• FluTrackers.com Inc. does not provide medical advice. Information on this web site is collected from various internet resources, and the FluTrackers board of directors makes no warranty to the safety, efficacy, correctness or completeness of the information posted on this site by any author or poster. The information collated here is for instructional and/or discussion purposes only and is NOT intended to diagnose or treat any disease, illness, or other medical condition. Every individual reader or poster should seek advice from their personal physician/healthcare practitioner before considering or using any interventions that are discussed on this website. By continuing to access this website you agree to consult your personal physican before using any interventions posted on this website, and you agree to hold harmless FluTrackers.com Inc., the board of directors, the members, and all authors and posters for any effects from use of any medication, supplement, vitamin or other substance, device, intervention, etc. mentioned in posts on this website, or other internet venues referenced in posts on this website.
  • We are not asking for any donations. Do not donate to any entity who says they are raising funds for us.

RNA interference as a natural antiviral to mosquito vectored diseases

sharon sanders

Editor-in-Chief & President
RNA interference acts as a natural antiviral response to O'nyong-nyong virus (Alphavirus; Togaviridae) infection of Anopheles gambiae
</NOBR><NOBR>Kimberly M. Keene</NOBR>, <NOBR>Brian D. Foy</NOBR>, <NOBR>Irma Sanchez-Vargas</NOBR>, <NOBR>Barry J. Beaty</NOBR>, <NOBR>Carol D. Blair</NOBR>, and <NOBR>Ken E. Olson<SUP> *</SUP></NOBR>
Arthropod-Borne and Infectious Diseases Laboratory, Department of Microbiology, Immunology, and Pathology, Colorado State University, Fort Collins, CO 80523
Contributed by Barry J. Beaty, October 4, 2004
<!-- null -->
<TABLE cellSpacing=0 cellPadding=0 width="100%" bgColor=#e1e1e1><TBODY><TR><TD vAlign=center align=left width="5%" bgColor=#ffffff>
rarrow.gif
</TD><TH vAlign=center align=left width="95%">[SIZE=+2] Abstract [/SIZE]</TH></TR></TBODY></TABLE><TABLE cellPadding=5 align=right border=1><TBODY><TR><TH align=left>[SIZE=-1]Top
dot.gif
Abstract
Materials and Methods
Results
Discussion
References
[/SIZE]</TH></TR></TBODY></TABLE>

RNA interference (RNAi) is triggered in eukaryotic organisms<SUP> </SUP>by double-stranded RNA (dsRNA), and it destroys any mRNA that<SUP> </SUP>has sequence identity with the dsRNA trigger. The RNAi pathway<SUP> </SUP>in Anopheles gambiae can be silenced by transfecting cells with<SUP> </SUP>dsRNA derived from exon sequence of the A. gambiae Argonaute2<SUP> </SUP>(AgAgo2) gene. We hypothesized that RNAi may also act as an<SUP> </SUP>antagonist to alphavirus replication in A. gambiae because RNA<SUP> </SUP>viruses form dsRNA during replication. Silencing AgAgo2 expression<SUP> </SUP>would make A. gambiae mosquitoes more permissive to virus infection.<SUP> </SUP>To determine whether RNAi conditions the vector competence of<SUP> </SUP>A. gambiae for O'nyong-nyong virus (ONNV), we engineered a genetically<SUP> </SUP>modified ONNV that expresses enhanced GFP (eGFP) as a marker.<SUP> </SUP>After intrathoracic injection, ONNV-eGFP slowly spread to other<SUP> </SUP>A. gambiae tissues over a 9-day incubation period. Mosquitoes<SUP> </SUP>were then coinjected with virus and either control
beta.gif
-galactosidase<SUP> </SUP>dsRNA (ds
beta.gif
gal; note that "ds" is used as a prefix to indicate<SUP> </SUP>the dsRNA derived from a given gene throughout) or ONNV dsnsP3.<SUP> </SUP>Treatment with dsnsP3 inhibited virus spread significantly,<SUP> </SUP>as determined by eGFP expression patterns. ONNV-eGFP titers<SUP> </SUP>from mosquitoes coinjected with dsnsP3 were significantly lower<SUP> </SUP>at 3 and 6 days after injection than in mosquitoes coinjected<SUP> </SUP>with ds
beta.gif
gal. Mosquitoes were then coinjected with ONNV-eGFP and<SUP> </SUP>dsAgAgo2. Mosquitoes coinjected with virus and AgAgo2 dsRNA<SUP> </SUP>displayed widespread eGFP expression and virus titers 16-fold<SUP> </SUP>higher than ds
beta.gif
gal controls after 3 or 6 days after injection.<SUP> </SUP>These observations provide direct evidence that RNAi is an antagonist<SUP> </SUP>of ONNV replication in A. gambiae, and they suggest that the<SUP> </SUP>innate immune response conditions vector competence.<SUP> </SUP>

[SIZE=-1]innate immunity | mosquito | vector competence[/SIZE]
<HR align=center width="50%" noShade SIZE=1>Arboviruses (arthropod-borne viruses) continue to impact human<SUP> </SUP>and animal health worldwide. Mosquito-borne arboviruses replicate<SUP> </SUP>and disseminate within susceptible vector tissues before transmission<SUP> </SUP>to vertebrate hosts. We know little about how mosquitoes cope<SUP> </SUP>with arbovirus infections. However, we expect that mosquitoes<SUP> </SUP>have defense mechanisms to counteract or modulate arbovirus<SUP> </SUP>infections that could impair host functions. RNA interference<SUP> </SUP>(RNAi) may be an important pathway that mosquitoes use to modulate<SUP> </SUP>arbovirus replication (1).<SUP> </SUP>
RNAi is a potent intracellular response activated by double-stranded<SUP> </SUP>RNA (dsRNA) and results in a reduced steady-state level of specific<SUP> </SUP>RNA molecules with sequence similarity to the dsRNA (2, 3).<SUP> </SUP>The mechanism of RNAi has been studied in some detail in Drosophila<SUP> </SUP>melanogaster. In fruit flies, the RNase III enzyme Dicer is<SUP> </SUP>responsible for digesting dsRNA into 21- to 23-bp small interfering<SUP> </SUP>RNAs (siRNAs). The siRNAs are then unwound into single-stranded<SUP> </SUP>siRNAs in an ATP-dependent step and incorporated into an enzyme<SUP> </SUP>complex termed the RNA-induced silencing complex (RISC). The<SUP> </SUP>single-stranded siRNAs guide RISC to the target mRNA, and the<SUP> </SUP>complex cleaves the message or inhibits its translation (4).<SUP> </SUP>An essential component of RISC is Argonaute2 (AGO2), a member<SUP> </SUP>of the Argonaute family of proteins. AGO2 has been coimmunoprecipitated<SUP> </SUP>with Dicer from Dicer-transfected Drosophila S2 cells (5). A<SUP> </SUP>proposed interaction between AGO2 and Dicer2 facilitates the<SUP> </SUP>incorporation of siRNAs into RISC, which can target cognate<SUP> </SUP>mRNAs for destruction (5, 6).<SUP> </SUP>
