Announcement

**HenryN** · June 24, 2009, 07:36 AM

Re: A/Shanghai/60T/2009(H1N1) released 6/22

The above travel logs show that the three earlier Shanghai sequences are from the same sub-clade. For PB1 the defining polymorphism is also in 71T, suggesting the E627K in PB2 has a Shanghai origin.

It is also worth noting that the defining PB1 polymorphism is also in human H3N2 (and PB1 traces back to human H3N2 PB1), while the defining polymorphism in PB2 is shared with avian isolates and PB2 originated in avian.

This association linked to newly acquired polymorphisms is NOT a coincidence, and these acquisitions are NOT due to random de novo mutations created by a "sloppy" polymerase, as described in dogma cited by WHO and its band of consultants.

**HenryN** · June 24, 2009, 07:47 AM

Re: A/Shanghai/60T/2009(H1N1) released 6/22

Here is the other PB2 polymorphism found in the three Shanghai sequences, which also traces back to avian (in Asia)

gb|GQ290434.1| Influenza A virus (A/Shanghai/60T/2009(H1N1)) ... 40.1 0.046
gb|GQ253489.1| Influenza A virus (A/Shanghai/37T/2009(H1N1)) ... 40.1 0.046
gb|GQ225354.1| Influenza A virus (A/Shanghai/1/2009(H1N1)) se... 40.1 0.046
gb|DQ485213.2| Influenza A virus (A/chicken/China/Guangxi14/2... 40.1 0.046
gb|EU086333.1| Influenza A virus (A/swine/Guangxi/S15/2005(H9... 40.1 0.046
gb|EU086301.1| Influenza A virus (A/bird/Guangxi/A1/2006(H9N2... 40.1 0.046
gb|EU086262.1| Influenza A virus (A/duck/Guangxi/51/2005(H9N2... 40.1 0.046
gb|EU086244.1| Influenza A virus (A/chicken/Guangxi/6/2000(H9... 40.1 0.046
gb|EU081871.1| Influenza A virus (A/chicken/Guangxi/4/1999(H9... 40.1 0.046
gb|DQ366319.1| Influenza A virus (A/duck/Vietnam/8/05(H5N1)) ... 40.1 0.046
gb|DQ366311.1| Influenza A virus (A/goose/Vietnam/3/05(H5N1))... 40.1 0.046
gb|DQ366303.1| Influenza A virus (A/duck/Vietnam/1/2005(H5N1)... 40.1 0.046
gb|DQ485221.1| Influenza A virus (A/chicken/China/Guangxi17/2... 40.1 0.046
gb|AF258846.1| Influenza A virus (A/Hong Kong/97/98(H5N1)) RN... 40.1 0.046
gb|AF258845.1| Influenza A virus (A/Hong Kong/542/97(H5N1)) R... 40.1 0.046
gb|AF258844.1| Influenza A virus (A/Hong Kong/538/97(H5N1)) R... 40.1 0.046
gb|AF258843.1| Influenza A Virus (A/Hong Kong/532/97(H5N1)) R... 40.1 0.046
gb|AF258840.1| Influenza A virus (A/Hong Kong/486/97(H5N1)) R... 40.1 0.046
gb|AF258839.1| Influenza A Virus (A/Hong Kong/483/97(H5N1)) R... 40.1 0.046
gb|AF258838.1| Influenza A virus (A/Hong Kong/482/97(H5N1)) R... 40.1 0.046
gb|AF258837.1| Influenza A virus (A/Hong Kong/481/97(H5N1)) R... 40.1 0.046
gb|AF258836.1| Influenza A virus (A/Hong Kong/1074/99(H9N2)) ... 40.1 0.046
gb|AF258835.1| Influenza A virus (A/Hong Kong/1073/99(H9N2)) ... 40.1 0.046
gb|DQ064569.1| Influenza A virus (A/chicken/Shenzhen/9/97(H9N... 40.1 0.046
gb|DQ064557.1| Influenza A virus (A/chicken/Henan/26/00(H9N2)... 40.1 0.046
gb|DQ064555.1| Influenza A virus (A/chicken/Heilongjiang/35/0... 40.1 0.046
gb|DQ064553.1| Influenza A virus (A/chicken/Guangxi/9/99(H9N2... 40.1 0.046
