Announcement

Collapse
No announcement yet.

Infezioni umane da nuovo coronavirus (Aggiornamenti da OMS, ECDC, CDC, EpiCentro), Ricerca, Schede Tecniche

Collapse
This is a sticky topic.
X
X
  • Filter
  • Time
  • Show
Clear All
new posts

  • Infezioni umane da nuovo coronavirus (Aggiornamenti da OMS, ECDC, CDC, EpiCentro), Ricerca, Schede Tecniche

    [Fonte: Organizzazione Mondiale della Sanità, pagina originale in Inglese: (LINK). Testo tradotto e adattato.]
    Infezione da nuovo coronavirus in Gran Bretagna


    23 settembre 2012


    Il giorno 22 settembre 2012 la Gran Bretagna ha informato l’OMS di un caso di sindrome respiratoria acuta con insufficienza renale in un soggetto che aveva viaggiato in Arabia Saudita e Qatar.

    Il caso riguarda una persona senza storia clinica pregressa di rilievo, dell’età di 49 anni, residente in Qatar che aveva sviluppato sintomatologia il 3 settembre scorso e che aveva compiuto un viaggio in Arabia Saudita nel periodo precedente l’esordio dei sintomi.

    Il 7 settembre il paziente è stato ricoverato in terapia intensiva a Doha, Qatar.

    L’11 settembre è stato trasferito con un volo speciale in Gran Bretagna.

    L’Agenzia per la Protezione della Salute britannica (HPA) ha condotto delle analisi di laboratorio che hanno confermato la presenza di un nuovo tipo di coronavirus.

    L’HPA ha quindi effettuato una comparazione genetica tra il virus isolato dal paziente di 49 anni ed uno identificato in precedenza presso il Centro Medico Universitario Erasmus in Olanda. Il virus isolato in Olanda proveniva da un campione di polmone prelevato a un paziente deceduto di 60 anni di età, residente in Arabia Saudita. Le analisi indicano una identità genetica del 99.5% con una differenza limitata a un nucleotide fra le regioni esplorate.

    I Coronavirus sono una famiglia di virus molto ampia che comprende ceppi coinvolti in semplici raffreddori o in malattie molto gravi come la SARS.

    L’OMS sta cercando di ottenere maggiori informazioni sui due casi confermati per determinare le possibili implicazioni per la salute pubblica derivanti dalla scoperta di questo nuovo coronavirus.

    L’OMS non raccomanda l’adozione di misure di restrizione ai viaggi riguardo l’attuale situazione.


    Informazioni e raccomandazioni per la stagione dell’Hajj 2012 sono disponibili seguendo questo link: http://www.who.int/ith/updates/20120730/en/index.html
    -
    ------

  • #2
    Malattia Respiratoria Acuta causata da un nuovo virus, Gran Bretagna (Agenzia Protezione Salute, 23 settembre 2012, adattato)

    [Fonte: Agenzia per la Protezione della Salute, Gran Bretagna, pagina originale in Inglese: (LINK). Testo tradotto e adattato.]
    Malattia Respiratoria Acuta causata da un nuovo virus, Gran Bretagna

    23 settembre 2012



    L’Agenzia per la Protezione della Salute (HPA) britannica è in grado di confermare la diagnosi di un caso di malattia respiratoria severa acuta causata da un nuovo tipo di coronavirus. Il paziente coinvolto, originario del Medio Oriente e di recente giunto in GB, è attualmente ricoverato in terapia intensiva in un ospedale di Londra.

    Nel corso degli ultimi mesi questo nuovo coronavirus è stato identificato in un altro paziente affetto da malattia respiratoria severa acuta in Arabia Saudita, poi deceduto.

    I Coronavirus sono causa di infezioni respiratorie lievi fra cui il raffreddore comune ma possono provocare anche malattie gravi come la SARS (Sindrome Respiratoria Severa Acuta).

    Questo nuovo virus, tuttavia, differisce da quelli finora conosciuti e causa di malattia nell’uomo. Le indagini preliminari non hanno rivelato segni di malattia nei soggetti entrati in contatto con questi due pazienti, compreso il personale sanitario.

    Sulla base di quanto si sa sugli altri coronavirus, molti di questi soggetti hanno ormai passato il periodo durante il quale avrebbero potuto manifestare I segni di una infezione contratta dagli ammalati.

    Si è anche informati di un piccolo numero di altri casi di grave infezione respiratoria registrati in Medio Oriente nel corso degli ultimi tre mesi, uno dei quali trattato in Gran Bretagna e deceduto.

    Quest’ultimo caso è sottoposto ad indagine sebbene non esista al momento prova che suggerisca un coinvolgimento del nuovo coronavirus nella malattia che ha colpito gli altri due casi confermati o sia in qualche modo correlato con essi.

    Nessun altro caso confermato è stato identificato alla data in Gran Bretagna.

    Il professor John Watson, Capo del Dipartimento Malattie Respiratorie dell’HPA, ribadisce che: ‘’L’HPA sta raccomandando al personale sanitario di trattare in modo appropriato il caso in questione.’’

    ‘’Alla luce della gravita’ della malattia che è stata descritta in questi due casi confermati, sono state intraprese tutte le misure necessarie per assicurarsi che I soggetti entrati in contatto con I malati non abbiano sviluppato essi stessi l’infezione. Al momento non c’è prova di infezione fra di essi.’’