There are several reasons to suspect that RNAi is an antagonist<SUP> </SUP>of arbovirus replication in mosquitoes. First, the RNAi-like<SUP> </SUP>posttranscriptional gene silencing (PTGS) pathway in plants<SUP> </SUP>is a potent antiviral response triggered by dsRNA generated<SUP> </SUP>by some plant viruses (7). Second, many plant RNA viruses encode<SUP> </SUP>suppressors of PTGS, supporting the observations that PTGS acts<SUP> </SUP>as a viral defense system (8). For example, the tombusvirus<SUP> </SUP>p19 protein suppresses PTGS in plants by binding siRNAs produced<SUP> </SUP>after virus infection (9). Third, Li et al. (10) demonstrated<SUP> </SUP>that the B2 gene of the insect nodavirus, flock house virus<SUP> </SUP>(FHV), can suppress PTGS activity in plants and RNAi in Drosophila<SUP> </SUP>S2 cells, emphasizing that an evolutionarily conserved RNAi<SUP> </SUP>pathway plays a natural antiviral role. Also, this research<SUP> </SUP>group demonstrated that vaccinia and human influenza A, B, and<SUP> </SUP>C viruses each encode a protein that suppresses RNAi in mammalian<SUP> </SUP>and insect cells (11).<SUP> </SUP>
Studies have shown that RNAi is active in anopheline and culicine<SUP> </SUP>mosquitoes (1, 12?19). Recently, Hoa et al. (20) demonstrated<SUP> </SUP>that expression of Dicer2, AGO2, and AGO3 proteins are essential<SUP> </SUP>for RNAi activity in Anopheles gambiae Sua1B cells. Transient<SUP> </SUP>expression of luciferase in the Sua1B cell line was silenced<SUP> </SUP>
ap.gif
4,000-fold after transfection with dsRNA derived from the luciferase<SUP> </SUP>reporter gene. Pretreatment of the cells with dsRNA derived<SUP> </SUP>from cDNA sequence of A. gambiae dcr2 (AgDcr2), A. gambiae Ago2<SUP> </SUP>(AgAgo2), or AgAgo3 consistently yielded recovery of luciferase<SUP> </SUP>activity, demonstrating that RNAi can be used to silence genes<SUP> </SUP>involved in its own pathway and implying that these genes have<SUP> </SUP>important roles in RNAi within mosquito cells. The recovery<SUP> </SUP>phenomenon was not observed when the cells were treated with<SUP> </SUP>
beta.gif
-galactosidase (
beta.gif
-gal) dsRNA (ds
beta.gif
gal; note that "ds" is used as<SUP> </SUP>a prefix to indicate the dsRNA derived from a given gene throughout),<SUP> </SUP>or dsAgAgo1, dsAgAgo4, and dsAgAgo5 (20).<SUP> </SUP>
A logical progression from these studies would be to determine<SUP> </SUP>whether RNAi can act as an antagonist to arbovirus replication<SUP> </SUP>in A. gambiae. However, anopheline mosquitoes transmit few arboviruses.<SUP> </SUP>An exception is O'nyong-nyong virus (ONNV) (Togaviridae; Alphavirus),<SUP> </SUP>which is the etiological agent of a large outbreak of human<SUP> </SUP>disease in East Africa from 1959?1962 (21?23) and<SUP> </SUP>again in 1996 (24). In epidemics, Anopheles spp. are almost<SUP> </SUP>certainly the vectors. Wild-caught Anopheles funestus and A.<SUP> </SUP>gambiae mosquitoes held alive for up to 20 days after capture<SUP> </SUP>have been found to be infected with ONNV (21).<SUP> </SUP>
ONNV is a small, enveloped RNA virus that replicates exclusively<SUP> </SUP>in the cytoplasm of infected cells (25). The genome is a positive-sense,<SUP> </SUP>single-stranded, nonsegmented RNA of
ap.gif
11.7 kb (25, 26). The 5'<SUP> </SUP>two-thirds of the alphavirus genome is translated to form polyproteins<SUP> </SUP>that are posttranslationally processed into nsP1?nsP4<SUP> </SUP>proteins to form replicase complexes that synthesize positive<SUP> </SUP>or negative RNAs (25, 27). Replication of alphavirus RNA occurs<SUP> </SUP>at intracellular membranes in infected cells and leads to formation<SUP> </SUP>of dsRNA forms called replicative intermediates (28). The subgenomic<SUP> </SUP>(26S) mRNA, colinear with the 3' one-third of the genome, is<SUP> </SUP>translated into a structural polyprotein from which capsid,<SUP> </SUP>the envelope glycoproteins (E1 and E2), and two smaller polypeptides<SUP> </SUP>(E3 and 6K) are produced as cleavage products during glycoprotein<SUP> </SUP>processing. Alphavirus RNA genomes are readily manipulated as<SUP> </SUP>full-length cDNA infectious clones, and recombinant double subgenomic<SUP> </SUP>ONNV has been generated that expresses enhanced GFP (eGFP) as<SUP> </SUP>a marker of infection (29).<SUP> </SUP>
In this article, we describe the replication of a recombinant<SUP> </SUP>ONNV-eGFP after intrathoracic injection into A. gambiae. When<SUP> </SUP>this virus was coinjected with dsRNA derived from the viral<SUP> </SUP>genome, virus replication in the mosquito was compromised significantly.<SUP> </SUP>In contrast, mosquitoes coinjected with ONN-eGFP and dsRNA derived<SUP> </SUP>from AgAgo2 were more permissive to virus replication and dissemination.<SUP> </SUP>These experiments demonstrate that RNAi acts as an antiviral<SUP> </SUP>response to ONNV-eGFP infections in A. gambiae.<SUP> </SUP>
<!-- null -->
<TABLE cellSpacing=0 cellPadding=0 width="100%" bgColor=#e1e1e1><TBODY><TR><TD vAlign=center align=left width="5%" bgColor=#ffffff>
rarrow.gif
</TD><TH vAlign=center align=left width="95%">[SIZE=+2] Materials and Methods [/SIZE]</TH></TR></TBODY></TABLE><TABLE cellPadding=5 align=right border=1><TBODY><TR><TH align=left>[SIZE=-1]Top
Abstract
dot.gif
Materials and Methods
Results
Discussion
References
[/SIZE]</TH></TR></TBODY></TABLE>
Cell Lines and Virus Production and Generation of ONNV-eGFP.<SUP> </SUP>The infectious cDNA clone, pONN.30a, derived from the Uganda<SUP> </SUP>SG-650 strain of ONNV was provided by Ann Powers (Division of<SUP> </SUP>Vector-Borne Infectious Diseases, Centers for Disease Control<SUP> </SUP>and Prevention, Fort Collins, CO). The infectious clone was<SUP> </SUP>further modified to a recombinant double subgenomic infectious<SUP> </SUP>clone expressing eGFP (p5'dsONNic-Foy/eGFP, but for simplicity,<SUP> </SUP>it is referred to here as ONNV-eGFP), constructed essentially<SUP> </SUP>as described (30) and linearized to form a template for in vitro<SUP> </SUP>transcription by using T7 polymerase. RNA from the transcription<SUP> </SUP>reaction was electroporated into BHK-21 cells. At 36 h later,<SUP> </SUP>the supernatant containing virus was collected, and the virus<SUP> </SUP>titer was determined by plaque assay. C6/36 cells (Aedes albopictus)<SUP> </SUP>were then infected at an multiplicity of infection of 0.01,<SUP> </SUP>and 60 h later, supernatant containing the virus was collected<SUP> </SUP>and titrated. The virus stock contained 2.1 [FONT=arial,helvetica]x[/FONT] 10<SUP>7</SUP> plaque-forming<SUP> </SUP>units (pfu)/ml.<SUP> </SUP>
Mosquitoes and Intrathoracic Inoculation of Virus and/or dsRNAs.<SUP> </SUP>A. gambiae (G3 strain) were reared on an artificial diet of<SUP> </SUP>ground fish food at 30?C with a 14 h light/10 h dark photoperiod.<SUP> </SUP>Adult female A. gambiae (2?4 days after emergence) were<SUP> </SUP>injected with 0.5 ?l of inoculum. For viral characterization<SUP> </SUP>studies, viral stock was diluted to 1 [FONT=arial,helvetica]x[/FONT] 10<SUP>7</SUP> pfu/ml before injection,<SUP> </SUP>and thus, each mosquito received