gb|DQ064552.1| Influenza A virus (A/chicken/Guangxi/10/99(H9N... 40.1 0.046
gb|DQ064551.1| Influenza A virus (A/chicken/Guangdong/6/97(H9... 40.1 0.046
gb|AF508659.1| Influenza A virus (A/Chicken/Shenzhen/9/97(H9N... 40.1 0.046
gb|AF508656.1| Influenza A virus (A/Chicken/Sichuan/5/97(H9N2... 40.1 0.046
gb|AF508654.1| Influenza A virus (A/Chicken/Henan/62/00(H9N2)... 40.1 0.046
gb|AF508642.1| Influenza A virus (A/Chicken/Pakistan/5/99(H9N... 40.1 0.046
gb|AF508641.1| Influenza A virus (A/Chicken/Pakistan/4/99(H9N... 40.1 0.046
gb|AY043030.1| Influenza A virus (A/Guangzhou/333/99(H9N2)) p... 40.1 0.046
gb|AF250476.1|AF250476 Influenza A virus (A/Teal/Hong Kong/W3... 40.1 0.046
gb|AF115291.1|AF115291 Influenza A virus (A/Hong Kong/486/97(... 40.1 0.046
gb|AF115290.1|AF115290 Influenza A virus (A/Hong Kong/481/97(... 40.1 0.046
gb|AF084263.1|AF084263 Influenza A virus (A/HongKong/485/97(H... 40.1 0.046
gb|AF084262.1|AF084262 Influenza A virus (A/HongKong/483/97(H... 40.1 0.046
gb|AF084261.1|AF084261 Influenza A virus (A/HongKong/482/97(H... 40.1 0.046
gb|AF046093.1| Influenza A virus (A/Hong Kong/156/97(H5N1)) p... 40.1 0.046
gb|AF046086.1| Influenza A virus (A/Chicken/Hong Kong/220/97 ... 40.1 0.046
emb|AJ427305.1| Influenza A virus (A/pheasant/Hong Kong/FY294... 40.1 0.046
emb|AJ410501.1| Influenza A virus genomic RNA for polymerase ... 40.1 0.046
emb|AJ410499.1| Influenza A virus genomic RNA for polymerase ... 40.1 0.046
emb|AJ410498.1| Influenza A virus genomic RNA for polymerase ... 40.1 0.046
emb|AJ410497.1| Influenza A virus genomic RNA for polymerase ... 40.1 0.046
emb|AJ410496.1| Influenza A virus genomic RNA for polymerase ... 40.1 0.046
emb|AJ410495.1| Influenza A virus genomic RNA for polymerase ... 40.1 0.046
dbj|AB049154.1| Influenza A virus (A/parakeet/Narita/92A/98(H... 40.1 0.046
dbj|AB049153.1| Influenza A virus (A/parakeet/Chiba/1/97(H9N2... 40.1 0.046
emb|AJ291395.1| Influenza A virus (A/Chicken/Pakistan/2/99 (H... 40.1 0.046
emb|AJ404632.1| Influenza A virus pb2 gene for polymerase Pb2... 40.1 0.046
emb|AJ404631.1| Influenza A virus pb2 gene for polymerase Pb2... 40.1 0.046
emb|AJ404630.1| Influenza A virus pb2 gene for polymerase Pb2... 40.1 0.046
gb|AF098584.1|AF098584 Influenza A virus (A/Goose/Hong Kong/w... 40.1 0.046
gb|AF098583.1|AF098583 Influenza A virus (A/Duck/Hong Kong/y2... 40.1 0.046
gb|AF098582.1|AF098582 Influenza A virus (A/Duck/Hong Kong/p4... 40.1 0.046
gb|AF098581.1|AF098581 Influenza A virus (A/Chicken/Hong Kong... 40.1 0.046
gb|AF098580.1|AF098580 Influenza A virus (A/Chicken/Hong Kong... 40.1 0.046
gb|AF098579.1|AF098579 Influenza A virus (A/Chicken/Hong Kong... 40.1 0.046
gb|AF098578.1|AF098578 Influenza A virus (A/Chicken/Hong Kong... 40.1 0.046
gb|AF098577.1|AF098577 Influenza A virus (A/Chicken/Hong Kong... 40.1 0.046
gb|AF156435.1|AF156435 Influenza A virus (A/Quail/Hong Kong/G... 40.1 0.046
gb|AF036363.1|AF036363 Influenza A virus (A/HongKong/156/97(H... 40.1 0.046

