Announcement

Collapse
No announcement yet.

Worldwide: 24 confirmed cases due to novel animal nCoV coronavirus - 16 fatalities - September 20, 2012 - May 2, 2013

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • #46
    Re: Saudi Arabia: 3 cases, 2 deaths due to novel animal coronavirus

    Originally posted by alert View Post
    Onset appears to be September 3, so if he contracted the virus in Saudi Arabia before August 18, the incubation period for him appears to be at least 16 days. Since we have no idea what (or who) we contracted the virus from, it seems possible his exposure might not be in Saudi Arabia.
    According to RIVM (= Dutch CDC) SARS incubation period is between 2 and 10 days. First symptoms are non specific: myalgia (muscle pain), headache, fever. Sometimes diarrhea.

    Some patients develop high fever between day 7 and day 10. Riskgroups are people older than 60 years.

    Guess we can't exclude Saudi Arabia.

    We may need to open a discussion thread?

    Comment


    • #47
      Re: Saudi Arabia: 3 cases, 2 deaths due to novel animal coronavirus

      New coronavirus alert) Qatari in London remains critical
      (29 mins ago)


      A Qatari man suffering from a new respiratory virus from the same family as the deadly virus that causes SARS, remains in critical condition, the World Health Organization said today.
      ?He is still in critical condition'' at a London hospital, Gregory Haertl, a spokesman for the United Nations health body, said in Geneva.
      The 49-year-old Qatari was admitted to an intensive care unit in Doha on September 7 suffering from acute respiratory infection and kidney failure before being transferred to Britain by air ambulance on September 11, the WHO said.
      A Saudi Arabian national died earlier this year from a virtually identical virus, the WHO said.
      The WHO confirmed the illness was in the coronavirus family but was not SARS, or Severe Acute Respiratory Syndrome, which swept out of China in 2003, killing more than 800 people worldwide.
      Haertl stressed that the coronavirus family also includes other viruses, including the common cold, and insisted the new virus was not SARS.
      ?This is not SARS, it will not become SARS, and it is not SARS-like,'' he said, pointing out that what sets the new virus apart was that it caused rapid kidney failure.
      The WHO is cooperating with national health authorities in a bid to detect other cases, and was planning to publish an update later Tuesday, Haertl said.
      He stressed though that very little was known about the new virus so far, pointing out that there were only two confirmed cases, which popped up three months apart and with no connection besides the fact that both men had links to Saudi Arabia.
      ?We don't know yet how it transmits... if it's human to human or animal to human,?? he said, pointing out that the virus might also provoke milder, and therefore undetected illness. ?We are very much in an investigative period,'' he said.
      http://www.thestandard.com.hk/breaki...&icid=a&d_str=
      CSI:WORLD http://swineflumagazine.blogspot.com/

      treyfish2004@yahoo.com

      Comment


      • #48
        Re: Saudi Arabia: 3 cases, 2 deaths due to novel animal coronavirus

        Health authorities allay viral outbreak fears
        Tuesday, 25 September 2012 03:33



        by MOHAMED IQBAL

        DOHA: The Supreme Council of Health (SCH) yesterday confirmed reports about a Qatari man affected with a new SARS-like respiratory virus that left him critically ill in a London hospital.

        While the incident has prompted the World Health Organisation (WHO) to issue a global alert for the virus, the SCH has discounted fears about a possible spread of the disease in the country saying no second case has been detected here until now.

        The news was circulating on social media yesterday, with people expressing fears about a possible outbreak, especially during the forthcoming

        Haj pilgrimage. ?The one we heard today is the only case detected in Qatar until now. All members of his family have been tested, but none of them were found affected,? Dr Mohammed Al Thani, director of the Public Health Department at SCH said in a news conference held on short notice last evening.

        He said the victim had contracted the illness in Saudi Arabia where he went for Umrah earlier this month. 

        The 49-year-old Qatari was admitted to an intensive care unit in Doha on September 7 suffering from acute respiratory infection and kidney failure before being transferred to Britain by air ambulance on September 11, the WHO said yesterday.

        ?He was admitted to the HMC but we decided to send him to the UK when we found that he needed further tests,? said Mohammed Al Thani.

        A Saudi Arabian national died earlier this year from a virtually identical virus, the WHO said, while Saudi medical authorities said they were investigating other possible cases of the disease.