ap.gif
5 [FONT=arial,helvetica]x[/FONT] 10<SUP>3</SUP> pfu of virus. For coinjections<SUP> </SUP>of virus and dsRNA, dsRNA was diluted to a concentration of<SUP> </SUP>1 ?g/?l in PBS and mixed 1:1 (vol/vol) with the<SUP> </SUP>undiluted stock (2.1 [FONT=arial,helvetica]x[/FONT] 10<SUP>7</SUP> pfu/ml). Thus, each mosquito was<SUP> </SUP>inoculated with
ap.gif
5.3 [FONT=arial,helvetica]x[/FONT] 10<SUP>3</SUP> pfu of virus and 250 ng of dsRNA.<SUP> </SUP>
Characterization of ONNV Infection in A. gambiae Mosquitoes.<SUP> </SUP>After inoculation, A. gambiae adult female mosquitoes were assayed<SUP> </SUP>at 3, 6, and 9 days postinjection (dpi). Mosquitoes were killed<SUP> </SUP>by brief submersion in 70% ethanol, washed in saline, and assayed<SUP> </SUP>initially for eGFP expression under UV light. The heads were<SUP> </SUP>then removed, squashed on glass slides, fixed in acetone, and<SUP> </SUP>assayed for viral antigen by immunofluorescence assay using<SUP> </SUP>an mAb (30.11a) that was developed against Sindbis virus E2<SUP> </SUP>protein but cross-reacts with ONNV E2 protein. The thorax and<SUP> </SUP>abdomen of each mosquito were frozen individually at ?70?C<SUP> </SUP>and later titrated by plaque assay (described below).<SUP> </SUP>
Generation of dsRNA. cDNAs were generated from total mosquito<SUP> </SUP>RNA [extracted from fourth-instar larvae by using the RNeasy<SUP> </SUP>kit (Qiagen, Valencia, CA)] by RT-PCR using an oligo(dT) primer.<SUP> </SUP>Oligonucleotide primers were designed to amplify
ap.gif
500-bp regions<SUP> </SUP>of A. gambiae Ago1?5 cDNA, and they incorporated T7 promoter<SUP> </SUP>sequences at the 5' ends (Table 1). Control
ap.gif
500-bp cDNA templates<SUP> </SUP>were generated by PCR using primers specific for portions of<SUP> </SUP>the Escherichia coli
beta.gif
-gal cDNA clone and for the nsP3 gene from<SUP> </SUP>ONNV-eGFP. To generate dsRNA, PCR products were purified by<SUP> </SUP>gel extraction and used as templates for in vitro transcription<SUP> </SUP>using the MegaScript kit (Ambion, Austin, TX), and dsRNAs were<SUP> </SUP>purified according to the manufacturer's instructions. The quality<SUP> </SUP>of dsRNA was checked by agarose gel electrophoresis and quantified<SUP> </SUP>by using a spectrophotometer.<SUP> </SUP>
<SUP></SUP>
<!-- null -->
<CENTER><TABLE cellSpacing=0 cellPadding=0 width="95%"><TBODY><TR bgColor=#e1e1e1><TD><TABLE cellSpacing=2 cellPadding=2><TBODY><TR bgColor=#e1e1e1><TD vAlign=top align=middle bgColor=#ffffff>View this table:
<NOBR>[in this window]
[in a new window]
</NOBR> </TD><TD vAlign=top align=left>Table 1. Primer pairs for amplification of dsRNA template from A. gambiae
</TD></TR></TBODY></TABLE></TD></TR></TBODY></TABLE></CENTER>
Determination of Virus Titer. Mosquitoes were triturated in<SUP> </SUP>270 ?l of DMEM by using a mortar and pestle, and large<SUP> </SUP>particulates were pelleted by centrifugation. The supernatant<SUP> </SUP>was passed through a 0.22-?m filter and then titrated<SUP> </SUP>by standard plaque assay by using Vero cells (31). We counted<SUP> </SUP>pfu, and the data were log<SUB>10</SUB> transformed. Differences in viral<SUP> </SUP>titers were first analyzed by ANOVA, and the titers in the treatment<SUP> </SUP>groups were found to be significantly different (P < 0.01).<SUP> </SUP>Pairwise t tests were then performed. Highly significant differences<SUP> </SUP>(P < 0.0001) between treatments groups and controls are marked<SUP> </SUP>with two asterisks, and significant differences (P < 0.05)<SUP> </SUP>are marked with a single asterisk.<SUP> </SUP>
Northern Blot Analysis. Total RNA was isolated at 2?3<SUP> </SUP>dpi from 50?60 mosquitoes for each treatment group by<SUP> </SUP>using the guanidine isothiocyanate/phenol?chloroform method<SUP> </SUP>of extraction. mRNA was purified from total RNA by using the<SUP> </SUP>MicroPoly(A) Purist kit (Ambion). We separated 10 ?g of<SUP> </SUP>mRNA on a 1% agarose-formaldehyde gel and transferred to a BrightStar<SUP> </SUP>Plus nylon membrane (Ambion). The blots were hybridized with<SUP> </SUP><SUP>32</SUP>P-labeled probe complementary to the ONNV E2 gene (Fig. 1B)<SUP> </SUP>or AgAgo2 (Fig. 4). The blots were then washed at 68?C,<SUP> </SUP>and radioactivity was detected by using a Storm PhosphoImager<SUP> </SUP>(Molecular Dynamics, Amersham Biosciences).<SUP> </SUP>
<SUP></SUP>
<!-- null -->
<CENTER><TABLE cellSpacing=0 cellPadding=0 width="95%"><TBODY><TR bgColor=#e1e1e1><TD><TABLE cellSpacing=2 cellPadding=2><TBODY><TR bgColor=#e1e1e1><TD vAlign=top align=middle bgColor=#ffffff>
View larger version (44K):
<NOBR>[in this window]
[in a new window]
</NOBR> </TD><TD vAlign=top align=left>Fig. 1. Design and characterization of recombinant ONNV-eGFP. (A) p5'dsONNVic/Foy contains a full-length cDNA of the ONNV genome with a second subgenomic promoter inserted 3' of the original subgenomic promoter. eGFP was cloned into the MCS and is transcribed under control of the first subgenomic promoter. (B) Characterization of viral transcripts of ONNV after injection into adult female A. gambiae. Lanes 1 and 2 show the ONNV-eGFP transcript profile at 48 and 72 h after infection, respectively. The blot was hybridized by using a radiolabeled ONNV E2 gene as probe, and it shows the production of the full-length genomic and two subgenomic transcripts. (C) eGFP expression at 9 dpi occurs throughout the body.
</TD></TR></TBODY></TABLE></TD></TR></TBODY></TABLE></CENTER><SUP></SUP>
<!-- null -->
<CENTER><TABLE cellSpacing=0 cellPadding=0 width="95%"><TBODY><TR bgColor=#e1e1e1><TD><TABLE cellSpacing=2 cellPadding=2><TBODY><TR bgColor=#e1e1e1><TD vAlign=top align=middle bgColor=#ffffff>
View larger version (51K):
<NOBR>[in this window]
[in a new window]
</NOBR> </TD><TD vAlign=top align=left>Fig. 4. Northern blot analysis of AgAgo2 mRNA after injection of mosquitoes with ONNV-eGFP, dsRNA, or dsRNA and ONNV-eGFP. Injection of dsAgAgo2 results in the reduction of Ago2 transcript levels. Mosquitoes injected with dsAgAgo2 and virus showed partial recovery of the Ago2 mRNA accumulation. (Upper) Lane 1, mock injected; lane 2, ds
beta.gif
gal at 3 dpi; lane 3, dsAgAgo2 at 3 dpi; lane 4, dsAgAgo2 + ONNV-eGFP 3 at dpi; lane 5, ONNV-eGFP 2 dpi; and lane 6, ONNV-eGFP 3 dpi. (Lower) Ethidium bromide stain of Northern blot showing ribosomal RNA in each lane and verifying that equivalent amounts of total RNA were added to each lane.