**gsgs** · June 24, 2009, 07:48 AM

Re: A/Shanghai/60T/2009(H1N1) released 6/22

look at the other markers. That mutation in PB1 is an exception
(or contamination ?)

------edit---------
ahh, better: look at the timing and travel histories of the cases.
That PB1-mutation emerged in Cancun mid April, then spread to Ohio,Georgia,...
Not the St.Francis introduction but another one (still Cancun presumably)

**HenryN** · June 24, 2009, 07:56 AM

Re: A/Shanghai/60T/2009(H1N1) released 6/22

Originally posted by gsgs View Post

look at the other markers. That mutation in PB1 is an exception
(or contamination ?)

All recent isolates with that acquistion are from Shanghai (no lab error required - the isolate was cloned and sequenced again with IDENTICAL results).
Reality check - sequences that don't follow the random mutation dogma are NOT lab errors, no matter how many times lab error is cited or how vigorously hands are waved).

**Cyril** · June 24, 2009, 08:21 AM

Re: A/Shanghai/60T/2009(H1N1) released 6/22

PB1 in the Shanghai isolates has a silent mutation: AAG387AAA

which is present in those isolates of the h1n1 outbreak (and those only):

A/Canada-ON/RV1526/2009(H1N1)
A/Georgia/01/2009(H1N1)
A/New York/3007/2009(H1N1)
A/Ohio/07/2009(H1N1)
A/Shanghai/1/2009(H1N1)
A/Shanghai/37T/2009(H1N1)
A/Shanghai/60T/2009(H1N1)
A/Shanghai/71T/2009(H1N1)

On the other hand the shanghai isolates have two silent mutations in PB2 that 71T doesn't have : ACA147ACG and CGA427CGG.

Those two mutations are only found in the shanghai sequences :

A/Shanghai/1/2009(H1N1)
A/Shanghai/37T/2009(H1N1)
A/Shanghai/60T/2009(H1N1)

**gsgs** · June 24, 2009, 08:34 AM

Re: A/Shanghai/60T/2009(H1N1) released 6/22

also 1 in PA (40) , also 2 in NS (291,729)
{enumerating nucleotides}

and Bayern/63 has also the mutation in PB1

**HenryN** · June 24, 2009, 08:36 AM

Re: A/Shanghai/60T/2009(H1N1) released 6/22

Originally posted by Cyril View Post

PB1 in the Shanghai isolates has a silent mutation: AAG387AAA

which is present in those isolates of the h1n1 outbreak (and those only):

On the other hand the shanghai isolates have two silent mutations in PB2 that 71T doesn't have : ACA147ACG and CGA427CGG.

Those two mutations are only found in the shanghai sequences :

These are in the posted travel logs.

**gsgs** · June 24, 2009, 08:44 AM

Re: A/Shanghai/60T/2009(H1N1) released 6/22

you had PB1 in #17, not PB2,
presumably a typo, which caused some confusion.