        The WHO confirmed the illness belongs to coronavirus family but was not SARS, or Severe Acute Respiratory Syndrome, which swept out of China in 2003, killing more than 800 people worldwide.

        ?These are the only two known cases of the disease until now. A third suspected case was reported but it has not been confirmed. The family members of the Saudi victim were also tested but none of them was found infected. We don?t have enough information about the illness. We still cannot say whether it will spread through human contact, or if it is curable,? said Mohammed Al Thani.

        Dr Abdullatheef Al Khal, head of the communicable diseases section at HMC said HMC had alerted all its hospitals and emergency departments about the new disease. The illness was detected in the UK because the HMC laboratory does not have the facilities to identify the virus, he added

        ?We want to reassure the public that there is nothing to worry since there is no indication of the illness spreading fast. It has not yet become an epidemic. However, we are taking all necessary precautions,? said Al Khal.

        He, however, added that Qatar has not initiated any special precautions for Haj pilgrims because the current situation does not demand that.

        ?We are advising all pilgrims to take all the required vaccinations at least two weeks in advance and follow general hygiene like washing the hands frequently during the pilgrimage,? said Al Khal.

        Dr Mohammed Al Hajari, head of the communicable diseases department at SCH said Qatar was waiting for official instructions from the WHO and the Saudi authorities on precautions related to Haj pilgrims.

        Meanwhile, Britain?s Health Protection Agency (HPA) confirmed the presence of the new coronavirus and then found that it was a 99.5 percent match with a virus obtained from the lung tissue of the 60-year-old Saudi man who died earlier this year.

        Coronaviruses are causes of the common cold but can also include more severe illnesses including SARS.

        Quoting Saudi media, agencies reported yesterday that three people, including the Qatari man were diagnosed with the virus.

        The HPA, stressed no one else in Britain, including those who had come into contact with the man, were reporting symptoms.

        The HPA said the new virus was ?different from any that have previously been identified in humans.?

        It said there were encouraging signs that it was not as infectious as SARS as there had been no evidence of illness in people who had been in contact with the Qatari or the Saudi, including in health workers.

        ?Based on what we know about other coronaviruses, many of these contacts will already have passed the period when they could have caught the virus from the infected person,? it said.

        John Oxford, professor at the University of London, said he was ?somewhat relaxed? because he believed the illness was more likely to behave ?like a nasty infection rather than join the ?exception? group like SARS.?

        ?This new virus does not appear to be in the same ?big bang? group,? he added. ?I am very pleased that it does not!? http://www.thepeninsulaqatar.com/qat...eak-fears.html
        CSI:WORLD http://swineflumagazine.blogspot.com/

        treyfish2004@yahoo.com

        Comment


        • #49
          Re: Saudi Arabia: 3 cases, 2 deaths due to novel animal coronavirus

          'Sars' patient fights for life at St Thomas' after flying into London from Qatar
          25 September 2012


          The London hospital treating a man struck down by an illness similar to Sars has been named as St Thomas?.

          Experts at the Lambeth hospital, which specialises in respiratory illnesses, have put him in isolation and are treating him by oxygenating his blood outside his body.

          The 49-year-old patient who was born in Qatar caught the illness in Saudi Arabia and travelled by air ambulance for treatment in the UK.

          He is the second person confirmed with the coronavirus, which has been likened to the Sars virus that killed hundreds of people in 2002.

          The first case was a 60-year-old man in Saudi Arabia who died in July. The two patients never met. The Health Protection Agency is also investigating a third possible case.

          Specialists at St Thomas? are using a procedure known as extracorporeal membrane oxygenation (ECMO) treatment.

          All medical staff who come into contact with the patient are following strict infection prevention and control procedures and wearing masks and protective gloves.

          It is believed he developed a severe chest infection and renal failure after visiting Saudi Arabia. He was admitted to an intensive care unit in Doha in September but when the illness worsened he was flown to a private hospital in London.

          He was then transferred to St Thomas? which specialises in treating respiratory infections and is currently being given intensive care in an isolation unit.

          Officials are still determining what threat the new virus may pose.

          A spokesman for Guy?s and St Thomas? said: ?The patient has been identified as having a new type of coronavirus and we are working closely with the Health Protection Agency and following their guidance.

          ?The patient, who has been isolated, is receiving extracorporeal membrane oxygenation (ECMO) treatment, which delivers oxygen to the blood outside the body when the lungs are not able to. We are one of five designated specialist centres in the UK to offer this treatment.