</TD></TR></TBODY></TABLE></TD></TR></TBODY></TABLE></CENTER><!-- null -->
<TABLE cellSpacing=0 cellPadding=0 width="100%" bgColor=#e1e1e1><TBODY><TR><TD vAlign=center align=left width="5%" bgColor=#ffffff>
rarrow.gif
</TD><TH vAlign=center align=left width="95%">[SIZE=+2] Results [/SIZE]</TH></TR></TBODY></TABLE><TABLE cellPadding=5 align=right border=1><TBODY><TR><TH align=left>[SIZE=-1]Top
Abstract
Materials and Methods
dot.gif
Results
Discussion
References
[/SIZE]</TH></TR></TBODY></TABLE>
Construction and in Vivo Characterization of Intrathoracically<SUP> </SUP>Injected ONNV-eGFP. The pONNV.30a infectious clone was engineered<SUP> </SUP>to contain a duplicated subgenomic promoter, 3' to the original<SUP> </SUP>subgenomic promoter (Fig. 1 A). eGFP was inserted immediately<SUP> </SUP>downstream of the first subgenomic promoter into a multiple<SUP> </SUP>cloning site, generating ONNV-eGFP plasmid. Recombinant virus<SUP> </SUP>was produced from this plasmid and injected into A. gambiae<SUP> </SUP>mosquitoes. The three RNA species predicted from virus transcription<SUP> </SUP>were not detectable by Northern blotting of mosquito RNA after<SUP> </SUP>48 h, but they were apparent after 72 h (Fig. 1B), indicating<SUP> </SUP>a relatively slow rate of viral replication in A. gambiae tissue.<SUP> </SUP>Viral titers in the mosquito at 3 dpi were lower than the input<SUP> </SUP>titer by >1.5 log pfu (Table 2), but they then slowly increased<SUP> </SUP>over a 9-day incubation period. Virus was detected in the head<SUP> </SUP>tissues of individual mosquitoes both by eGFP expression and<SUP> </SUP>by immunofluorescence analysis of the E1 glycoprotein (Table 2).<SUP> </SUP>The data indicate that these methods of detection are equivalent<SUP> </SUP>and that eGFP serves as a readily detectable marker of infection<SUP> </SUP>during this time period. eGFP expression in injected mosquitoes<SUP> </SUP>at 9 dpi revealed temporal and spatial infection patterns of<SUP> </SUP>the virus (Fig. 1C). Virus typically infected nervous, muscle,<SUP> </SUP>and fat body tissues. When ONNV-eGFP dissemination to the head<SUP> </SUP>occurred, ommatidia and cells in the maxillary palps, antennae,<SUP> </SUP>and in the mouth parts expressed eGFP, but the marker was not<SUP> </SUP>apparent in salivary glands (data not shown). In the abdomen,<SUP> </SUP>eGFP was most often sporadically associated with circular muscle<SUP> </SUP>fibers wrapping the alimentary canal and with fat body.<SUP> </SUP>
<SUP></SUP>
<!-- null -->
<CENTER><TABLE cellSpacing=0 cellPadding=0 width="95%"><TBODY><TR bgColor=#e1e1e1><TD><TABLE cellSpacing=2 cellPadding=2><TBODY><TR bgColor=#e1e1e1><TD vAlign=top align=middle bgColor=#ffffff>View this table:
<NOBR>[in this window]
[in a new window]
</NOBR> </TD><TD vAlign=top align=left>Table 2. Dissemination of 5' dsONNic-Foy/eGFP after injection in A. gambiae
</TD></TR></TBODY></TABLE></TD></TR></TBODY></TABLE></CENTER>
Inhibition of Virus Replication After Coinjection with ONNV<SUP> </SUP>and dsRNA Targeting ONNV nsP3 Gene Sequence. Initially, we tested<SUP> </SUP>whether the RNAi pathway in A. gambiae could inhibit virus replication<SUP> </SUP>and dissemination by introduction of nsP3 gene dsRNA (dsnsP3)<SUP> </SUP>to target the virus genome. Mosquitoes were coinjected with<SUP> </SUP>5.3 [FONT=arial,helvetica]x[/FONT] 10<SUP>3</SUP> pfu of virus and 250 ng of ONNV dsnsP3. Mosquitoes<SUP> </SUP>were also coinjected with the same dose of ONNV-eGFP virus and<SUP> </SUP>ds
beta.gif
gal. Primers for generating dsRNAs are given in Table 1. In<SUP> </SUP>mosquitoes receiving dsnsP3, eGFP was usually restricted to<SUP> </SUP>thoracic tissue surrounding the site of injection (Fig. 2A).<SUP> </SUP>Mosquitoes coinjected with virus and ds
beta.gif
gal control usually had<SUP> </SUP>more extensive expression of eGFP in the thorax (Fig. 2B). At<SUP> </SUP>3 dpi, 86% (n = 58) of mosquitoes receiving ds
beta.gif
gal expressed<SUP> </SUP>eGFP in thoracic tissues, but only 38% (n = 52) expressed eGFP<SUP> </SUP>in thoracic tissues when dsnsP3 was coinjected (Table 3). At<SUP> </SUP>3 dpi, 23% (n = 52) of mosquitoes receiving dsnsP3 showed eGFP<SUP> </SUP>expression in head tissues and none of the same mosquitoes had<SUP> </SUP>eGFP in abdominal tissue (Table 3). In contrast, 34% (n = 58)<SUP> </SUP>of mosquitoes receiving ds
beta.gif
gal had eGFP expression in their head<SUP> </SUP>and abdominal tissues (Table 3). At 6 dpi, 57% (n = 53) of mosquitoes<SUP> </SUP>injected with ds
beta.gif
gal had eGFP in their head and abdominal tissues;<SUP> </SUP>however, eGFP could only be seen in 36% of the head tissue and<SUP> </SUP>16% of the abdominal tissue (n = 52) of mosquitoes coinjected<SUP> </SUP>with virus and dsnsP3 (Table 3).<SUP> </SUP>
<SUP></SUP>
<!-- null -->
<CENTER><TABLE cellSpacing=0 cellPadding=0 width="95%"><TBODY><TR bgColor=#e1e1e1><TD><TABLE cellSpacing=2 cellPadding=2><TBODY><TR bgColor=#e1e1e1><TD vAlign=top align=middle bgColor=#ffffff>
View larger version (155K):
<NOBR>[in this window]
[in a new window]
</NOBR> </TD><TD vAlign=top align=left>Fig. 2. eGFP expression at 3 dpi in mosquitoes coinjected with dsRNAs and ONNV-eGFP. (A) Coinjection of ONNV-eGFP and dsnsP3. (B) Coinjection of ONNV-eGFP and ds
beta.gif
gal. (C) Coinjection of ONNV-eGFP and dsAgAgo2. Mosquitoes injected with dsnsP3 show a dramatic reduction in eGFP expression when compared with ds
beta.gif
gal-injected controls, whereas mosquitoes injected with dsAgAgo2 show an increase in eGFP expression over controls.
