A/Shanghai/60T/2009(H1N1) released 6/22

[HenryN]

Re: A/Shanghai/60T/2009(H1N1) released 6/22

Thanks, that's gold. I'm going to give this method a try and see if I can make sense out of it.


We actually met on a french forum
my tools are dead simple - they just compare sequences and search for triplets of nucleotides. I've been reluctant towards using the tools available at ncbi - I like to experiment by myself.

You will find this to be very simple and very powerful (searching the flu database will give cleaner results, but it frequently trails the full database -sequences greater that 15 bp will eliminate most noise).

[Cyril]

Re: A/Shanghai/60T/2009(H1N1) released 6/22

Sorry but I fail to see what it entails, and if I'm entitled to a dumb question:

If I look for the sequence GCTGAACCCCATGCACCAAC (PB2 427CGG) I obtain the travel log you posted, with many avian isolates involved.

If on the other hand I search for the consensus sequence, ACTGAACCCCATGCACCAAC (PB2 427CGA), I obtain (obviously) the isolates from the h1n1 outbreak, as well as many (other) avian isolates - for instance some of them are:

A/northern pintail/Alaska/44203-079/2006(H4N6)
A/turkey/WI/1966(H9N2)
A/chukkar/Shantou/13393/2005(H6N1)
A/quail/Shantou/9399/2005(H6N2)
A/quail/Shantou/6825/2005(H6N2)
A/chukkar/Shantou/5275/2005(H6N1)
A/quail/Shantou/5017/2005(H6N2)
A/quail/Shantou/4106/2005(H6N2)
A/pheasant/Shantou/114/2005(H6N1)
A/pheasant/Shantou/113/2005(H6N1)
A/pheasant/Shantou/7503/2004(H6N2)
A/guinea fowl/Shantou/7211/2004(H6N1)

Those are exact matches.

What I understand is that it points out to an avian lineage, but I fail to see what it implies in regard to Shanghai's 427CGG genotype and the "single point mutation vs recombination" argument?

Welcome Cyril!

Thanks!

[Cyril]

Re: A/Shanghai/60T/2009(H1N1) released 6/22

Unless of course the whole idea is that both genotypes exist locally in avian species and the similarities in sequence made the shanghai strain "pick up" the polymorphism through recombination.

I guess the whole question then would be "how did two strains that affect different species recombine?".

[HenryN]

Re: A/Shanghai/60T/2009(H1N1) released 6/22

Swine is infected by human, swine, and avian influenza. Your consensus search just confirms that swine acquired an avian PB2 decades ago (which you could also see by searching the whole gene and look for most closely related).
The fact that the pandemic H1N1 is a "triple reassortant" (swine, avain, and human) was know from the first isolates (and the presence of triple reassortants has been known since the 1990's).

[gsgs]

Re: A/Shanghai/60T/2009(H1N1) released 6/22

> I've encountered some instances of segments that bear the
> markers of different, not immediately related lineages.
> Only explanation I could come up with (for what it's worth) is for
> them to be recombinant. I just don't know better - they only
> seem to defy logic otherwise.

give an example

[Cyril]

Re: A/Shanghai/60T/2009(H1N1) released 6/22

Well for instance Texas/15.
I was considering building lineages and thought every isolate would fall into place until I stumbled upon such cases.

Texas/15 shares 406CAG with isolates from nearby California (+one in NY). The three isolates from California (but not the one in NY) bear an additional marker (624GCC).

Texas/15 also shares 317TTA with South Carolina/09, which otherwise has itself the markers of a wildly distributed variant that spans America, Europe, China...

If it's not for recombination I can't explain why this latter mutation appears in both a member of a well-established lineage and this Texas/15 isolate that bears a marker from the California variant.

But again I don't pretend this is a correct explanation - it's basically the only explanation I could come up with myself. It might just show the limitation in my understanding.

[Mamabird]

Re: A/Shanghai/60T/2009(H1N1) released 6/22

Well for instance Texas/15.
I was considering building lineages and thought every isolate would fall into place until I stumbled upon such cases.

Texas/15 shares 406CAG with isolates from nearby California (+one in NY). The three isolates from California (but not the one in NY) bear an additional marker (624GCC).

Texas/15 also shares 317TTA with South Carolina/09, which otherwise has itself the markers of a wildly distributed variant that spans America, Europe, China...

If it's not for recombination I can't explain why this latter mutation appears in both a member of a well-established lineage and this Texas/15 isolate that bears a marker from the California variant.