**HenryN** · June 24, 2009, 09:10 AM

Re: A/Shanghai/60T/2009(H1N1) released 6/22

Originally posted by gsgs View Post

you had PB1 in #17, not PB2,
presumably a typo, which caused some confusion.

Yes, it should have said PB2 as implied by the description which notes the avian history (and PB2 is avian in the pandemic H1N1). The isolates in the travel log are also PB2, as indocated in several of the posted descriptions.

The travel logs are more comprehensive than the much shorter list of pandemic H1N1 sequences. Although the travel logs include the pandemic isolates, they also have the limited number of sequences that have the same polymorphsism and associated region that exactly matches the pandemic strain, identifying the most likely source of the acquisition. These travel logs show that the two defining PB2 polymorphisms are found in avian isolates. consistent with the PB2 origin in the pandemic sequences.

The Shanghai isolates that have the two avain PB2 polymorohisms also have a defining PB1 polymorphism, which is also in 71T, linking it to Shanghai and suggesting the acquisition E627K is Shanghai associated. The PB1 polymorphism found in all four Shanghai isoaltes traces back to human H3N2, which is also the origin of PB1 in pandmeic H1N1.

These associates are NOT coincidental nor are they random and do NOT represent de novo mutations created by a sloppy polymerase.

**Cyril** · June 24, 2009, 09:14 AM

Re: A/Shanghai/60T/2009(H1N1) released 6/22

Sorry my post is being redundant.

and Bayern/63 has also the mutation in PB1

That escaped me - I can only work with full sequences.

These are in the posted travel logs.

Sorry I admit I actually have a hard time making sense of the travel logs you post.

I'm not trained in this field - I'm a programmer with some interest in artificial evolution and genetics. I devised my own tools/methods out of interest for browsing the outbreak sequences.

Would you be kind enough to give a clue as to what sequence you used in PB1 to build this travel log?

I assume you have been looking for a set sequence of nucleotides.

All recent isolates with that acquistion are from Shanghai (no lab error required - the isolate was cloned and sequenced again with IDENTICAL results).
Reality check - sequences that don't follow the random mutation dogma are NOT lab errors, no matter how many times lab error is cited or how vigorously hands are waved).

I've spent a fair amount of time browsing the h1n1 isolates for mutations and lineages. I've encountered some instances of segments that bear the markers of different, not immediately related lineages. Only explanation I could come up with (for what it's worth) is for them to be recombinant. I just don't know better - they only seem to defy logic otherwise.

**HenryN** · June 24, 2009, 09:22 AM

Re: A/Shanghai/60T/2009(H1N1) released 6/22

Originally posted by Cyril View Post

Sorry my post is being redundant.

That escaped me - I can only work with full sequences.

Sorry I admit I actually have a hard time making sense of the travel logs you post.

I'm not trained in this field - I'm a programmer with some interest in artificial evolution and genetics. I devised my own tools/methods out of interest for browsing the outbreak sequences.

Would you be kind enough to give a clue as to what sequence you used in PB1 to build this travel log?

I assume you have been looking for a set sequence of nucleotides.

I've spent a fair amount of time browsing the h1n1 isolates for mutations and lineages. I've encountered some instances of segments that bear the markers of different, not immediately related lineages. Only explanation I could come up with (for what it's worth) is for them to be recombinant. I just don't know better - they only seem to defy logic otherwise.

Yes, they are polymophisms that jump from one background to the next, which is precisely what happens in recombination.

The travel logs are created by taking the newly acquired polymorphism and the adjacent sequence (usually about 15 BP) and the searching the entire database at Genbank (which takes a few seconds). The isolates listed have the polymorphism and exactly match the adjacent region.

The sequences used for the two PB1 travel logs were

aaaaaaaTTGAGAAAA

and

GAACCCTGGCCATGCAGATC

Since the search uses a short sequence, it will find matches in full or partial sequences that have exact matches.