    ‘’Una informativa per il personale sanitario in Gran Bretagna è in corso di preparazione cosiccome sui mezzi per incrementare la vigilanza su questo virus. Le informazioni a disposizione sono condivise con le altre autorità sanitarie nazionali e internazionali, compresa l’Organizzazione Mondiale della Sanità e il Centro Europeo per la Prevenzione e il Controllo delle Malattie.’’

    ‘’Dal momento che si conoscono soltanto due casi confermati in tutto il mondo di questa malattia e che non esistono prove specifiche di una trasmissione in corso, al momento non si ravvede la necessità di fornire particolari consigli al pubblico o ai viaggiatori; in ogni caso, verrà dato conto di ogni nuovo sviluppo della situazione.’’


    (…)
    -
    ------

    Comment


    • #3
      Nuovo Coronavirus, Informazioni per il personale sanitario, Settembre 2012 (Agenzia Protezione Salute, GB, 23 settembre 2012, adattato)

      [Fonte: Agenzia per la Protezione della Salute, Gran Bretagna, testo originale in Inglese: (LINK). Tradotto e adattato.]
      Nuovo Coronavirus, Informazioni per il personale sanitario, Settembre 2012



      Il 21 settembre 2012 un nuovo coronavirus è stato identificato nei campioni delle basse vie respiratorie prelevati a un paziente originario del Qatar ricoverato in ospedale a Londra per una grave malattia respiratoria.

      Il virus è lo stesso isolato dai ricercatori in Olanda che lo hanno rinvenuto in un campione di tessuto polmonare prelevato dal cadavere di un soggetto originario dell’Arabia Saudita, deceduto in seguito a polmonite.

      Si tratta degli unici due casi di cui si conosce con certezza la presenza di questo nuovo virus.

      Esiste una grande varietà di coronavirus, da quelli che causano semplici raffreddori ad altri in grado di provocare malattie molto piu’ gravi, come per esempio la SARS.

      Alla luce della gravità della malattia osservata in questi due casi e della natura ancora oscura di questo nuovo virus, il paziente ricoverato a Londra è gestito in modo da assicurare il massimo isolamento respiratorio mentre il personale sanitario deve indossare l’equipaggiamento di protezione personale durante la terapia, che comprende un respiratore di tipo FFP3 (di cui deve essere controllato l’appropriato posizionamento), guanti, tuta e occhiali.

      Ogni soggetto entrato in contatto con il paziente nel corso della sua malattia è sottoposto a sorveglianza sanitaria, incluso il personale sanitario che ha fornito le prime cure a diretto contatto con il malato o ne ha curato l’esame clinico e che avesse mostrato sintomatologia in quel periodo.

      Il periodo di incubazione è attualmente considerato della durata di sette giorni e perciò ogni malattia respiratoria con esordio compreso nei sette giorni successivi all’ultimo contatto con il paziente è ritenuta rilevante e I responsabili degli staff sanitari devono renderne conto ai loro superiori o datori di lavoro al piu’ presto possibile. I sintomi comprendono febbre, tosse e altri segni respiratori.

      Allo stato dei fatti, ogni individuo che ritorni da un viaggio recente in Arabia Saudita o Qatar e presenti una malattia respiratoria seria dovrebbe essere gestito in stretto isolamento respiratorio (si consiglia un ambiente a pressione negativa) e il personale sanitario dovrebbe indossare l’equipaggiamento di protezione personale sopra descrito.

      I medici ritengano di aver individuato un caso che corrisponda ai criteri clinici sopra citati dovrebbero contattare il numero 0844 7788990.

      Tutti coloro che siano interessati a conoscere meglio l’evento in atto possono contattare I servizi sanitari di loro competenza.


      Ultima revisione: 23 settembre 2012
      -
      ------

      Comment


      • #4
        Due casi di infezione da coronavirus confermati – Aggiornamento Epidemiologico (ECDC, 24 settembre 2012, adattato)

        [Fonte: Centro Europeo per la Prevenzione e il Controllo delle Malattie, pagina originale in Inglese: (LINK). Testo tradotto e adattato.]
        Due casi di infezione da coronavirus confermati – Aggiornamento Epidemiologico

        24 settembre 2012



        Un nuovo coronavirus è stato identificato tramite test di laboratorio effettuati sui campioni prelevati a due pazienti, entrambi sofferenti di una grave malattia respiratoria e insufficienza renale.

        Entrambi avevano compiuto dei viaggi in Arabia Saudita nel corso degli ultimi mesi.

        Non è chiaro al momento se I virus sono identici fra loro ma ci sono forti indicazioni che possano esserlo.

        Un soggetto con cittadinanza britannica ma originario del Qatar ha sviluppato I primi sintomi di malattia il 3 settembre scorso ed è stato quindi ricoverato in un ospedale a Doha, Qatar. E’ stato trasferito in Gran Bretagna l’11 settembre tramite un volo speciale; si trova ora ricoverato in un reparto di terapia intensiva di un ospedale di Londra. L’uomo aveva effettuato un viaggio in Arabia Saudita.

        Il primo caso di infezione causato da questo virus è stato registrato in un paziente di 60 anni di età, a Jeddah, in Arabia Saudita nel giugno scorso. Il paziente è in seguito deceduto.

        Lo stesso tipo di coronavirus isolato da questo paziente è stato poi identificato anche nel paziente del Qatar tramite le analisi effettuate presso il Centro Medico Universitario Erasmus di Rotterdam, Olanda.

