NS1
Well-known member
Fatal Divergency on 4 UK Zoonotic Sequences
Fatal Divergency on 4 UK Zoonotic Sequences
http://pf11.blogspot.com/2011/01/fatal-divergency-on-4-uk-zoonotic.html
** Error on spacing prior to table with sequence name norming **
2011-01-07
Fatal Divergency on 4 UK Zoonotic Sequences
The UK Health Protection Agency released an analysis of the early severe wave today in Eurosurveillance. The requested citation is:
Ellis J, Galiano M, Pebody R, Lackenby A, Thompson C, Bermingham A, McLean E, Zhao H, Bolotin S, Dar O, Watson JM, Zambon M. Virological analysis of fatal influenza cases in the United Kingdom during the early wave of influenza in winter 2010/11. Euro Surveill. 2011;16(1)
ii=19760.
Available online:
http://www.eurosurveillance.org/ViewArticle.aspx?ArticleId=19760
Date of submission: 31 December 2010
No additional sequences appear to have been released with the paper though a very useful phylogenetic chart is provided as Figure 3: Phylogenetic relationship of full-length HA sequences of influenza A(H1N1)2009 viruses from fatal, severe and mild cases in the United Kingdom during 2010.
All four previously released UK sequences from 2010-12-20 are on the Ellis Figure3 <SUP>1</SUP> chart marked as fatality and all four were updated yesterday on GISAID as "Deceased". Two were recent and all four are divergent.
Fatal Sequences from Ellis Figure 3 In GISAID 2010-12-20 Deposit
<TABLE><TBODY><TR><TD>* UKWhiteChapel4880374_2M_2010_11_28_f</TD><TD>= A/England/4880374/2010</TD></TR>
<TR><TD>* UKCambridge118_4F_2010_11_19_f</TD><TD>= A/England/118/2010</TD></TR>
<TR><TD>* UKWhiteChapel4780352_5M_2010_10_26_f</TD><TD>= A/England/4780352/2010</TD></TR>
<TR><TD>* UKBirmingham3220137_44F_2010_08_07_f</TD><TD>= A/England/3220137/2010</TD></TR>
</TBODY></TABLE>
GeneWurx has annotated the Ellis Figure3 <SUP>1</SUP> phylogenetic chart with green boxes next to the four fatal GISAID 2010-12-20 deposited sequences and has proposed a 225G branch due to lack of data transparency.
Preliminary Comments on the Ellis Figure 3
(without the essential corroborating sequences)
The numbering system employed in our analyses requires adding 3 to the amino acid positions indicated in the UK chart.
Notice that the branch polymorphisms are not labeled from that top D97N (100N) upwardly.
The accumulation of 100N, 188T, 377K, 225G and 454N patterns onto the OzBrisbane209_51F_2010_08_09 sequence from the late winter in the Southern Hemisphere. Though parameters are adjustable for the phylogenetic chart, the top section may indicate one or more unmarked branches near the top right. Either publication of the sequences or the notation for the branching polymorphism would be very useful at this time. Are these strictly indicative of the high variability head and tail changes being seen frequently (under aa100, over aa499)?
Is it probable that no instance of change at any amino acid position from 156 to 159 has been elucidated from this wide inspection of the severe wave?
Alternate sub-clade:
By chart appearances, the accumulation of 128D onto the more established backgrounds with 100N and 377K (lower section) creates a fatality risk similar to more recognised severity markers. The bottom fatal sequence designated on the lower branch as A/England/4780352/2010 is identified as UKWhiteChapel4780352_2010_10_26_f in v3 of the GeneWurx Emerging Genetics spreadsheet within column AY and carries three additional silent (synonymous) changes at syn58C, syn131S and syn210S.
Hyper-Zoonotic Polymorphism Details
Please excuse the intermediate markings on these sequences. The following are rough lab notes, but divergence may be ascertained easily.
The common ground among these sequences and those in the database on either side of them temporally, from Cameroon (Sub-clade 1 & Sub-clade 2) and especially Iran, is the high quantity of polymorphisms that are novel or rare to pH1N1 and that also appear in zoonotic reservoirs, particularly H3N8, H5N1 and H7N7.
Even small genetic adjustments from animal vectors into human infections, especially H3N8, may create variant behaviour. This potential era of zoonotic sub-segment spillover merits as much investigation for severity (in combination) as does the recognised 225G.