**gsgs** · June 24, 2009, 09:22 AM

Re: A/Shanghai/60T/2009(H1N1) released 6/22

hey, programmer.
Let's share (processed) data, programs,utilities,work...

h5n1experts.org - h5n1experts Resources and Information.

http://h5n1experts.org/forum/showthread.php?t=738

h5n1experts.org is your first and best source for all of the information you’re looking for. From general topics to more of what you would expect to find here, h5n1experts.org has it all. We hope you find what you are searching for!

**HenryN** · June 24, 2009, 09:28 AM

Re: A/Shanghai/60T/2009(H1N1) released 6/22

The sequence used to create the PB2 travel log was

GCTGAACCCCATGCACCAAC

The fact that the only matches in the entire database are the three closley related Shanghai sequences and a series of avian isolates is NOT a coincidence (as I am sure you and anyone else who frequently analyzes data realizes in a nanosecond or less).

gb|GQ290434.1| Influenza A virus (A/Shanghai/60T/2009(H1N1)) ... 40.1 0.046
gb|GQ253489.1| Influenza A virus (A/Shanghai/37T/2009(H1N1)) ... 40.1 0.046
gb|GQ225354.1| Influenza A virus (A/Shanghai/1/2009(H1N1)) se... 40.1 0.046
gb|EU980493.1| Influenza A virus (A/mallard/MD/865/2002(H5N2)... 40.1 0.046
gb|EU980501.1| Influenza A virus (A/mallard/MD/898/2002(H5N2)... 40.1 0.046
gb|EU980508.1| Influenza A virus (A/mallard/MD/185/2003(H5N2)... 40.1 0.046
gb|CY029936.1| Influenza A virus (A/blue-winged teal/Ohio/186... 40.1 0.046
gb|EU050626.1| Influenza A virus (A/chukkar/Shantou/1530/2005... 40.1 0.046
gb|EU050621.1| Influenza A virus (A/chukkar/Shantou/89/2005(H... 40.1 0.046
gb|EU050619.1| Influenza A virus (A/chukkar/Shantou/7964/2004... 40.1 0.046
gb|EU050615.1| Influenza A virus (A/chukkar/Shantou/6865/2004... 40.1 0.046
gb|EU050613.1| Influenza A virus (A/quail/Shantou/6651/2004(H... 40.1 0.046
gb|EU050610.1| Influenza A virus (A/quail/Shantou/6060/2004(H... 40.1 0.046
gb|EU050609.1| Influenza A virus (A/guinea fowl/Shantou/6042/... 40.1 0.046
gb|EU050608.1| Influenza A virus (A/chukkar/Shantou/5651/2004... 40.1 0.046
gb|EU050606.1| Influenza A virus (A/partridge/Shantou/5028/20... 40.1 0.046
gb|EU050600.1| Influenza A virus (A/guinea fowl/Shantou/3431/... 40.1 0.046
gb|EU050591.1| Influenza A virus (A/guinea fowl/Shantou/2418/... 40.1 0.046
gb|EU050550.1| Influenza A virus (A/quail/Shantou/1811/2001(H... 40.1 0.046
gb|CY023317.1| Influenza A virus (A/chicken/Shantou/2402/2004... 40.1 0.046
gb|EU026013.1| Influenza A virus (A/mallard/Maryland/887/2002... 40.1 0.046
gb|CY021596.1| Influenza A virus (A/mallard/Maryland/899/2002... 40.1 0.046
gb|CY020868.1| Influenza A virus (A/blue-winged teal/Ohio/907... 40.1 0.046
gb|CY020860.1| Influenza A virus (A/mallard/Ohio/664/2002(H6N... 40.1 0.046
gb|CY011119.1| Influenza A virus (A/mallard/Maryland/881/2002... 40.1 0.046