        Nessun altro caso è stato identificato al momento.

        I Coronavirus sono un gruppo di virus che causano infezioni respiratorie nell’animale e nell’uomo. Un terzo di tutte le infezioni lievi, non complicate, del tratto respiratorio superiore negli adulti è causato da coronavirus.

        L’ECDC sta operando in stretto contatto con l’Agenzia per la Protezione della Salute (HPA) della Gran Bretagna, con il Centro Medico Universitario Erasmus, con l’OMS (quartier generale e ufficio regionale per l’Europa) e con la Commissione Europea per coordinare lo scambio di informazioni, e per la valutazione del rischio di una ulteriore diffusione della malattia e per supportare le misure di risposta piu’ appropriate.



        Maggiori Informazioni
        -
        ------

        Comment


        • #5
          Coronavirus: sorveglianza e cooperazione sono la chiave per l’identificazione precoce dei casi e la valutazione del rischio (ECDC, 25/9/12)

          [Fonte: Centro Europeo per la Prevenzione e il Controllo delle Malattie (ECDC), pagina originale in Inglese: (LINK). Testo tradotto e adattato.]
          Coronavirus: sorveglianza e cooperazione sono la chiave per l’identificazione precoce dei casi e la valutazione del rischio

          25 settembre 2012 / ECDC



          Le Autorità Europee, Nazionali e Internazionali stanno cooperando insieme sin dalla prima identificazione di due casi di infezione causati da un nuovo tipo di coronavirus. Uno di questi è deceduto in Arabia Saudita mentre il secondo si trova attualmente ricoverato in terapia intensiva in un ospedale di Londra.

          Questo nuovo coronavirus non è geneticamente assimilabile al virus che causa la SARS (Sindrome Respiratoria Acuta Severa) e la sua comparsa non indica l’inizio di una nuova epidemia di SARS.

          Non c’è prova di trasmissione del nuovo virus da persona a persona, come invece è stato nel caso della SARS, e inoltre la sintomatologia è diversa.

          I Coronavirus sono responsabili di infezioni molto lievi, del tutto simili al comune raffreddore, ma – in certuni casi – possono provocare malattie molto gravi come appunto testimonia l’epidemia internazionale di SARS nel 2003.

          Per comprendere appieno le implicazioni per la salute pubbliche derivanti dalla scoperta di questo nuovo coronavirus sono necessarie ulteriori indagini. Tuttavia, sulla base delle informazioni disponibili, l’ECDC valuta l’attuale rischio come minimo.

          L’unico modo con il quale si possa costruire una appropriata conoscenza del comportamento del virus è rappresentato da una sorveglianza coordinata a livello internazionale e tramite l’utilizzo delle analisi di laboratorio.

          Il valore dei laboratori è stato dimostrato dall’eccellente lavoro svolto da quelli dell’Agenzia per la Protezione della Salute (HPA) della Gran Bretagna e da quelli del Centro Medico Universitario Erasmus di Rotterdam in Olanda.

          Esistono piani e procedure tramite I quali le Autorità Sanitarie Nazionali e Internazionali sono in grado di gestire eventi nei quali siano coinvolti virus poco conosciuti o malattie emergenti.

          Tali piani e procedure comprendono la condivisione del genoma virale fra I vari Paesi per assicurare la pronta diagnosi di laboratorio fino alle conferenze fra esperti di sanità pubblica.

          Ciò deriva, in parte, all’eredità lasciata dall’epidemia internazionale di SARS del 2003.

          Si sa ora di possedere un sistema di sorveglianza migliore unitamente a una rete di laboratori specializzati nella diagnosi della malattie virali importate.



          Maggiori informazioni (in Inglese):
          -
          ------

          Comment


          • #6
            Sequenza genica parziale del nuovo coronavirus 2012 (HPA, GB, 25/9/12)

            [Fonte: Agenzia per la Protezione della Salute, Gran Bretagna, pagina originale in Inglese: (LINK). Testo tradotto e adattato, segnalato via Twitter da Helen Branswell.]
            Sequenza genica parziale del nuovo coronavirus 2012



            In figura è mostrato l’albero filogenetico - costruito sulla base delle sequenze parziali del gene polimerasi (nsp12) - delle specie tipiche di coronavirus appartenenti ai vari gruppi.

            La sequenza è stata ottenuta dall’Agenzia per la Protezione della Salute (HPA) ed è stata denominata provvisoriamente ‘London1_novel CoV 2012’ (indicata nel rettangolo rosso).

            La sequenza ottenuta dall’HPA è basata sul materiale clinico ottenuto direttamente dal caso umano ricovero in ospedale a Londra.

            L’HPA non ha ancora isolato il virus.

            Presso GENBANK sarà pubblicato a breve il codice per accedere alla sequenza.

            L’albero filogenetico in allegato è da considerarsi preliminare, cosiccome la nomenclatura del virus e soggetto a cambiamenti nel momento in cui ulteriori informazioni saranno disponibili.