</TD></TR></TBODY></TABLE></TD></TR></TBODY></TABLE></CENTER><SUP></SUP>
<!-- null -->
<CENTER><TABLE cellSpacing=0 cellPadding=0 width="95%"><TBODY><TR bgColor=#e1e1e1><TD><TABLE cellSpacing=2 cellPadding=2><TBODY><TR bgColor=#e1e1e1><TD vAlign=top align=middle bgColor=#ffffff>View this table:
<NOBR>[in this window]
[in a new window]
</NOBR> </TD><TD vAlign=top align=left>Table 3. Percentage of injected mosquitoes displaying eGFP expression in body tissues after coinjection of ONNV-eGFP and dsnsP3 or dsAgAgo2 at 3 and 6 dpi
</TD></TR></TBODY></TABLE></TD></TR></TBODY></TABLE></CENTER>
To quantitate virus abundance, mosquitoes were triturated and<SUP> </SUP>virus titer was determined by plaque assay from these treatment<SUP> </SUP>groups. No significant difference in the number of plaques was<SUP> </SUP>observed between the mosquitoes injected only with ONNV-eGFP<SUP> </SUP>and mosquitoes coinjected with ds
beta.gif
gal (P > 0.08). However,<SUP> </SUP>mosquitoes coinjected with ONNV-eGFP and dsnsP3 had significantly<SUP> </SUP>fewer plaques than those mosquitoes coinjected with ONNV-eGFP<SUP> </SUP>and ds
beta.gif
gal (P < 0.0001) at both 3 and 6 dpi (Fig. 3).<SUP> </SUP>
<SUP></SUP>
<!-- null -->
<CENTER><TABLE cellSpacing=0 cellPadding=0 width="95%"><TBODY><TR bgColor=#e1e1e1><TD><TABLE cellSpacing=2 cellPadding=2><TBODY><TR bgColor=#e1e1e1><TD vAlign=top align=middle bgColor=#ffffff>
View larger version (23K):
<NOBR>[in this window]
[in a new window]
</NOBR> </TD><TD vAlign=top align=left>Fig. 3. Viral titers of ONNV-eGFP in mosquitoes coinjected with dsRNA homologous to ONNV nsP3 and AgAgo2. Compared with the nonspecific ds
beta.gif
gal, mosquitoes coinjected with virus and dsnsP3 had statistically significant decreases in infection at both 3 and 6 dpi (P < 0.0001). Viral titers of ONNV-eGFP increased significantly in mosquitoes at 3 and 6 dpi after coinjection with dsRNAs homologous with AgAgo2 (P < 0.0001 and P = 0.0006 at 3 and 6 dpi, respectively).
</TD></TR></TBODY></TABLE></TD></TR></TBODY></TABLE></CENTER>Coinjection of ONNV and dsRNAs Homologous to AgAgo2. We then<SUP> </SUP>coinjected mosquitoes with dsAgAgo2 to observe whether silencing<SUP> </SUP>of AgAgo2 expression would make mosquitoes more permissive to<SUP> </SUP>ONNV. At 3 dpi, these mosquitoes usually displayed dramatic<SUP> </SUP>increases in eGFP expression with eGFP detected in tissues in<SUP> </SUP>all body segments (Fig. 2C). At 3 dpi, only 34% (n = 58) of<SUP> </SUP>mosquitoes treated with ONNV-eGFP and ds
beta.gif
gal showed eGFP in their<SUP> </SUP>heads and abdomens, but
ge.gif
97% (n = 63) of mosquitoes treated with<SUP> </SUP>dsAgAgo2 showed eGFP in the same tissues (Table 3). At 6 dpi,<SUP> </SUP>57% (n = 53) of mosquitoes injected with virus and ds
beta.gif
gal displayed<SUP> </SUP>eGFP in head and abdominal tissues; 100% (n = 36) injected with<SUP> </SUP>virus and dsAgAgo2 displayed eGFP in those tissues (Fig. 3).<SUP> </SUP>
We examined mRNA accumulation of AgAgo2 in mosquitoes after<SUP> </SUP>injection with dsAgAgo2 to determine whether the dsRNA specifically<SUP> </SUP>silenced AgAgo2 mRNA. Injection of nonspecific ds
beta.gif
gal failed<SUP> </SUP>to silence AgAgo2 mRNA, but injection of dsAgAgo2 silenced accumulation<SUP> </SUP>of Ago2 mRNA in mosquitoes (Fig. 5, lane 3). Interestingly,<SUP> </SUP>we detected partial recovery of AgAgo2 mRNA when ONNV was coinjected<SUP> </SUP>with dsAgAgo2 (Fig. 5, lane 4). AgAgo2 mRNA levels in mosquitoes<SUP> </SUP>injected with ONNV alone were similar to noninjected and ds
beta.gif
gal-injected<SUP> </SUP>controls.<SUP> </SUP>
<SUP></SUP>
<!-- null -->
<CENTER><TABLE cellSpacing=0 cellPadding=0 width="95%"><TBODY><TR bgColor=#e1e1e1><TD><TABLE cellSpacing=2 cellPadding=2><TBODY><TR bgColor=#e1e1e1><TD vAlign=top align=middle bgColor=#ffffff>
View larger version (27K):
<NOBR>[in this window]
[in a new window]
</NOBR> </TD><TD vAlign=top align=left>Fig. 5. Viral titers of ONNV-eGFP in mosquitoes at 3 and 6 dpi after coinjection of dsRNA homologous to AgAgo1, AgAgo3, AgAgo4, and AgAgo5. Compared with the nonspecific ds
beta.gif
gal, only mosquitoes coinjected with virus and dsAgAgo3 had statistically significant increases at 3 and 6 dpi (P
le.gif
0.0141).