gb|CY020820.1| Influenza A virus (A/mallard/Maryland/470/2002... 40.1 0.046
gb|CY020804.1| Influenza A virus (A/mallard/Ohio/671/2002(H4N... 40.1 0.046
gb|CY020780.1| Influenza A virus (A/mallard/Ohio/655/2002(H4N... 40.1 0.046
gb|CY014525.2| Influenza A virus (A/mallard/Ohio/657/2002(H4N... 40.1 0.046
gb|CY020772.1| Influenza A virus (A/black duck/Maryland/834/2... 40.1 0.046
gb|CY020740.1| Influenza A virus (A/mallard/Maryland/750/2002... 40.1 0.046
gb|EF063554.1| Influenza A virus (A/quail/Dubai/303/2000(H9N2... 40.1 0.046
gb|EF063553.1| Influenza A virus (A/quail/Dubai/302/2000(H9N2... 40.1 0.046
gb|EF063552.1| Influenza A virus (A/quail/Dubai/301/2000(H9N2... 40.1 0.046
gb|CY017732.1| Influenza A virus (A/pintail/Ohio/25/1999(H1N1... 40.1 0.046
gb|CY017724.1| Influenza A virus (A/green-winged teal/Ohio/72... 40.1 0.046
gb|CY016962.1| Influenza A virus (A/mallard/Ohio/66/1999(H1N1... 40.1 0.046
gb|CY014805.1| Influenza A virus (A/turkey/Minnesota/1012/199... 40.1 0.046
gb|CY014701.1| Influenza A virus (A/gull/Maryland/704/1977(H1... 40.1 0.046
gb|CY012831.1| Influenza A virus (A/mallard/Ohio/56/1999(H1N1... 40.1 0.046
gb|AY619970.1| Influenza A virus (A/swine/Ontario/42729A/01(H... 40.1 0.046
gb|AY619962.1| Influenza A virus (A/swine/Ontario/K01477/01(H... 40.1 0.046
gb|AF508647.1| Influenza A virus (A/Pheasant/Ireland/PV18/97(... 40.1 0.046
gb|CY005071.1| Influenza A virus (A/laughing gull/DE/2838/198... 40.1 0.046
gb|CY004567.1| Influenza A virus (A/herring gull/DE/712/1988(... 40.1 0.046
gb|CY004457.1| Influenza A virus (A/herring gull/NJ/782/1986(... 40.1 0.046
gb|CY003901.1| Influenza A virus (A/herring gull/DE/475/1986(... 40.1 0.046
gb|CY005865.1| Influenza A virus (A/gull/Minnesota/945/1980(H... 40.1 0.046
gb|CY005858.1| Influenza A virus (A/shoveler/Netherlands/19/1... 40.1 0.046
gb|CY004880.1| Influenza A virus (A/herring gull/DE/665/1988(... 40.1 0.046
gb|CY004389.1| Influenza A virus (A/herring gull/New Jersey/7... 40.1 0.046
gb|M73525.1|FLAH13N6B Influenza A virus (A/gull/Maryland/704/... 40.1 0.046

**sharon sanders** · June 24, 2009, 09:32 AM

Re: A/Shanghai/60T/2009(H1N1) released 6/22

Welcome Cyril!

**Cyril** · June 24, 2009, 09:40 AM

Re: A/Shanghai/60T/2009(H1N1) released 6/22

Thanks, that's gold. I'm going to give this method a try and see if I can make sense out of it.

hey, programmer.
Let's share (processed) data, programs,utilities,work...

We actually met on a french forum

my tools are dead simple - they just compare sequences and search for triplets of nucleotides. I've been reluctant towards using the tools available at ncbi - I like to experiment by myself.

Announcement

A/Shanghai/60T/2009(H1N1) released 6/22

Comment

Comment

Comment

Comment

Comment

Comment

Comment

Comment

Comment

Comment

Comment

Comment

Comment

Comment

Comment