            Sequenza parziale nucleotidica della polimerasi virale (nsp12):

            >London1_novel_CoV_2012_nsp12(partial)
            TATTAGTGCTAAGAATAGAGCTCGCACTGTTGCAGGCGTGTCCATACTTA GCACAATGAC
            TAATCGCCAGTACCATCAGAAAATGCTTAAGTCCATGGCTGCAACTCGTG GAGCGACTTG
            CGTCATTGGTACTACAAAGTTCTATGGTGGCTGGGATTTCATGCTTAAAA CATTGTACAA
            AGATGTTGATAATCCGCATCTTATGGGT


            Il fasta file può essere scaricato (in un file zip) seguendo il link in basso: London1 novel CoV 2012 nsp12 (partial) (ZIP Archive, 330 byte)


            Ultima revisione: 25 September 2012
            -
            -------

            Comment


            • #7
              Definizione di Caso per l’Identificazione dei Casi di Malattia Respiratoria Severa associata al Nuovo Coronavirus (OMS, 25/9/12)

              [Fonte: Organizzazione Mondiale della Sanità, pagina originale in Inglese: (LINK). Testo tradotto e adattato.]
              Definizione di Caso per l’Identificazione dei Casi di Malattia Respiratoria Severa associata al Nuovo Coronavirus

              Definizione di Caso temporanea elaborata sulla base dei dati disponibili al 25 settembre 2012



              Paziente sottoposto ad osservazione:

              Definizione Clinica:

              Un individuo con una sindrome respiratoria acuta che può soffrire anche di febbre (≥ 38°C , 100.4°F) e tosse
              • che necessita di ricovero in ospedale
              OPPURE
              • che si sospetta abbia un coinvolgimento delle basse vie respiratorie (reperti clinici o radiologici di consolidamento) la cui origine non può essere correlata ad un’altra infezione o eziologia.
              E


              Criterio Epidemiologico:

              Sia entrato in contatto ravvicinato* nel corso dei dieci giorni precedenti l’esordio della malattia
              • con un caso probabile o confermato di infezione da nuovo coronavirus mentre quest’ultimo era ammalato
              OPPURE
              • abbia compiuto dei viaggi in una zona** dove delle infezioni da nuovo coronavirus siano state registrate recentemente o dove la trasmissione del virus sia avvenuta.

              Caso Probabile di Infezione da Nuovo Coronavirus:

              Un individuo che rientri nella definizione clinica E in quella epidemiologica ma di cui non si ha la conferma di laboratorio.



              Caso Confermato di Infezione da Nuovo Coronavirus:

              Un individuo con infezione confermata da nuovo coronavirus tramite analisi di laboratorio.



              * Un soggetto entrato in contatto ravvicinato con un caso di nuovo coronavirus è colui che:
              • Abbia fornito cure ad un caso confermato o probabile, incluso il personale sanitario e I familiari in ambiente sanitario o in comunità.
              • Abbia soggiornato nello stesso luogo (per esempio, un convivente o visitatore) di un caso probabile o confermato mentre questi era sintomatico.
              • Abbia avuto una significativa esposizione di tipo casuale ad un paziente, per esempio star seduto vicino in una aula scolastica, oppure all’interno di un taxi o in un aereo.

              ** Una zona nella quale la trasmissione del nuovo coronavirus possa essere avvenuta:
              • Regno di Arabia Saudita, Qatar (al 25 settembre 2012).
              -
              ------

              Comment


              • #8
                Infezione da Nuovo Coronavirus, aggiornamento (OMS, 25/9/12)

                [Fonte: Organizzazione Mondiale della Sanità, pagina originale in Inglese: (LINK). Testo tradotto e adattato.]
                Infezione da Nuovo Coronavirus, aggiornamento

                25 settembre 2012



                Alla data di oggi non sono stati notificati all’OMS altri casi di malattia respiratoria acuta con insufficienza renale dovuta all’infezione da nuovo coronavirus.

                L’OMS continua le indagini a proposito dei due casi recentemente confermati di infezione dovuta a un nuovo coronavirus.

                Nella giornata di oggi l’OMS ha redatto una definizione di caso provvisoria per aiutare I vari Paesi a migliorare la sorveglianza e le misure di protezione sanitaria nei confronti del nuovo virus.

                La definizione, costruita sulla base della descrizione dei casi riportati fino a questo momento, include I criteri per identificare I ‘casi sottoposti ad indagine’, I ‘casi probabili’ e I ‘casi confermati’. I criteri sono basati su indicatori clinici, epidemiologici e di laboratorio.

                In seguito alla conferma della scoperta del nuovo coronavirus, l’OMS – in base a quanto previsto dal Regolamento Sanitario Internazionale – ha provveduto a inviare un’allerta a tutti gli Stati Membri e si è posta a capo del coordinamento fra le varie autorità, fornendo anche linee guida per le stesse e per le agenzie sanitarie.

                L’OMS sta anche individuando una rete di laboratori in grado di fornire assistenza riguardo l’identificazione del coronavirus per I vari Paesi.

                Il 22 settembre 2012 il Regno Unito (UK) ha informato l’OMS di un caso di sindrome respiratoria acuta in un soggetto che aveva compiuto un viaggio nel Regno di Arabia Saudita (KSA) e in Qatar.

                Il caso si riferisce ad un soggetto – senza storia clinica di rilievo – dell’età di 49 anni, di sesso maschile, con cittadinanza del Qatar che ha sviluppato sintomatologia il 3 settembre 2012, e che aveva compiuto una visita nel KSA alcuni giorni prima l’esordio dei sintomi.

                Il 7 settembre è stato ricoverato in un reparto di terapia intensiva di un ospedal di Doha, Qatar.

                L’11 settembre è stato trasferito in UK con un volo speciale dal Qatar.

                L’Agenzia per la Protezione della Salute dell’UK (HPA) ha eseguito delle analisi di laboratorio che hanno in seguito permesso di confermare la presenza del nuovo coronavirus.