          ?We are following strict infection prevention and control procedures to protect patients and staff.

          ?There is no evidence that the virus has been transmitted to any other patient or member of staff. However, staff involved in caring for this patient are being followed up by occupational health as a precaution.?

          Professor John Watson, head of the respiratory diseases department at the HPA said there was no specific evidence of the virus spreading from person-to-person.

          Coronaviruses are a large family of viruses which includes ones that cause the common cold as well as ones that cause Sars (severe acute respiratory syndrome).

          There was a global outbreak of Sars in 2002 which killed around 800 people.http://www.standard.co.uk/news/healt...r-8175088.html
          CSI:WORLD http://swineflumagazine.blogspot.com/

          treyfish2004@yahoo.com

          Comment


          • #50
            Re: Saudi Arabia: 3 cases, 2 deaths due to novel animal coronavirus

            Originally posted by solitaire View Post
            Hi Treyfish, thanks for all your hard work keeping us up to date. I read the Daily Mail article you have posted above and the outraged comments that the UK are treating a foreigner who has flown in for treatment, however in your post #39 from the ECDC it says the man is a British National originally from Qatar. It's always confusing in the early days of an outbreak getting precise information but I would hope and expect that the ECDC are right.
            Your very welcome! We are all watching pretty close on this one.
            I don't see any other infections so far and cleanliness is the order of the day in the affected countries.
            CSI:WORLD http://swineflumagazine.blogspot.com/

            treyfish2004@yahoo.com

            Comment


            • #51
              Re: Saudi Arabia: 3 cases, 2 deaths due to novel animal coronavirus

              hat tip Michael Coston

              WHO: Coronavirus Not SARS




              Coronavirus ? Credit CDC PHIL



              # 6578

              We are just three days into the emerging coronavirus story (see here, here, and here) , and the short message above, tweeted this morning by the World Health Organization, deserves repeating.


              Despite coming from the same family of viruses as SARS (as do many other, far less pathogenic viruses), this new coronavirus is not SARS - and until more testing can be completed - we don?t know how much of a danger it actually presents.
              The WHO continued to tweet:





              Kidney failure, while not unheard of in SARS, was not a common presenting symptom back in 2002-2003. And SARS transmitted readily from human to human. Thus far, we haven?t seen signs of that sort of transmission with this new virus.
              None of which is to say this virus couldn?t prove to be a bigger public health threat down the road, only that it is premature to think of this virus as the next global health crisis.
              The media has been quick to refer to this virus as SARS-like, but it remains to be seen just how much the two viruses really have in common.

              The discovery of new - even deadly - viruses that can afflict humans or other mammals is not uncommon. And most of the time, after an initial flurry of breathless news reports, the threat is found to be less than of pandemic proportion.

              To provide a little perspective, a few viral discoveries in recent years that sparked initial hyperbolic headlines, but have (so far, anyway) failed to present a major public health threat:

              • We?ve watched a number of triple-reassortant swine flu (Variant) viruses (H1N1v, H1N2v, H3N2v) make tentative jumps into human hosts (see An Increasingly Complex Flu Field), and so far they?ve failed to spread efficiently, or to produce substantial levels of morbidity.
              • In August of this year (see New Phlebovirus Discovered In Missouri) the CDC announced the detection of a novel tick-borne virus in America?s heartland. Despite being detected in 2009, only two cases have been reported.
              • In March of this year, we learned of a new H17 flu subtype, carried by bats in an unusual host: bats(see A New Flu Comes Up To Bat).
              • In November of 2011 we saw a major die-off of seals in New England, that was eventually traced to a new mammalian adapted influenza virus mBio: A Mammalian Adapted H3N8 In Seals.
              • In October of 2008 doctors in Zambia and South Africa ran across a mysterious, previously unclassified virus that caused hemorrhagic symptoms in its victims similar to Ebola (see Lujo Virus: Newly Identified Arenavirus) While highly contagious, and fatal in 4 of the 5 identified victims, it has not reappeared since 2008.


              And if you want to go back a few more years, you can add Nipah, Hendra, H5N1, Ebola, Marburg . . . .