</TD></TR></TBODY></TABLE></TD></TR></TBODY></TABLE></CENTER>Finally, virus titers were recovered on the same mosquitoes<SUP> </SUP>used for determining the eGFP expression profiles. Mosquitoes<SUP> </SUP>treated with dsAgAgo2 had significantly more infectious virus<SUP> </SUP>per mosquito at 3 dpi than mosquitoes treated with ds
beta.gif
gal (16-fold<SUP> </SUP>increase; P < 0.0001, Fig. 4). At 6 dpi, viral titers increased<SUP> </SUP>in all tested mosquitoes, but dsAgAgo2-treated mosquitoes still<SUP> </SUP>had significantly more virus per mosquito than ds
beta.gif
gal-treated<SUP> </SUP>controls (P = 0.0006, Fig. 4).<SUP> </SUP>
Coinjection of ONNV and dsRNAs Homologous to AgAgo1, AgAgo3,<SUP> </SUP>AgAgo4, and AgAgo5. Mosquitoes were injected with virus and<SUP> </SUP>dsRNAs derived from AgAgo1, AgAgo3, AgAgo4, and AgAgo5 (20).<SUP> </SUP>These studies were performed to observe whether silencing of<SUP> </SUP>other AgAgo genes also could increase mosquito permissiveness<SUP> </SUP>to ONNV replication, possibly implicating them in RNAi modulation<SUP> </SUP>of ONNV-eGFP replication. At 3 and 6 dpi, mosquitoes coinjected<SUP> </SUP>with virus and AgAgo-derived dsRNAs (dsAgAgo1, dsAgAgo3, dsAgAgo4,<SUP> </SUP>and dsAgAgo5) usually displayed similar eGFP expression patterns<SUP> </SUP>to that seen with the ds
beta.gif
gal control mosquitoes (Table 4). The<SUP> </SUP>only exception was that mosquitoes injected with dsAgAgo3 consistently<SUP> </SUP>had greater dissemination of virus in all tissues than those<SUP> </SUP>injected with either ds
beta.gif
gal or dsAgAgo1, dsAgAgo4, and dsAgAgo5<SUP> </SUP>(Table 4). These observations were confirmed by virus titration.<SUP> </SUP>Virus titers in mosquitoes injected with dsAgAgo3 differed significantly<SUP> </SUP>from those mosquitoes injected with ds
beta.gif
gal at 3 dpi (P = 0.0067)<SUP> </SUP>and at 6 dpi (P = 0.0141) (Fig. 5). Virus titers in mosquitoes<SUP> </SUP>injected with dsAgAgo1, dsAgAgo4, and dsAgAgo5 did not differ<SUP> </SUP>statistically from those mosquitoes injected with ds
beta.gif
gal at 3<SUP> </SUP>and 6 dpi.<SUP> </SUP>
<SUP></SUP>
<!-- null -->
<CENTER><TABLE cellSpacing=0 cellPadding=0 width="95%"><TBODY><TR bgColor=#e1e1e1><TD><TABLE cellSpacing=2 cellPadding=2><TBODY><TR bgColor=#e1e1e1><TD vAlign=top align=middle bgColor=#ffffff>View this table:
<NOBR>[in this window]
[in a new window]
</NOBR> </TD><TD vAlign=top align=left>Table 4. Percentage of injected mosquitoes displaying eGFP expression in body tissues after coinjection of ONNV-eGFP and dsRNAs from AgAgo1, AgAgo3, AgAgo4, and AgAgo5 at 3 and 6 dpi
</TD></TR></TBODY></TABLE></TD></TR></TBODY></TABLE></CENTER>
<!-- null -->
<TABLE cellSpacing=0 cellPadding=0 width="100%" bgColor=#e1e1e1><TBODY><TR><TD vAlign=center align=left width="5%" bgColor=#ffffff>
rarrow.gif
</TD><TH vAlign=center align=left width="95%">[SIZE=+2] Discussion [/SIZE]</TH></TR></TBODY></TABLE><TABLE cellPadding=5 align=right border=1><TBODY><TR><TH align=left>[SIZE=-1]Top
Abstract
Materials and Methods
Results
dot.gif
Discussion
References
[/SIZE]</TH></TR></TBODY></TABLE>
In this study, we demonstrated that RNAi can act as an antagonist<SUP> </SUP>to arbovirus replication in mosquitoes. We describe an alphavirus<SUP> </SUP>transducing system based on ONNV and follow the course of infection<SUP> </SUP>after injection of recombinant virus into the A. gambiae hemocoel.<SUP> </SUP>After injection into the hemocoel, ONNV-eGFP replicated slowly<SUP> </SUP>in A. gambiae. Injection of dsRNA cognate to a portion of the<SUP> </SUP>ONNV genome and stimulation of RNAi further slowed ONNV replication<SUP> </SUP>in this mosquito species. Injection of dsRNA cognate to AgAgo2,<SUP> </SUP>which is a gene known to function in the A. gambiae RNAi pathway<SUP> </SUP>(20), silenced RNAi, thereby permitting ONNV-eGFP to replicate<SUP> </SUP>and disseminate quickly in mosquitoes. In addition, dsRNA derived<SUP> </SUP>from AgAgo3 also made mosquitoes more permissive to ONNV-eGFP<SUP> </SUP>replication at 3 and 6 dpi. In contrast, dsRNAs derived from<SUP> </SUP>AgAgo1, AgAgo4, and AgAgo5 did not alter virus replication significantly<SUP> </SUP>at either 3 or 6 dpi. These data suggest a regulatory role for<SUP> </SUP>RNAi in controlling arbovirus infections in mosquitoes.<SUP> </SUP>
The pathogenesis of ONNV in A. gambiae is unusual when compared<SUP> </SUP>with typical alphavirus?vector models. When injected into<SUP> </SUP>culicine mosquitoes, ONNV, like other alphaviruses (Sindbis<SUP> </SUP>virus and Venezuelan equine encephalitis virus), replicates<SUP> </SUP>efficiently and rapidly spreads throughout the mosquito (32?34;<SUP> </SUP>B.D.F., unpublished data). However, ONNV replication in A. gambiae<SUP> </SUP>is relatively slow after intrathoracic injection. ONNV also<SUP> </SUP>infects A. gambiae midgut tissues after per os infection, but<SUP> </SUP>it has an unusual tropism for the anterior midgut epithelium<SUP> </SUP>and is limited in its ability to escape from the alimentary<SUP> </SUP>canal (29). A. gambiae may not be the ideal vector for ONNV.<SUP> </SUP>A. funestus has been implicated as a potentially better vector<SUP> </SUP>of ONNV in Africa (21, 23). It would be interesting to observe<SUP> </SUP>whether A. funestus can modulate ONNV-eGFP infection as readily<SUP> </SUP>as A. gambiae.<SUP> </SUP>
Our results point to the AGO2, and possibly AGO3, proteins as<SUP> </SUP>critical components of a mosquito RNAi pathway involved in the<SUP> </SUP>inhibition of alphavirus replication. ONNV replication was affected<SUP> </SUP>most by silencing of Ago2, which has been shown to be an important<SUP> </SUP>RISC component in Drosophila (5). Northern blot analysis showed<SUP> </SUP>that the presence of dsAgAgo2 leads to reduced amounts of AgAgo2<SUP> </SUP>mRNA in vivo, but the analysis also suggests that infection<SUP> </SUP>with ONNV stimulates recovery of this transcript accumulation.<SUP> </SUP>A possible explanation is that ONNV infection induced transcription<SUP> </SUP>of AgAgo2, although there is no supporting evidence for this<SUP> </SUP>hypothesis. The other, more likely, explanation is that ONNV<SUP> </SUP>encodes a repressor of RNAi in the mosquito, which has been<SUP> </SUP>shown with other RNA viruses (8). The ONNV suppressor might<SUP> </SUP>counteract the silencing from dsAgAgo2 injection. Transcription<SUP> </SUP>of ONNV-eGFP was first detected at 72 h after infection (Fig.<SUP> </SUP>1B), which is when an ONNV suppressor protein may be translated<SUP> </SUP>in sufficient quantities to have an effect on RNAi. Even if<SUP> </SUP>one or both of these possibilities is correct, it is clear that<SUP> </SUP>the injection of dsAgAgo2 has a strong biological effect that<SUP> </SUP>resulted in increased ONNV titers in the mosquito that lasted<SUP> </SUP>at least 6 days after treatment.<SUP> </SUP>