                L’HPA ha effettuato una comparazione genetica fra il virus isolato nel paziente del Qatar di 49 anni con quello identificato in precedenza dal Centro Medico Universitario Erasmus, in Olanda.

                Quest’ultimo aveva ottenuto il virus da un campione di tessuto polmonare proveniente da un caso fatale, un soggetto di 60 anni di età con cittadinanza saudita.

                La comparazione indica una identita’ fra I virus del 99,5%, con la differenza di un solo nucleotide fra le regione analizzate.

                Sebbene si tratti di un virus molto diverso da quello che ha causato la SARS, data la gravità della malattia osservata nei due casi confermati fino a questo momento, l’OMS è impegnata nella caratterizzazione ulteriore del nuovo coronavirus.

                A questo scopo, degli sforzi a livello internazionale – in tutte e sei le regioni OMS – stanno per essere intrapresi per garantire una appropriata ed efficace risposta coordinata da un gruppo specializzato dell’OMS in contatto giornaliero con piu’ di una dozzina di partner tecnici regionali e internazionali.

                Inoltre l’OMS lavora in stretto contatto con il governo del KSA, come è accaduto negli anni scorsi, per sostenere le misure sanitarie del Paese nei confronti dei visitatori partecipanti al pellegrinaggio Haji alla Mecca che si svolgerà a partire dal prossimo mese.



                Maggiori informazioni (in Inglese):

                http://www.who.int/influenza/case_definition_NovelCoronavirus_20120925/en/index.html
                http://www.who.int/ith/updates/20120730/en/index.html
                -
                ------

                Comment


                • #9
                  Malattia Respiratoria Severa associata a un nuovo coronavirus (ECDC, 26/9/12)

                  [Fonte: Centro Europeo per la Prevenzione e il Controllo delle Malattie (ECDC), documento PDF completo in Inglese: (LINK). Porzione di testo tradotto e adattato.]


                  VALUTAZIONE RAPIDA DEL RISCHIO

                  Malattia Respiratoria Severa associata a un nuovo coronavirus

                  24 Settembre 2012



                  Principali Conclusioni e Raccomandazioni
                  • A partire dal giugno 2012, due pazienti che presentavano I sintomi di insufficienza respiratoria acuta e infiammazione polmonare sono risultati positivi ad un nuovo coronavirus. L’esordio della malattia nei due casi è avvenuto a tre mesi di distanza uno dall’altro, tuttavia entrambi avevano compiuto dei viaggi in Arabia Saudita nel periodo immediatamente precedente lo sviluppo dei sintomi. I test genetici preliminari indicano che I due virus sono molto simili.
                  • Il primo caso ha sviluppato I sintomi in Arabia Saudita ed è deceduto il 24 giugno. Il secondo caso ha sviluppato la malattia il 3 settembre in Qatar ed è stato trasferito in Gran Bretagna tramite un volo speciale l’11 settembre; da allora rimane ricoverato nel reparto di terapia intensiva di un ospedale londinese.
                  • Il nuovo coronavirus non è geneticamente assimilabile al coronavirus responsabile della SARS (SARS-CoV), e – fino a questo momento – la sua diffusione non sta seguendo lo stesso andamento dell’epidemia di SARS del 2003.
                  • Ad oggi, non c’è prova di trasmissione del nuovo coronavirus da persona a persona. Un relazione causale fra il virus e lo sviluppo della malattia respiratoria severa è probabile ma al momento non ancora provata.
                  • Fino a questo momento, la fonte della malattia e la riserva naturale del virus, le vie di trasmissione, il periodo di incubazione, e la capacità di causare infezioni asintomatiche rimangono sconosciuti. L’infezione zoonotica non può essere esclusa.
                  • Una definizione di caso particolareggiata e adatta per l’individuazione dei casi è stata sviluppata in collaborazione fra diverse agenzie di controllo sanitario internazionali e le autorità nazionali; tutti I casi che dovessero corrispondere a questa definizione dovrebbero essere notificati tramite il Sistema di Allerta e Risposta Precoce.
                  • La capacità di laboratorio per la diagnosi del virus è presente nei Paesi dell’Unione Europea, mentre test diagnostici piu’ specifici sono in corso di preparazione.
                  • Il Regno di Arabia Saudita non raccomanda l’adozione di misure di restrizione ai viaggi, almeno fino a questo momento, o modifiche ai suggerimenti per il pellegrinaggio dell’Hajj.
                  • Anche assumendo che il nuovo coronavirus sia la causa della malattia nei due casi sopra descritti, il fatto che soltanto due casi siano stati identificati in tre mesi suggerisce che il virus si trasmette in modo molto poco efficiente tra gli esseri umani.
                  • Finche’ maggiori informazioni non saranno disponibili, tutti I casi dovrebbero essere gestiti seguendo in modo stretto le indicazioni nazionali per il controllo delle infezioni respiratorie. L’ECDC raccomanda di utilizzare le linee guida per il controllo delle infezioni adottate per I casi sospetti o confermati di nuovo coronavirus dall’Agenzia per la Protezione della Salute della Gran Bretagna (HPA) o quelle suggerite dall’OMS per la prevenzione e il controllo delle malattie respiratorie acute a carattere epidemico / pandemico in ambito sanitario (WHO/CDS/EPR/2007.6) in assenza di appropriate linee guida nazionali.
                  (…)



                  -
                  ------

                  Comment


                  • #10
                    Infezione da nuovo coronavirus nel Regno Unito e Olanda (EpiCentro, 27/9/12)

                    [Fonte: EpiCentro, pagina originale completa: (LINK). Adattato.]
                    27 settembre 2012

                    Infezione da nuovo coronavirus nel Regno Unito e Olanda



                    Il 22 settembre l’Health Protection Agency (Hpa) e le autorità sanitarie del Regno Unito hanno segnalato un caso di sindrome respiratoria acuta in un paziente di 49 anni residente in Qatar, trasferito nel Regno Unito l’11 settembre in seguito all’aggravarsi delle sue condizioni cliniche durante il ricovero nell’ospedale di Doha (il 7 settembre).