              The truth is, scientists ? with better tools available today ? are indentifying `new? viruses all of the time. A few well distributed viruses that until recently, were unknown, include:

              • The human metapneumovirus (HMPV) was identified in Dutch children with bronchiolitis about a decade ago. Since then, it has been found to be ubiquitous around the world, and responsible for a significant percentage of childhood respiratory infections . . . yet until 2001, no one knew it existed.
              • Human Bocavirus-infection (HBoV) wasn?t identified until 2005, when it was detected in 48 (9.1%) of 527 children with gastroenteritis in Spain (cite). It has since been found around the globe using PCR testing.


              And the list grows longer every year.

              While most will prove to be less than devastating in impact, we need only look at HIV, the 1918 H1N1 pandemic, and the pandemic viruses of 1957 and 1968 to realize that novel viruses can sometimes emerge and cause incredible morbidity and death.

              According to well respected anthropologist and researcher George Armelagos of Emory University, we are entering the Third Epidemiological Transition.

              This third transition began in the late 1970s or early 1980s, and is hallmarked by newly emerging infectious diseases, re-emerging diseases carried over from the 2nd transition (which began with the industrial revolution, and added chronic, non-infectious, degenerative diseases), and a rise in antimicrobial resistant pathogens.
              When you combine those factors with an increasingly mobile global population of about 7 billion people, and huge increases in the number of animals being raised for food consumption (often in environments conducive to the spread of diseases), and you have a recipe for explosive growth in diseases.

              Hence the need for continual surveillance, which will help us spot ? and if we are lucky, even contain ? the next pandemic before it can spread widely.

              Posted by Michael Coston at <a class="timestamp-link" href="http://afludiary.blogspot.com/2012/09/who-coronavirus-not-sars.html" rel="bookmark" title="permanent link"><abbr class="published" title="2012-09-25T09:23:00-04:00">9:23 AM</abbr>

              Comment


              • #52
                Re: Saudi Arabia: 3 cases, 2 deaths due to novel animal coronavirus

                See also: Jordan - Cluster of approximately 11 people with acute pneumonia type illness, 1 fatality - additional media reports of cases and fatalities denied


                Published Date: 2012-09-25

                NOVEL CORONAVIRUS - SAUDI ARABIA (04): REQUEST FOR INFORMATION, JORDAN, APRIL 2012
                ************************************************** ********************************
                A ProMED-mail post
                ProMED: Your 24/7 early warning system for emerging infectious diseases worldwide. Subscribe now to search alerts.


                Date: Sun 23 Sep 2012

                From: Irene Lai [edited]

                I would be interested to know whether the outbreak of severe respiratory disease of unknown origin in Jordan in April [2012] is now being reviewed for evidence of this new coronavirus.

                The HPA UK reports (http://www.hpa.org.uk/NewsCentre/Nat...essidentified/) seem to indicate that the cases under review were only those that occurred since July [2012]. "We are also aware of a small number of other cases of serious respiratory illness in the Middle East in the past 3 months."


                This ECDC report from May [2012] (http://ecdc.europa.eu/en/publication...y%202012.pdf):

                Severe respiratory disease of unknown origin - Jordan - Outbreak in ICU

                Opening date: [26 Apr 2012] Latest update: 3 May 2012


                Epidemiological summary

                -----------------------

                An outbreak of a respiratory illness was reported on [19 Apr 2012] by the Ministry of Health in an intensive care unit in a hospital in Zarqa, Jordan. 7 nurses and one doctor were among the 11 affected. One of the nurses died. Jordan's Ministry of Health acknowledges the fatal case specifying she had underlying conditions and all cases had high fever and lower respiratory symptoms. According to the Ministry, the origin of the infection is likely to be viral. However, laboratory results are not available to date.

                ECDC assessment

                ---------------
                ECDC is following this event due to its severity including one fatality and the unusualness of the disease affecting healthcare staff. These cases drew high media attention this week [week of 3 May 2012].

                Actions

                -------

                ECDC contacted both Episouth, WHO, and US CDC for further information. Both WHO and US CDC are following this event.


                --------------------------------------------------------------------------------------


                Date: Sun 22 Apr 2012

                Source: Jordan Times [edited]





                Emergency team searching for cause of unidentified illness


                ----------------------------------------------------------

                The disease that broke out in the Intensive Care Unit of Zarqa Public Hospital late last week [week of 19 Apr 2012] has not yet been identified, but the outbreak is under control, Minster of Health Abdul Latif Wreikat said on Sunday [22 Apr 2012].