The Argonaute family comprises a group of proteins, some of<SUP> </SUP>which are required for RNAi and others of which have roles in<SUP> </SUP>regulating development. We have demonstrated that AgAgo2 and<SUP> </SUP>AgAgo3 are involved in RNAi both in cell culture (20) and in<SUP> </SUP>mosquitoes. Whereas the Drosophila ortholog of Ago2 has been<SUP> </SUP>characterized, Ago3 has not (5, 35). DmAgo1 is required for<SUP> </SUP>efficient RNAi in Drosophila, functioning in the pathway after<SUP> </SUP>the production of siRNA (36). We hypothesized previously that<SUP> </SUP>the function of AgAgo3 may be analogous to that of DmAgo1 (20).<SUP> </SUP>The Drosophila paralogues of AgAgo4 and AgAgo5, piwi and aubergine,<SUP> </SUP>have known functions in development (35).<SUP> </SUP>
Several innate immune pathways in mosquitoes have been elucidated<SUP> </SUP>for defense against bacterial and macroparasite infections (18,<SUP> </SUP>37?40); however, no antiviral mechanisms or pathways have<SUP> </SUP>been described. In vertebrate species, there are innate immune<SUP> </SUP>mechanisms that recognize and mount responses to dsRNA, including<SUP> </SUP>the interferon and protein kinase R pathways, but neither has<SUP> </SUP>been detected in the mosquito. The data presented in this article<SUP> </SUP>support the idea that RNAi is a mechanism to protect mosquitoes<SUP> </SUP>from viral infection. We hypothesize that vector competence<SUP> </SUP>for an alphavirus is partly due to the balance struck between<SUP> </SUP>the opposing forces of vector and arbovirus evolution. Some<SUP> </SUP>alphaviruses may replicate and disseminate so quickly as to<SUP> </SUP>avoid induction of an RNAi defense, or they may quickly disseminate<SUP> </SUP>from tissues with a strong RNAi response and into mosquito tissues<SUP> </SUP>with a weak RNAi response (30, 41, 42). For example, the C.<SUP> </SUP>elegans nervous system has been shown to be refractory to silencing<SUP> </SUP>of mRNA by RNAi (43). Also, many plant viruses encode suppressors<SUP> </SUP>of RNAi that may also be present in alphaviruses (8). Different<SUP> </SUP>vector species are also likely to show differences in their<SUP> </SUP>RNAi responses. Some mosquitoes may preferentially express negative<SUP> </SUP>regulators of RNAi, such as the ERI-1 protein that has been<SUP> </SUP>identified in C. elegans (44). Data demonstrating dsRNA effectiveness<SUP> </SUP>against myriad targets in A. gambiae (12, 18, 19) may indicate<SUP> </SUP>that these mosquitoes generally have a robust RNAi response,<SUP> </SUP>which could partly explain why anopholine mosquitoes are such<SUP> </SUP>poor vectors of arboviruses. Mosquitoes such as Aedes aegypti<SUP> </SUP>readily transmit both alphaviruses (Chikungunya and Sindbis),<SUP> </SUP>and flaviviruses (yellow fever and dengue), possibly indicating<SUP> </SUP>that these mosquitoes have a weaker RNAi response. In support<SUP> </SUP>of this hypothesis, we have observed that ONNV readily disseminates<SUP> </SUP>in A. aegypti tissues after injection but that the Sindbis virus<SUP> </SUP>MRE16 strain (30), which disseminates very efficiently in all<SUP> </SUP>of the culicines that we have injected, could not replicate<SUP> </SUP>in A. gambiae tissues (data not shown).<SUP> </SUP>
This study is the first step in understanding how RNAi naturally<SUP> </SUP>modulates arboviral infection in the mosquito. An understanding<SUP> </SUP>of whether the RNAi response can modulate arboviral infection<SUP> </SUP>and dissemination in other vector mosquitoes and by other families<SUP> </SUP>of arboviruses would provide a better understanding of how mosquitoes<SUP> </SUP>respond to virus infection, and it would possibly provide researchers<SUP> </SUP>with information on how to design strategies that enhance mosquito<SUP> </SUP>refractoriness to arboviruses.<SUP> </SUP>
<!-- null -->
<TABLE cellSpacing=0 cellPadding=0 width="100%" bgColor=#e1e1e1><TBODY><TR><TD vAlign=center align=left width="5%" bgColor=#ffffff>
rarrow.gif
</TD><TH vAlign=center align=left width="95%">[SIZE=+2] Acknowledgements [/SIZE]</TH></TR></TBODY></TABLE>
We thank Drs. Ann Powers and Aaron Brault (University of California,<SUP> </SUP>Davis) for their gift of pONN.30A. We also thank Cynthia Meredith<SUP> </SUP>and Sarah VanOtterloo for assistance with mosquito rearing.<SUP> </SUP>This work was supported by National Institutes of Health Grants<SUP> </SUP>AI-34014, AI-25489, and AI46435.<SUP> </SUP>


<TABLE cellSpacing=0 cellPadding=0 width="100%" bgColor=#e1e1e1><TBODY><TR><TD vAlign=center align=left width="5%" bgColor=#ffffff>
rarrow.gif
</TD><TH vAlign=center align=left width="95%">[SIZE=+2] Footnotes [/SIZE]</TH></TR></TBODY></TABLE>
<!-- null -->Author contributions: K.M.K., B.D.F., I.S.-V., B.J.B., C.D.B.,<SUP> </SUP>and K.E.O. designed research; K.M.K., B.D.F., and I.S.-V. performed<SUP> </SUP>research; K.M.K., B.D.F., I.S.-V., B.J.B., C.D.B., and K.E.O.<SUP> </SUP>analyzed data; and K.M.K., B.D.F., and K.E.O. wrote the paper.<SUP> </SUP>
<!-- null -->Abbreviations: RNAi, RNA interference; dsRNA, double-stranded<SUP> </SUP>RNA; eGFP, enhanced GFP; dpi, days postinjection;
beta.gif
-gal,
beta.gif
-galactosidase;<SUP> </SUP>ONNV, O'nyong-nyong virus; RISC, RNA-induced silencing complex;<SUP> </SUP>AgAgo, Anopheles gambiae Ago; AGO2/3, Argonaute2/3; pfu, plaque-forming<SUP> </SUP>units; siRNA, small interfering RNA.<SUP> </SUP>
<!-- null --><SUP>*</SUP> To whom correspondence should be addressed. E-mail: kolson@colostate.edu<SCRIPT type=text/javascript><!-- var u = "kolson", d = "colostate.edu"; document.getElementById("em0").innerHTML = '<a href="mailto:' + u + '@' + d + '">' + u + '@' + d + '<\/a>'//--></SCRIPT> .
? 2004 by The National Academy of Sciences of the USA
<!-- null -->
<TABLE cellSpacing=0 cellPadding=0 width="100%" bgColor=#e1e1e1><TBODY><TR><TD vAlign=center align=left width="5%" bgColor=#ffffff>
rarrow.gif