                    Gli esami diagnostici effettuati hanno permesso di identificare un nuovo coronavirus come responsabile della malattia.

                    Il coronavirus isolato è stato successivamente confrontato dal punto di vista molecolare con un altro coronavirus isolato in Olanda, presso l’Erasmus medical centre, in un paziente sessantenne deceduto per sindrome respiratoria acuta a fine di giugno.

                    Le indagini molecolari sulle sequenze nucleotidiche dei due virus isolati hanno mostrato una omologia pari al 99,5%.

                    Infine, l’Hpa sta effettuando indagini epidemiologiche su un altro caso di malattia respiratoria acuta in un cittadino saudita deceduto dopo un ricovero a Londra nel mese di agosto 2012.

                    Le indagini epidemiologiche in corso non hanno evidenziato correlazione fra i casi fino a ora segnalati.

                    L’Ufficio europeo dell’Oms sta coordinando le indagini epidemiologiche in corso nel Regno Unito, Emirati Arabi Uniti e Qatar per stabilire le implicazioni sanitarie dell’evento e ha fornito una definizione di caso per identificare casi di infezione da nuovo coronavirus.

                    Per maggiori informazioni leggi il comunicato stampa dell’Oms Europa pubblicato il 26 settembre, il comunicato (pdf 204 kb) del ministero della Salute pubblicato il 26 settembre 2012 e il Rapid risk assessment dell’Ecdc “Severe respiratory disease associated with a novel coronavirus” (pdf 1,3 Mb) del 24 settembre.
                    -
                    ------

                    Comment


                    • #11
                      Infezione da Nuovo Coronavirus, aggiornamento (OMS, 28 settembre 2012)

                      [Fonte: Organizzazione Mondiale della Sanità, pagina originale in Inglese: (LINK). Testo tradotto e adattato.]
                      Infezione da Nuovo Coronavirus, aggiornamento



                      28 settembre 2012


                      Alla data del 28 settembre 2012 nessun nuovo caso umano confermato di infezione da Nuovo Coronavirus è stata notificata all’OMS.

                      L’OMS lavora in stretto contatto con le Autorità Nazionali e I Paesi coinvolti (Qatar, Arabia Saudita, Gran Bretagna) e I partner internazionali allo scopo di meglio comprendere il possibile rischio per la salute pubblica rappresentato dal Nuovo Coronavirus.

                      Sulla base delle informazioni disponibili fino a questo momento, sembra che il Nuovo coronavirus non si trasmetta facilmente da persona a persona.

                      Data la severità della malattia osservata nei due casi confermati tramite analisi di laboratorio, l’OMS continua a seguire la situazione allo scopo di fornire la risposta più appropriata, le compteneze e il supporto agli Stati Membri.

                      Veloci progressi sono stati fatti nel caratterizzare geneticamente il Nuovo Coronavirus e nello sviluppo di test diagnostici specifici e sensibili. L’OMS collabora con I laboratori partner per rendere I test disponibili al piu’ presto possibile. Ci si aspetta che il primo lotto di reagenti, unitamente alle informazioni necessarie e agli algoritmi per le diagnosi piu’ urgenti, saranno disponibili nei prossimi giorni.

                      I test di laboratorio per per la diagnosi dell’infezione da Nuovo Coronavirus per I pazienti sottoposti ad indagine – secondo I criteri stabiliti dall’OMS – sono attualmente disponibili presso alcuni laboratori partner. Le Autorità Sanitarie Nazionali possono contattare questi laboratori tramite l’OMS.

                      L’OMS continua ad informare gli Stati Membri attraverso I Punti Focali Nazionali designati dal Regolamento Sanitario Internazionale (2005).

                      Rispetto alle infezioni da Nuovo Coronavirus, l’OMS non raccomanda l’adozione di misure restrittive ai viaggi o ai commerci nei confronti dell’Arabia Saudita o del Qatar.
                      - -----

                      Comment


                      • #12
                        Nuovo coronavirus: Definizione di caso provvisoria, revisione – 29 settembre 2012 (OMS, adattato)

                        [Fonte: Organizzazione Mondiale della Sanità, pagina originale in Inglese: (LINK). Porzione di testo tradotto e adattato.]
                        Nuovo coronavirus: Definizione di caso provvisoria, revisione – 29 settembre 2012



                        Schema di classificazione e ricerca dei casi di Infezione Respiratoria Acuta Severa associata al Nuovo Coronavirus:

                        Lo schema che segue è raccomandato per l’identificazione dei casi che dovranno essere sottoposti ad analisi di laboratorio per l’infezione dal recentemente descritto Nuovo Coronavirus.