                The ministry on Friday [20 Apr 2012] closed the hospital's ICU after an unknown illness believed to be pneumonia affected 7 nurses, one of whom died on Thursday [19 Apr 2012], one doctor, and the brother of one of the nurses.



                The minister said that so far, only 11 people have been confirmed infected with the disease, 4 of whom are receiving treatment and responding positively to medication, while 6 others have already been discharged from the hospital.

                The ministry has set up an emergency team from its Communicable Diseases Directorate to investigate the cause of the illness, he said.

                "The ministry's team took samples from the infected citizens, who also underwent intensive care measures to identify the cause," Wreikat told reporters at a press conference on Sunday [22 Apr 2012], noting that the infected patients' symptoms are similar to those of pneumonia.

                The minister, who visited the Zarqa hospital on Saturday [21 Apr 2012], said the ministry has confirmed that the outbreak has been brought under control and that the infected individuals are not in danger of spreading the disease to others.

                Meanwhile, the minister said, the hospital has been sterilised 3 times over the past 3 days as a precautionary measure, while its employees have received a short, intensive training course on preventing the disease from spreading.

                He also urged the media to be cautious and objective in reporting on the outbreak.



                [ProMED-mail would like to thank Dr Lai for raising this very astute query and for alerting us to this prior report of an earlier outbreak of severe respiratory disease in the region. This moderator has checked the WHO archives and the ProMED-mail archives and could not find reports on the above mentioned outbreak. The ECDC report is the only formal report on this outbreak. A retrospective search of HealthMap Alerts from 2 Apr 2012 through 25 Apr 2012 looking for reports of pneumonia outbreaks that might be related to this current event only identified a report on the above mentioned outbreak in Jordan in April 2012.

                There are a series of newswire reports in the Jordanian Times on this event at the time of the outbreak -- the report above in [2] is a comprehensive discussion of the event. Another report the preceding day (21 Apr 2012) highlighted the fact that after the 1st severe case, staff were not using adequate infection control measures, especially an absence of use of masks (see http://jordantimes.com/zarqa-hospita...from-infection). From these reports, it appears as though the outbreak in Jordan was a nosocomial outbreak involving healthcare personnel working in an ICU where presumably a patient with a severe pneumonia had been hospitalized -- quite possibly related to deficiencies in respiratory infection control measures.

                It would be of interest to know if the etiology of the outbreak was ever identified, along with more information on the epidemiologic studies conducted at the time. Information on the index case in that outbreak would be of interest as well.


                ProMED

                Comment


                • #53
                  Re: Saudi Arabia: 3 cases, 2 deaths due to novel animal coronavirus

                  ProMED personnel read FluTrackers. Our thread on the Jordan respiratory outbreak has been posted here since April 20, 2012:

                  Jordan - Cluster of approximately 11 people with acute pneumonia type illness, 1 fatality - additional media reports of cases and fatalities denied - April 20, 2012

                  Comment


                  • #54
                    Re: Saudi Arabia: 3 cases, 2 deaths due to novel animal coronavirus

                    [Source: Centre for Health Protection, Hong Kong PRC SAR, full text: (LINK).]
                    Update on overseas human cases with novel coronavirus infection


                    The Centre for Health Protection (CHP) of the Department of Health today (September 25) provided an update on its work following the report by the World Health Organization (WHO) on human cases with novel coronavirus infection in two patients from the Kingdom of Saudi Arabia (KSA) and Qatar.

                    The CHP is liaising with the WHO for updated information. The Centre is also closely monitoring the global situation for possible additional cases that may be discovered in the weeks ahead.

                    To enhance monitoring of the novel coronavirus in Hong Kong, the CHP has set up an enhanced surveillance mechanism with public and private hospitals and the airport for any suspected cases of novel coronavirus infection.

                    "There is no suspected case from returning travellers from the KSA and Qatar so far.

                    "We will treat each case seriously, even though there will be a few false alarms," a CHP spokesman said.

                    The Public Health Laboratory Services Branch under the CHP has the ability to diagnose this infection. Confirmatory testing requires about two days under normal circumstances.

                    The CHP will closely monitor the progress of further epidemiological investigations and surveillance, and the corresponding advice from the WHO. The WHO does not recommend any travel restrictions at this point.