But again I don't pretend this is a correct explanation - it's basically the only explanation I could come up with myself. It might just show the limitation in my understanding.

Texas/15 is a consensus virus and genetically distint from the two variants that include the CA viruses. The earliest known source for TX/15 is Mex/4115.

[gsgs]

Re: A/Shanghai/60T/2009(H1N1) released 6/22

OK, I localized your mutations in PB2 (segment 1).
I think it's a coincidence that South Carolina/09 developed the same
mutation. There are not so many mutations available (13000 in total,
but some are much preferred, e.g. 3rd position A-G,C-T, so basically
~5000)
There are also biological constraints which favour some mutations over others

[HenryN]

Re: A/Shanghai/60T/2009(H1N1) released 6/22

OK, I localized your mutations in PB2 (segment 1).
I think it's a coincidence that South Carolina/09 developed the same
mutation. There are not so many mutations available (13000 in total,
but some are much preferred, e.g. 3rd position A-G,C-T, so basically
~5000)
There are also biological constraints which favour some mutations over others

More coincidences!!!!

[HenryN]

Re: A/Shanghai/60T/2009(H1N1) released 6/22

OK, I localized your mutations in PB2 (segment 1).
I think it's a coincidence that South Carolina/09 developed the same
mutation. There are not so many mutations available (13000 in total,
but some are much preferred, e.g. 3rd position A-G,C-T, so basically
~5000)
There are also biological constraints which favour some mutations over others

Speaking of PB2 and coincidences, China has switched E627K back to wildtype!

It is still E627K at GISAID, but 4 of the 5 polymorphisms on PB2 have been switch to wild type at Genbank. Several other genes were also switch. I suspect there is a mixture and they found a wild type clone (sounds a lot like Hong Kong and their recombinant H5N1 isolates) and now are replacing the novel sequence with a much more generic sequence.

China deposited TWO PB2 sequences at GISAID last week, and both had (and at least one, if not both STILL have, E627K).

[Mamabird]

Re: A/Shanghai/60T/2009(H1N1) released 6/22

Speaking of PB2 and coincidences, China has switched E627K back to wildtype!

It is still E627K at GISAID, but 4 of the 5 polymorphisms on PB2 have been switch to wild type at Genbank. Several other genes were also switch. I suspect there is a mixture and they found a wild type clone (sounds a lot like Hong Kong and their recombinant H5N1 isolates) and now are replacing the novel sequence with a much more generic sequence.

China deposited TWO PB2 sequences at GISAID last week, and both had (and at least one, if not both STILL have, E627K).

GISAID has two 71T isolates from Shanghai. The original passage still has E627K in PB2, while the C2 passage does not. The C1 passage that was in GISAID previously apparently has been removed.

[Cyril]

Re: A/Shanghai/60T/2009(H1N1) released 6/22

OK, I localized your mutations in PB2 (segment 1).
I think it's a coincidence that South Carolina/09 developed the same
mutation. There are not so many mutations available (13000 in total,
but some are much preferred, e.g. 3rd position A-G,C-T, so basically
~5000)
There are also biological constraints which favour some mutations over others

Well, I understand this. Obviously a silent mutation has a greater chance for survival than a random change in phenotype.

Still, it's a funny one, and problem is I've encountered many such oddities while going into the details. It seems a bit odd that two closely related strains would develop the very same mutation independently, while it is silent and doesn't confer any benefit/selective advantage. Moreover those two strains (tx/15 and south carolina) hasn't diverged so much as to make the occurrence of having the same random mutation happen concurrently likely - but it's not impossile either.

I'll look for some more.

[gsgs]

Re: A/Shanghai/60T/2009(H1N1) released 6/22

that's good news, isn't it ?

How did it happen ? While they grew the virus in the lab ?

[HenryN]

Re: A/Shanghai/60T/2009(H1N1) released 6/22

that's good news, isn't it ?

How did it happen ? While they grew the virus in the lab ?

They likely have a mixture and are repalcing the variant with wild type. H1N1 really doesn't care what is at Genbank or GISAID.

[gsgs]

Re: A/Shanghai/60T/2009(H1N1) released 6/22

Cyril, make a statistic how often this
happens and compare with what is expected ! (will you...)

Maybe I did it before (years ago), I don't remember

Another thing that I'm still uncomfortable with is, how much
selection pressure is there on synonymous mutations ?
(A-G,C-T at position 3 in a codon)
Clearly less than for other mutations.
But not zero either.