                        Gli obiettivi dello schema sono quelli di assicurare un approccio sistematico per l’appropriata identificazione e indagine dei pazienti che potrebbero aver contratto il virus evitando nel contempo il sovraccarico delle strutture sanitarie a causa dell’eccessivo numero di test da effettuare. Si noti come le informazioni qui contenute siano state sviluppate sulla base dei dati forniti dai due casi confermati ad oggi e che un buon grado di giudizio clinico è richiesto nella scelta dei possibili casi di malattia.



                        Pazienti da sottoporre ad indagine (definiti anche come ‘Pazienti sotto indagine’’):
                        • Una persona con infezione respiratoria acuta, che può includere febbre (≥ 38°C , 100.4°F) e tosse; E
                        • sospetto di affezione polmonare parenchimale (per esempio, polmonite o Sindrome da Stress Respiratorio Acuto (ARDS)) basato su reperti clinici o radiologici di consolidamento; E
                        • viaggio o residenza in una zona dove infezioni da nuovo coronavirus sono state riportate di recente o dove la trasmissione potrebbe essersi verificata;* E
                        • quando la malattia non è stata ancora spiegata dalla presenza di altra infezione o eziologia, incluse tutte quelle per le quali sono indicati I test per l’individuazione di polmoniti acquisite in comunità secondo quanto previsto dalle linee guida nazionali.


                        Gestione dei Pazienti sotto indagine:

                        I pazienti che rientrano in questa categoria devono essere sottoposti a tutte le analisi di laboratorio di routine previste dai protocolli clinici per la diagnosi delle polmoniti acquisite in comunità stabiliti dalle autorità locali allo scopo di individuare la presenza di altri eventuali agenti eziologici della polmonite.

                        Esempi di altre eziologie sono: infezioni da streptococcus pneumoniae, hemophilus influenza tipo B, legionella pneumophila, e altri riconosciuti patogeni batterici e virali come l’influenza o il virus respiratorio sinciziale.

                        Non è necessario attendere l’esito di tutte le analisi prima di effettuare I test per il nuovo coronavirus. Inoltre I pazienti con una storia clinica chiara e una presentazione clinica consistente per pneumonite chimica o da inalazione da fumo non dovrebbero essere considerati come pazienti da sottoporre ad indagine.

                        Se la malattia respiratoria è inspiegabile, dei campioni clinici appropriati dovrebbero essere inviati per le analisi di laboratorio. Progressi rapidi sono stati conseguiti nella caratterizzazione del nuovo coronavirus e nello sviluppo di saggi diagnostici sensibili e specifici.

                        L’OMS collabora con I laboratori partner per rendere questi saggi disponibili nel tempo piu’ breve possibile. Il primo lotto di reagenti, unitamente alle istruzioni e agli algoritmi per le procedure, è atteso per I prossimi giorni, per le analisi piu’ urgenti.

                        Fino a quel momento, l’OMS è in grado di fornire informazioni per il contatto con I laboratori che hanno la capacità e possibilità di effettuare I test per la presenza del nuovo coronavirus.

                        Per maggiori dettagli, le autorità nazionali dovrebbero contattare I loro rispettivi Punti di Contatto secondo quanto stabilito dal Regolamento Sanitario Internazionale presso l’Ufficio Regionale OMS di comptenza.

                        Misure appropriate di controllo delle infezioni dovrebbero essere instituite mentre I pazienti sono sotto indagine. Se gli Stati Membri avessero la necessità di ulteriori linee guida sulla Prevenzione e il Controllo delle Infezioni, sono pregati di consultare la documentazione OMS ‘’Infection prevention and control of epidemic- and pandemic-prone acute respiratory diseases in health care’’ (WHO/CDS/EPR/2007.6). Infection prevention and control of epidemic- and pandemic-prone acute respiratory diseases in health care



                        Gestione dei soggetti entrati in contatto con I pazienti

                        Chiunque sia stato in prossimità** di un caso confermato o probabile mentre il caso probabile o confermato era ammalato dovrebbe essere sottoposto ad un’attenta sorveglianza per la comparsa di sintomi respiratori. Se I sintomi dovessero comparire nei primi dieci giorni successivi il contatto, il soggetto dovrebbe essere considerato come ‘Paziente sotto indagine’’, qualsiasi sia la gravità del suo stato e esaminato con cura.

                        Se I reperti di laboratorio, compresi quelli istopatologici provenienti dai casi fatali, non possono essere recuperati poichè non prelevati a causa del decesso prematuro, e non possono essere ottenuti in altro modo, o I test di laboratorio per gli altri patogeni non sono disponibili, il paziente verrà quindi definito come ‘Caso Probabile’ secondo quanto di seguito specificato.



                        Definizione di Caso per la Notifica

                        Caso Probabile
                        • Una persona che rientri nella definizione di ‘Paziente sottoposto ad Indagine’ con reperti clinici, radiologici o istopatologici di malattia polmonare parenchimale (per es.: polmonite o ARDS) ma per la quale non sia stato possibile ottenere una conferma tramite analisi di laboratorio perchè il paziente o I campioni non sono disponibili oppure per l’assenza di test per altre infezioni, E
                        • è stato in prossimità ** di un caso confermato, E
                        • la cui malattia non si può attribuire ad altra infezione o patologia, comperse tutte quelle per le quali sono previste le analisi per la ricerca di polmoniti acquisite in comunità.

                        Caso Confermato

                        Una persona con infezione confermata da nuovo coronavirus tramite analisi di laboratorio.