                    The spokesman said that letters are being issued to institutions such as schools, childcare centres and elderly homes as well as the tourism industry to inform them of the latest situation and provide them with infection control guidance and related health advice.

                    The Centre will alert other government departments to make related preparations.

                    "As the situation is dynamic and subject to new discoveries and changes, the CHP will conduct epidemiological assessment frequently in light of the latest evidence, and adjust control measures as necessary," the spokesman said.


                    Ends/Tuesday, September 25, 2012
                    Issued at HKT 17:08
                    NNNN
                    - ------

                    Comment


                    • #55
                      Re: Saudi Arabia: 3 cases, 2 deaths due to novel animal coronavirus

                      Osterhaus bends over new coronavirus

                      12/09/25
                      - 16:40 Source: Reuters
                      ? Reuters.
                      Is it coincidence that in a few months time, two people have been infected with a new type of coronavirus or is there something around? That is the question virologist Ab Osterhaus (Erasmus MC) and his colleagues at home and abroad are currently bending. Also, they are eagerly looking for the source of infection.


                      "We are now working on a method which we this virus early diagnose. We also work on means by which we can fight, if need be: vaccines and antivirals, "said Osterhaus. The question is whether the virus from person to person can be. Currently, research is carried out in the contact area of the two patients. The question is whether people with whom they have been in contact antibodies have created. This may indicate that the virus from human to human transmission is. "But we should be careful. It may also be that the people who have antibodies with the same source have been in trouble. A bat example. Then it is possible that they are not infected each other, but that both the infected bat. " According to the RIVM in the Netherlands are not known infections. Symptoms that a patient receives when he is infected, include fever, cough, shortness of breath and difficulty breathing. The two known patients had severe pneumonia and kidney problems. http://www.ad.nl/ad/nl/1012/Nederlan...navirus.dhtml?
                      CSI:WORLD http://swineflumagazine.blogspot.com/

                      treyfish2004@yahoo.com

                      Comment


                      • #56
                        Re: Saudi Arabia: 3 cases, 2 deaths due to novel animal coronavirus

                        [Source: European Centre for Disease Prevention and Control (ECDC), full page: (LINK). Edited.]
                        Coronavirus: collaboration and surveillance the key to early detection and understanding the risk

                        25 Sep 2012 / ECDC



                        European, international and national public health authorities have been working closely together since the identification of two cases with a novel coronavirus became known. One case has died in Saudi Arabia and the second is in intensive care in a London hospital.

                        This newly identified coronavirus is not genetically similar to the SARS coronavirus and does not signal the start of a new SARS outbreak.

                        There is no evidence of person to person transmission, which was the case with SARS, and the symptom presentation is also different.

                        Coronaviruses can cause quite mild symptoms, similar to the common cold, or more severe disease as witnessed by the 2003 international SARS outbreak.

                        Further investigations are needed to fully understand the novel coronavirus and the public health implications. However, based on the available information, ECDC assesses the current risk as low.

                        The only way we can build a proper understanding of the virus is through coordinated international surveillance and laboratory testing.

                        The value of laboratories has been demonstrated by the excellent work done by the Health Protection Agency (HPA) laboratories in the UK and the Erasmus University Medical Centre in Rotterdam, the Netherlands.

                        There are in place plans and procedures in all public health authorities and international organisations for managing events where there is a little- or un-known disease or virus.

                        These range from sharing the genome of the virus between countries to ensure rapid laboratory identification to regular conference calls of public health officials. This is, in part, due to the legacy of the 2003 international SARS (severe acute respiratory syndrome) outbreak.

                        We now have better surveillance systems and a network of expert laboratories on imported viral diseases.



                        Read more:
                        -
                        ------

                        Comment


                        • #57
                          Re: Saudi Arabia: 3 cases, 2 deaths due to novel animal coronavirus

                          Virus advisory issued to OFWs in Saudi, Qatar
                          MANILA, Philippines - Overseas Filipino Workers (OFWs) based in Saudi Arabia and Qatar have been advised to observe proper hygiene to avoid contracting a new flu strain similar to the potentially fatal Severe Acute Respiratory Syndrome (SARS).

                          The advice was issued yesterday by doctors assigned at the quarantine section of the Ninoy Aquino International Airport (NAIA) following reports from the World Health Organization (WHO) of a case of the new flu strain reported in the United Kingdom...