. . . . UKWhiteChapel4880374_2M_2010_11_28_f (
. . . . . . . . 0A (gCC) [1918 (GCT), S7 (GCT), S5 (GCA)]
. . . . . . . . syn55L [S9, H5N1],
. . . . . . . . . . . . . . [Darwin47_2010_08_09 with syn529L,
. . . . . . . . . . . . . . Iran16273_2009_11_22 with 226R
. . . . . . . . . . . . . . NZ_Waikato2_2010_01_04 with 233H,
. . . . . . . . . . . . . . tkOntarioFAV117_1C_2009_12_07 mult domain matches, et al],
. . . . . . . . 188T [H6N1, H7N7],
. . . . . . . . syn338G [H3N8, H4, H5, H6, sw],
. . . . . . . . . . . . . . . [OzBrisbane209_51F_2010_08_09
. . . . . . . . . . . . . . . . . . . . with 156E & 225G,
. . . . . . . . . . . . . . . Arizona05_2010_05_11 with 0A,
. . . . . . . . . . . . . . . Swine Asia 2005 with 0A, et al]
. . . . . . . . 377K,
. . . . . . . . 454N [H7N3, H7N7, H9N2]
. . . . . . . . . . [Florida14_24M_2010_08_05
. . . . . . . . . . . . . . . . . . with 188T, 454N,
. . . . . . . . . . FL_Pen210_2009_11_10
. . . . . . . . . . . . . . . . . . with 225E,
. . . . . . . . . . SouthCarolina18_2009_09_16_VxX
. . . . . . . . . . . . . . . . . . with 159D, 224K, et al],
. . . . . . . . syn529L (CTt) [Unique to PF11]
. . . . . . . . . . . . . . . . . . . . [S7 (CTt), tn with syn338G (GGg)]
. . . . . . . . . . . . . . . . . . . . [PF11 32 Worldwide (CTa),
. . . . . . . . . . . . . . . . . . . . PF11 5 North America (tTG)],
. . . . . . . . . . . . . . . . . . . . [swThailandCU_CHK4_2009_01 (tTG)
. . . . . . . . . . . . . . . . . . . . . . . . . . with 0A, syn338G, 189T, 377G, syn451K, syn456L])
. . . . UKCambridge118_4F_2010_11_19_f (
. . . . . . . . syn118E tcatttgaaaggtttgaA,
. . . . . . . . 137T [MoldovaG170_2009,
. . . . . . . . . . . . . 41 sequences at GISAID],
. . . . . . . . syn163K,
. . . . . . . . 186P,
. . . . . . . . syn251L gaagcaactggaaatctG,
. . . . . . . . syn293L gctataaacaccagcctT,
. . . . . . . . syn363G [21 sequences at GISAID],
. . . . . . . . syn455Q caAttaaaaaacaatgcc ,
. . . . . . . . syn474C [H3N8],
. . . . . . . . 504G ttaaacagagaagaaatagGt,
. . . . . . . . 513V [1918, S5, tn] Gtttaccagattttggcgatc)
. . . . UKWhiteChapel4780352_5M_2010_10_26_f (
. . . . . . . . syn58C,
. . . . . . . . 100N,
. . . . . . . . 128D,
. . . . . . . . syn131S tcaaacaaaggtgtaacggca,
. . . . . . . . syn210S,
. . . . . . . . 377K)
. . . . UKBirmingham3220137_44F_2010_08_07_f (
. . . . . . . . #8A gcagttctgctatatacattt,
. . . . . . . . 175K aaagtcctcgtgctatgg,
. . . . . . . . 311E Gaaagcacaaaattgaga,
. . . . . . . . 377K,
. . . . . . . . syn385V gtCattgaaaagatgaat,
. . . . . . . . syn451K aagaacttatatgaaaaA,
. . . . . . . . syn454S agTcagttaaaaaacaatgcc,
. . . . . . . . syn494E,
. . . . . . . . 537G [S5] tccctgggggcaatcGgt)
1. Ellis J, Galiano M, Pebody R, Lackenby A, Thompson C, Bermingham A, McLean E, Zhao H, Bolotin S, Dar O, Watson JM, Zambon M. Virological analysis of fatal influenza cases in the United Kingdom during the early wave of influenza in winter 2010/11. Euro Surveill. 2011;16(1)
ii=19760. Available online: http://www.eurosurveillance.org/ViewArticle.aspx?ArticleId=19760
Fatal Divergency on 4 UK Zoonotic Sequences
http://pf11.blogspot.com/2011/01/fatal-divergency-on-4-uk-zoonotic.html
** Error on spacing prior to table with sequence name norming **
2011-01-07
Fatal Divergency on 4 UK Zoonotic Sequences
The UK Health Protection Agency released an analysis of the early severe wave today in Eurosurveillance. The requested citation is:
Ellis J, Galiano M, Pebody R, Lackenby A, Thompson C, Bermingham A, McLean E, Zhao H, Bolotin S, Dar O, Watson JM, Zambon M. Virological analysis of fatal influenza cases in the United Kingdom during the early wave of influenza in winter 2010/11. Euro Surveill. 2011;16(1)
Available online:
http://www.eurosurveillance.org/ViewArticle.aspx?ArticleId=19760
Date of submission: 31 December 2010
No additional sequences appear to have been released with the paper though a very useful phylogenetic chart is provided as Figure 3: Phylogenetic relationship of full-length HA sequences of influenza A(H1N1)2009 viruses from fatal, severe and mild cases in the United Kingdom during 2010.