                        Notifica:

                        L’OMS richiede che qualsiasi caso confermato e probabile sia notificato entro 24 ore dal momento in cui è stata stabilita la diagnosi, attraverso I punti focali regionali stabiliti dal Regolamento Sanitario Internazionale all’Ufficio Regionale competente.



                        (*) Queste zone, attualmente, sono: Qatar e Arabia Saudita (alla data del 29 settembre 2012).

                        (**) Soggetti che sono stati in prossimità di un caso:
                        • coloro che hanno fornito cura al paziente, compreso il personale sanitario o I familiari, o hanno avuto contatti fisici ravvicinati;
                        • coloro che hanno condiviso lo stesso ambiente (conviventi o visitatori) di un caso probabile o confermato mentre questi era sintomatico.
                        -
                        ------

                        Comment


                        • #13
                          Infezione da nuovo coronavirus (EpiCentro, 4 ottobre 2012)

                          [Fonte: EpiCentro, pagina originale completa: (LINK). Adattato.]
                          4 ottobre 2012

                          Infezione da nuovo coronavirus



                          In seguito ai casi di sindrome respiratoria acuta segnalati in Europa ed Arabia Saudita nel settembre 2012, l’Oms ha recentemente pubblicato un aggiornamento della definizione di caso per le infezioni di sindrome respiratoria acuta dovute a nuovo coronavirus.

                          Su Eurosurveillance, inoltre, due articoli pubblicati il 27 settembre 2012 approfondiscono, il primo, il tema relativo alla diagnosi di laboratorio del nuovo coronavirus attraverso indagini molecolari (real-time PCR) “Detection of a novel human coronavirus by real-time reverse-transcription polymerase chain reaction”e, il secondo, riferisce la definizione di caso e le misure di salute pubblica intraprese “Novel coronavirus associated with severe respiratory disease: case definition and public health measures”.
                          -
                          -------

                          Comment


                          • #14
                            Nuovo coronavirus, aggiornamento (OMS, 10 ottobre 2012): Nessun nuovo caso identificato

                            [Fonte: Organizzazione Mondiale della Sanità, pagina originale completa in Inglese: (LINK). Testo tradotto e adattato.]
                            Nuovo coronavirus, aggiornamento

                            10 ottobre 2012



                            Nessun nuovo caso di infezione umana da nuovo coronavirus è stata registrata a partire dal 22 settembre 2012.

                            Fino a questo momento, dopo attenta sorveglianza di tutti I soggetti entrati in contatto con I due casi confermati, e dopo l’intensificazione della sorveglianza globale, non esiste prova di trasmissione da persona a persona del virus.

                            I Governi dell’Arabia Saudita, del Qatar e della Gran Bretagna continuano la loro opera di ricerca per meglio comprendere la malattia e la probabile fonte dell’infezione.

                            L’OMS sostiene le attività delle Autorità nazionali impegnate nelle investigazioni in corso; inoltre ha inviato degli esperti in Arabia Saudita e Qatar come parte di un gruppo di lavoro internazionale.

                            Gli attuali e I futuri studi epidemiologici e scientifici condurranno a una migliore comprensione del nuovo coronavirus.

                            L’OMS continua a collaborare con I ministeri della sanità e I partner Internazionali per coordinare le azioni necessarie a una tempestiva identificazione, una rapida diagnosi e gestione dei casi di infezione causati dal nuovo coronavirus, qualora dovessero materializzarsi.

                            Sulla base dell’attuale quadro della situazione, l’OMS incoraggia gli Stati Membri a continuare con le attività di sorveglianza di routine per garantire la pronta identificazione e adeguata risposta ad ogni possibile minaccia alla salute pubblica.

                            L’OMS continuerà a coordinare gli sforzi internazionali di sorveglianza di routine.

                            Questo evento è stato individuato precocemente dalla comunità sanitaria internazionale e notificato all’OMS attraverso il Regolamento Sanitario Internazionale (2005).

                            Ciò dimostra l’importanza di poter disporre degli strumenti e dei processi appropriati per la individuazione precoce, la valutazione del rischio e la diffusione delle notizie al fine di implementare la risposta piu’ adeguata.
                            -
                            ------

                            Comment


                            • #15
                              Infezione da nuovo coronavirus, aggiornamento (EpiCentro, 10 ottobre 2012, adattato)

                              [Fonte: EpiCentro, pagina originale completa: (LINK). Estratto, adattato.]
                              10 ottobre 2012

                              Infezione da nuovo coronavirus



                              Eurosurveillance prosegue nella pubblicazione di studi sul nuovo coronavirus responsabile dei casi di sindrome respiratoria acuta segnalati a settembre 2012 tra Europa e Arabia Saudita.

                              Due articoli, pubblicati nel Volume 17 (Issue 40, 04 October 2012), analizzano il primo le misure di sanità pubblica adottate dal Regno Unito a seguito del caso di sindrome respiratoria acuta residente in Qatar e trasferito nel Regno Unito l’11 settembre.

                              The United Kingdom public health response to an imported laboratory confirmed case of a novel coronavirus in september 2012” e il secondo “Severe respiratory illness caused by a novel coronavirus, in a patient transferred to the united kingdom from the middle east, september 2012” descrive lo stesso caso focalizzando l’attenzione sulle caratteristiche cliniche e virologiche dell’infezione.
                              -
                              ------

                              Comment

                              Working...
                              X