                          NAIA quarantine doctor Caloy de la Reyna said proper hygiene by washing hands with soap regularly and clean surroundings will prevent the spread of the virus.

                          ?There?s no need to panic, we are observing all incoming passengers from the Middle East and other parts of the world using our thermal scanners,? he said.
                          http://www.philstar.com/Article.aspx...bCategoryId=68
                          CSI:WORLD http://swineflumagazine.blogspot.com/

                          treyfish2004@yahoo.com

                          Comment


                          • #58
                            Re: Saudi Arabia: 3 cases, 2 deaths due to novel animal coronavirus

                            Originally posted by Treyfish View Post
                            Virus advisory issued to OFWs in Saudi, Qatar
                            MANILA, Philippines - Overseas Filipino Workers (OFWs) based in Saudi Arabia and Qatar have been advised to observe proper hygiene to avoid contracting a new flu strain similar to the potentially fatal Severe Acute Respiratory Syndrome (SARS).

                            The advice was issued yesterday by doctors assigned at the quarantine section of the Ninoy Aquino International Airport (NAIA) following reports from the World Health Organization (WHO) of a case of the new flu strain reported in the United Kingdom...

                            NAIA quarantine doctor Caloy de la Reyna said proper hygiene by washing hands with soap regularly and clean surroundings will prevent the spread of the virus.

                            ?There?s no need to panic, we are observing all incoming passengers from the Middle East and other parts of the world using our thermal scanners,? he said.
                            http://www.philstar.com/Article.aspx...bCategoryId=68

                            I really wish media would correctly identify this outbreak as a coronavirus and not flu. Also, it is not SARS.

                            Comment


                            • #59
                              Re: Saudi Arabia: 3 cases, 2 deaths due to novel animal coronavirus

                              [Source: Health Protection Agency, United Kingdom, full page: (LINK). Edited. Hat-tip Helen Branswell via Twitter.]
                              Partial genetic sequence information for scientists about the Novel Coronavirus 2012



                              Phylogenetic tree constructed with partial sequences from the polymerase gene (nsp12) of representative coronaviruses from different groups is displayed in the attached Figure.

                              The sequence obtained at HPA has been tentatively named as London1_novel CoV 2012 (boxed in red). The HPA sequence data is based on direct detection from clinical material from the London case. HPA do not yet have a virus isolate. There will shortly be a GENBANK accession number for the sequence.

                              The attached phylogenetic tree is considered preliminary, as is virus nomenclature, and liable to change as more information or a virus isolate becomes available.



                              This is the partial nucleotide sequence of the viral polymerase (nsp12):
                              >London1_novel_CoV_2012_nsp12(partial)
                              TATTAGTGCTAAGAATAGAGCTCGCACTGTTGCAGGCGTGTCCATACTTA GCACAATGAC
                              TAATCGCCAGTACCATCAGAAAATGCTTAAGTCCATGGCTGCAACTCGTG GAGCGACTTG
                              CGTCATTGGTACTACAAAGTTCTATGGTGGCTGGGATTTCATGCTTAAAA CATTGTACAA
                              AGATGTTGATAATCCGCATCTTATGGGT

                              You may download the fasta file (as a zip file) from the link below: Last reviewed: 25 September 2012
                              - -------

                              Comment


                              • #60
                                Re: Saudi Arabia: 3 cases, 2 deaths due to novel animal coronavirus

                                The above is VERY unfortunate naming. It is clear that this virus is NOT flu or SARS, but naming the virus the "London" coronavirus is a horrible idea and precisely what we fought hard to avoid doing with the 2009 flu pandemic. This virus should not get a geographical name, as it might hurt tourism to London (where no transmission is suspected to have occurred), or stigmatize British people around the world.

                                I can think of several better naming choices. We could name the virus after one of the scientists who discovered it (i.e. Fouchier coronavirus, Zaki coronavirus, etc.). We could mash the names of the two cities where teh first cases were reported (as they did with a novel hemorrhagic fever virus in Lusaka and Johannesburg in 2008, Lujo) to get something like Jedlon or Jelo virus. Or we could call this virus the 2012 SARS virus, distinguishing it from the 2003 SARS virus in much the same way we distingusih 1918 H1N1 from 2009 H1N1.

                                I am even slightly hesitant to take this last option, as the 2005 IHR dictates strict rules for reporting "SARS" cases that might not be applicable in the current outbreak.

                                Comment

                                Working...
                                X