All four previously released UK sequences from 2010-12-20 are on the Ellis Figure3 <SUP>1</SUP> chart marked as fatality and all four were updated yesterday on GISAID as "Deceased". Two were recent and all four are divergent.
Fatal Sequences from Ellis Figure 3 In GISAID 2010-12-20 Deposit
<TABLE><TBODY><TR><TD>* UKWhiteChapel4880374_2M_2010_11_28_f</TD><TD>= A/England/4880374/2010</TD></TR>
<TR><TD>* UKCambridge118_4F_2010_11_19_f</TD><TD>= A/England/118/2010</TD></TR>
<TR><TD>* UKWhiteChapel4780352_5M_2010_10_26_f</TD><TD>= A/England/4780352/2010</TD></TR>
<TR><TD>* UKBirmingham3220137_44F_2010_08_07_f</TD><TD>= A/England/3220137/2010</TD></TR>
</TBODY></TABLE>
GeneWurx has annotated the Ellis Figure3 <SUP>1</SUP> phylogenetic chart with green boxes next to the four fatal GISAID 2010-12-20 deposited sequences and has proposed a 225G branch due to lack of data transparency.
Preliminary Comments on the Ellis Figure 3
(without the essential corroborating sequences)
The numbering system employed in our analyses requires adding 3 to the amino acid positions indicated in the UK chart.
Notice that the branch polymorphisms are not labeled from that top D97N (100N) upwardly.
The accumulation of 100N, 188T, 377K, 225G and 454N patterns onto the OzBrisbane209_51F_2010_08_09 sequence from the late winter in the Southern Hemisphere. Though parameters are adjustable for the phylogenetic chart, the top section may indicate one or more unmarked branches near the top right. Either publication of the sequences or the notation for the branching polymorphism would be very useful at this time. Are these strictly indicative of the high variability head and tail changes being seen frequently (under aa100, over aa499)?
Is it probable that no instance of change at any amino acid position from 156 to 159 has been elucidated from this wide inspection of the severe wave?
Alternate sub-clade:
By chart appearances, the accumulation of 128D onto the more established backgrounds with 100N and 377K (lower section) creates a fatality risk similar to more recognised severity markers. The bottom fatal sequence designated on the lower branch as A/England/4780352/2010 is identified as UKWhiteChapel4780352_2010_10_26_f in v3 of the GeneWurx Emerging Genetics spreadsheet within column AY and carries three additional silent (synonymous) changes at syn58C, syn131S and syn210S.
Hyper-Zoonotic Polymorphism Details
Please excuse the intermediate markings on these sequences. The following are rough lab notes, but divergence may be ascertained easily.
The common ground among these sequences and those in the database on either side of them temporally, from Cameroon (Sub-clade 1 & Sub-clade 2) and especially Iran, is the high quantity of polymorphisms that are novel or rare to pH1N1 and that also appear in zoonotic reservoirs, particularly H3N8, H5N1 and H7N7.
Even small genetic adjustments from animal vectors into human infections, especially H3N8, may create variant behaviour. This potential era of zoonotic sub-segment spillover merits as much investigation for severity (in combination) as does the recognised 225G.
