ...R.NI.............S...S.I...K....S...........M
                              >KC535063,A/Manitoba/003/2012(H3N2)         ...R.NI.............S...S.I...K....S.....R------
                              >KC539129,A/Alberta/063/2012(H3N2)          I..R.NI..G..........S...S.I...K....S............
                              >KC539126,A/Alberta/060/2012(H3N2)          I..R.NI..G..........S...S.I...K....S............
                              >KC526211,A/Ontario/005/2013(H3N2)          ...R.NI...........AGS...S.I...K....SM...........
                              >KC526214,A/Ontario/008/2013(H3N2)          ...R.NI...........AGS...S.I...K....SM...........
                              >KC535025,A/British Columbia/026/2012(H3N2) ...R.NI...........AGS...S.I...K....SM.....------
                              >KC535036,A/Quebec/013/2012(H3N2)           ...R.NI...........AGS...S.I...K....SM......-----
                              >KC535037,A/Quebec/014/2012(H3N2)           ...R.NI...........AGS...S.I...K....SM......-----
                              >KC535038,A/Quebec/015/2012(H3N2)           ...R.NI...........AGS...S.I...K....SM......-----
                              >KC535040,A/Quebec/017/2012(H3N2)           ...R.NI...........AGS...S.I...K....SM.....------
                              >KC535041,A/Quebec/018/2012(H3N2)           ...R.NI...........AGS...S.I...K....SM......-----
                              >KC535047,A/Quebec/024/2012(H3N2)           ...R.NI...........AGS...S.I...K....SM......-----
                              >KC535048,A/Quebec/025/2012(H3N2)           ...R.NI...........AGS...S.I...K....SM......-----
                              >KC535054,A/Quebec/033/2012(H3N2)           ...R.NI...........AGS...S.I...K....SM......-----
                              >KC535058,A/Quebec/037/2012(H3N2)           ...R.NI...........AGS...S.I...K....SM......-----
                              >KC526205,A/Ontario/031/2012(H3N2)          ...R.NI..........RAGS...S.I...K....SM...........
                              >KC526206,A/Ontario/032/2012(H3N2)          ...R.NI..........RAGS...S.I...K....SM...........
                              >KC535034,A/Quebec/011/2012(H3N2)           ...R.NI...........AGS...S.I..VK....SM......-----
                              >KC535050,A/Quebec/028/2012(H3N2)           ...R.NI...........AGS..VS.I...K....SM......-----
                              >KC535059,A/Quebec/038/2012(H3N2)           ...R.NI...........AGS..VS.I...K....SM......-----
                              >KC535051,A/Quebec/029/2012(H3N2)           ...R.NI...........AGS...S.I...K....SML.....-----
                              >KC535053,A/Quebec/031/2012(H3N2)           ...R.NI...........AGS...S.I...K....SM......-----
                              >KC535064,A/Manitoba/004/2012(H3N2)         ...R.NI...........AGS...S.I...K....SM.....R-----
                              >KC535056,A/Quebec/035/2012(H3N2)           ...R.NI...........AGS...S.I.K.K....SM.....------
                              >KC535021,A/British Columbia/022/2012(H3N2) ...R.NI...........AGS...S.I...K....S.......-----
                              >KC535028,A/British Columbia/003/2013(H3N2) ...R.NI...........AGS...S.I...K....S.......-----
                              >KC535032,A/British Columbia/007/2013(H3N2) ...R.NI...........AGS...S.I...K....S..----------
                              >KC535033,A/British Columbia/008/2013(H3N2) ...R.NI...........AGS...S.I...K....S.......-----
                              >KC535020,A/British Columbia/021/2012(H3N2) ...R.NI...........AGS...S.I...K....S...E...-----
                              >KC535029,A/British Columbia/004/2013(H3N2) ...R.NI...........AGS...S.I...K....S....R..-----
                              >KC535019,A/British Columbia/020/2012(H3N2) ...RINI...........AGS...S.I...K....S...........-
                              >KC535023,A/British Columbia/024/2012(H3N2) ...R.NI...........AGS...S.I...K....S.......-----
                              >KC535024,A/British Columbia/025/2012(H3N2) ...R.NI...........AGS...S.I.K.K....S......------
                              >KC535031,A/British Columbia/006/2013(H3N2) .....NI...........AGS...S.I...K....S..F....-----
                              >KC535057,A/Quebec/036/2012(H3N2)           ...R.NI...........AGS...S.I...K....S.......-----
                                                                          000000000000000000000000000000000000000000000000
                                                                          000000000000011111111112222222223333333334445555
                                                                          124456666777800134456780113488990122677890290236
                                                                          963991469038348070481378459658468708324452745681
                                                                          ------------------------------------------------
                                                                          LTKQVSTEDSQEIVKYNSTRNLNIASVIRANEKTANVQSKGGKIDGIR
                              I'm interested in expert panflu damage estimates
                              my current links: [url]http://bit.ly/hFI7H[/url] ILI-charts: [url]http://bit.ly/CcRgT[/url]

                              Comment

                              Working...
                              X