. . . . UKWhiteChapel4880374_2M_2010_11_28_f (
. . . . . . . . 0A (gCC) [1918 (GCT), S7 (GCT), S5 (GCA)]
. . . . . . . . syn55L [S9, H5N1],
. . . . . . . . . . . . . . [Darwin47_2010_08_09 with syn529L,
. . . . . . . . . . . . . . Iran16273_2009_11_22 with 226R
. . . . . . . . . . . . . . NZ_Waikato2_2010_01_04 with 233H,
. . . . . . . . . . . . . . tkOntarioFAV117_1C_2009_12_07 mult domain matches, et al],
. . . . . . . . 188T [H6N1, H7N7],
. . . . . . . . syn338G [H3N8, H4, H5, H6, sw],
. . . . . . . . . . . . . . . [OzBrisbane209_51F_2010_08_09
. . . . . . . . . . . . . . . . . . . . with 156E & 225G,
. . . . . . . . . . . . . . . Arizona05_2010_05_11 with 0A,
. . . . . . . . . . . . . . . Swine Asia 2005 with 0A, et al]
. . . . . . . . 377K,
. . . . . . . . 454N [H7N3, H7N7, H9N2]
. . . . . . . . . . [Florida14_24M_2010_08_05
. . . . . . . . . . . . . . . . . . with 188T, 454N,
. . . . . . . . . . FL_Pen210_2009_11_10
. . . . . . . . . . . . . . . . . . with 225E,
. . . . . . . . . . SouthCarolina18_2009_09_16_VxX
. . . . . . . . . . . . . . . . . . with 159D, 224K, et al],
. . . . . . . . syn529L (CTt) [Unique to PF11]
. . . . . . . . . . . . . . . . . . . . [S7 (CTt), tn with syn338G (GGg)]
. . . . . . . . . . . . . . . . . . . . [PF11 32 Worldwide (CTa),
. . . . . . . . . . . . . . . . . . . . PF11 5 North America (tTG)],
. . . . . . . . . . . . . . . . . . . . [swThailandCU_CHK4_2009_01 (tTG)
. . . . . . . . . . . . . . . . . . . . . . . . . . with 0A, syn338G, 189T, 377G, syn451K, syn456L])
. . . . UKCambridge118_4F_2010_11_19_f (
. . . . . . . . syn118E tcatttgaaaggtttgaA,
. . . . . . . . 137T [MoldovaG170_2009,
. . . . . . . . . . . . . 41 sequences at GISAID],
. . . . . . . . syn163K,
. . . . . . . . 186P,
. . . . . . . . syn251L gaagcaactggaaatctG,
. . . . . . . . syn293L gctataaacaccagcctT,
. . . . . . . . syn363G [21 sequences at GISAID],
. . . . . . . . syn455Q caAttaaaaaacaatgcc ,
. . . . . . . . syn474C [H3N8],
. . . . . . . . 504G ttaaacagagaagaaatagGt,
. . . . . . . . 513V [1918, S5, tn] Gtttaccagattttggcgatc)
. . . . UKWhiteChapel4780352_5M_2010_10_26_f (
. . . . . . . . syn58C,
. . . . . . . . 100N,
. . . . . . . . 128D,
. . . . . . . . syn131S tcaaacaaaggtgtaacggca,
. . . . . . . . syn210S,
. . . . . . . . 377K)
. . . . UKBirmingham3220137_44F_2010_08_07_f (
. . . . . . . . #8A gcagttctgctatatacattt,
. . . . . . . . 175K aaagtcctcgtgctatgg,
. . . . . . . . 311E Gaaagcacaaaattgaga,
. . . . . . . . 377K,
. . . . . . . . syn385V gtCattgaaaagatgaat,
. . . . . . . . syn451K aagaacttatatgaaaaA,
. . . . . . . . syn454S agTcagttaaaaaacaatgcc,
. . . . . . . . syn494E,
. . . . . . . . 537G [S5] tccctgggggcaatcGgt)
1. Ellis J, Galiano M, Pebody R, Lackenby A, Thompson C, Bermingham A, McLean E, Zhao H, Bolotin S, Dar O, Watson JM, Zambon M. Virological analysis of fatal influenza cases in the United Kingdom during the early wave of influenza in winter 2010/11. Euro Surveill. 2011;16(1)