</TD><TH vAlign=center align=left width="95%">[SIZE=+2] References [/SIZE]</TH></TR></TBODY></TABLE><TABLE cellPadding=5 align=right border=1><TBODY><TR><TH align=left>[SIZE=-1]Top
Abstract
Materials and Methods
Results
Discussion
dot.gif
References
[/SIZE]</TH></TR></TBODY></TABLE>
  1. <!-- null --><LI value=1>Sanchez-Vargas, I., Travanty, E. A., Keene, K. M., Franz, A. W., Beaty, B. J., Blair, C. D. & Olson, K. E. (2004) Virus Res. 102, 65?74.<!-- HIGHWIRE ID="101:49:17240:1" -->[CrossRef][ISI][Medline] <!-- /HIGHWIRE --><!-- null --><LI value=2>Cogoni, C. & Macino, G. (1997) Proc. Natl. Acad. Sci. USA 94, 10233?10238.<!-- HIGHWIRE ID="101:49:17240:2" --><NOBR>[Abstract/Free Full Text]</NOBR><!-- /HIGHWIRE --><!-- null --> <LI value=3>Vaucheret, H., Beclin, C., Elmayan, T., Feuerbach, F., Godon, C., Morel, J. B., Mourrain, P., Palauqui, J. C. & Vernhettes, S. (1998) Plant J. 16, 651?659.<!-- HIGHWIRE ID="101:49:17240:3" -->[CrossRef][ISI][Medline] <!-- /HIGHWIRE --><!-- null --><LI value=4>Schwarz, D. S., Hutvagner, G., Haley, B. & Zamore, P. D. (2002) Mol. Cell 10, 537?548.<!-- HIGHWIRE ID="101:49:17240:4" -->[ISI][Medline] <!-- /HIGHWIRE --><!-- null --><LI value=5>Hammond, S. M., Boettcher, S., Caudy, A. A., Kobayashi, R. & Hannon, G. J. (2001) Science 293, 1146?1150.<!-- HIGHWIRE ID="101:49:17240:5" --><NOBR>[Abstract/Free Full Text]</NOBR><!-- /HIGHWIRE --><!-- null --> <LI value=6>Pham, J. W., Pellino, J. L., Lee, Y. S., Carthew, R. W. & Sontheimer, E. J. (2004) Cell 117, 83?94.<!-- HIGHWIRE ID="101:49:17240:6" -->[CrossRef][ISI][Medline] <!-- /HIGHWIRE --><!-- null --><LI value=7>Kasschau, K. D. & Carrington, J. C. (1998) Cell 95, 461?470.<!-- HIGHWIRE ID="101:49:17240:7" -->[ISI][Medline] <!-- /HIGHWIRE --><!-- null --><LI value=8>Roth, B. M., Pruss, G. J. & Vance, V. B. (2004) Virus Res. 102, 97?108.<!-- HIGHWIRE ID="101:49:17240:8" -->[CrossRef][ISI][Medline] <!-- /HIGHWIRE --><!-- null --><LI value=9>Silhavy, D., Molnar, A., Lucioli, A., Szittya, G., Hornyik, C., Tavazza, M. & Burgyan, J. (2002) EMBO J. 21, 3070?3080.<!-- HIGHWIRE ID="101:49:17240:9" --><NOBR>[Abstract/Free Full Text]</NOBR><!-- /HIGHWIRE --><!-- null --> <LI value=10>Li, H., Li, W. X. & Ding, S. W. (2002) Science 296, 1319?1321.<!-- HIGHWIRE ID="101:49:17240:10" --><NOBR>[Abstract/Free Full Text]</NOBR><!-- /HIGHWIRE --><!-- null --> <LI value=11>Li, W. X., Li, H., Lu, R., Li, F., Dus, M., Atkinson, P., Brydon, E. W., Johnson, K. L., Garcia-Sastre, A., Ball, L. A. et al. (2004) Proc. Natl. Acad. Sci. USA 101, 1350?1355.<!-- HIGHWIRE ID="101:49:17240:11" --><NOBR>[Abstract/Free Full Text]</NOBR><!-- /HIGHWIRE --><!-- null --> <LI value=12>Blandin, S., Moita, L. F., Kocher, T., Wilm, M., Kafatos, F. C. & Levashina, E. A. (2002) EMBO Rep. 3, 852?856.<!-- HIGHWIRE ID="101:49:17240:12" --><NOBR>[Abstract/Free Full Text]</NOBR><!-- /HIGHWIRE --><!-- null --> <LI value=13>Levashina, E. A., Moita, L. F., Blandin, S., Vriend, G., Lagueux, M. & Kafatos, F. C. (2001) Cell 104, 709?718.<!-- HIGHWIRE ID="101:49:17240:13" -->[CrossRef][ISI][Medline] <!-- /HIGHWIRE --><!-- null --><LI value=14>Brown, A. E., Crisanti, A. & Catteruccia, F. (2003) J. Exp. Biol. 206, 1817?1823.<!-- HIGHWIRE ID="101:49:17240:14" --><NOBR>[Abstract/Free Full Text]</NOBR><!-- /HIGHWIRE --><!-- null --> <LI value=15>Attardo, G. M., Higgs, S., Klingler, K. A., Vanlandingham, D. L. & Raikhel, A. S. (2003) Proc. Natl. Acad. Sci. USA 100, 13374?13379.<!-- HIGHWIRE ID="101:49:17240:15" --><NOBR>[Abstract/Free Full Text]</NOBR><!-- /HIGHWIRE --><!-- null --> <LI value=16>Adelman, Z. N., Blair, C. D., Carlson, J. O., Beaty, B. J. & Olson, K. E. (2001) Insect Mol. Biol. 10, 265?273.<!-- HIGHWIRE ID="101:49:17240:16" -->[CrossRef][ISI][Medline] <!-- /HIGHWIRE --><!-- null --><LI value=17>Adelman, Z. N., Sanchez-Vargas, I., Travanty, E. A., Carlson, J. O., Beaty, B. J., Blair, C. D. & Olson, K. E. (2002) J. Virol. 76, 12925?12933.<!-- HIGHWIRE ID="101:49:17240:17" --><NOBR>[Abstract/Free Full Text]</NOBR><!-- /HIGHWIRE --><!-- null --> <LI value=18>Blandin, S., Shiao, S. H., Moita, L. F., Janse, C. J., Waters, A. P., Kafatos, F. C. & Levashina, E. A. (2004) Cell 116, 661?670.<!-- HIGHWIRE ID="101:49:17240:18" -->[CrossRef][ISI][Medline] <!-- /HIGHWIRE --><!-- null --><LI value=19>Osta, M. A., Christophides, G. K. & Kafatos, F. C. (2004) Science 303, 2030?2032.<!-- HIGHWIRE ID="101:49:17240:19" --><NOBR>[Abstract/Free Full Text]</NOBR><!-- /HIGHWIRE --><!-- null --> <LI value=20>Hoa, N. T., Keene, K. M., Olson, K. E. & Zheng, L. (2003) Insect Biochem. Mol. Biol. 33, 949?957.<!-- HIGHWIRE ID="101:49:17240:20" -->[CrossRef][ISI][Medline] <!-- /HIGHWIRE --><!-- null --><LI value=21>Corbet, P. S., Williams, M. C. & Gillett, J. D. (1961) Trans. R. Soc. Trop. Med. Hyg. 55, 463?480.<!-- HIGHWIRE ID="101:49:17240:21" -->[CrossRef][Medline] <!-- /HIGHWIRE --><!-- null --><LI value=22>Williams, M. C. & Woodall, J. P. (1961) Trans. R. Soc. Trop. Med. Hyg. 55, 135?141.<!-- HIGHWIRE ID="101:49:17240:22" -->[CrossRef]<!-- /HIGHWIRE --><!-- null --> <LI value=23>Williams, M. C. & Woodall, J. P. (1965) Trans. R. Soc Trop. Med. Hyg. 59, 300?306.<!-- HIGHWIRE ID="101:49:17240:23" -->[CrossRef][ISI][Medline] <!-- /HIGHWIRE --><!-- null --><LI value=24>Lanciotti, R. S., Ludwig, M. L., Rwaguma, E. B., Lutwama, J. J., Kram, T. M., Karabatsos, N., Cropp, B. C. & Miller, B. R. (1998) Virology 252, 258?268.<!-- HIGHWIRE ID="101:49:17240:24" -->[CrossRef][ISI][Medline] <!-- /HIGHWIRE --><!-- null --><LI value=25>Strauss, J. H. & Strauss, E. G. (1994) Microbiol. Rev. 58, 491?562.<!-- HIGHWIRE ID="101:49:17240:25" -->[ISI][Medline] <!-- /HIGHWIRE --><!-- null --><LI value=26>Strauss, E. G., Rice, C. M. & Strauss, J. H. (1984) Virology 133, 92?110.<!-- HIGHWIRE ID="101:49:17240:26" -->[ISI][Medline] <!-- /HIGHWIRE --><!-- null --><LI value=27>Sawicki, D. L. & Sawicki, S. G. (1994) Arch. Virol. Suppl. 9, 393?405.<!-- HIGHWIRE ID="101:49:17240:27" -->[Medline] <!-- /HIGHWIRE --><!-- null --><LI value=28>Barton, D. J., Sawicki, S. G. & Sawicki, D. L. (1991) J. Virol. 65, 1496?1506.<!-- HIGHWIRE ID="101:49:17240:28" -->[ISI][Medline] <!-- /HIGHWIRE --><!-- null --><LI value=29>Brault, A. C., Foy, B. D., Myles, K. M., Higgs, S., Weaver, S. C., Olson, K. E., Miller, B. R. & Powers, A. M. (2004) Mol. Biol., in press.<!-- HIGHWIRE ID="101:49:17240:29" --><!-- /HIGHWIRE --><!-- null --> <LI value=30>Foy, B. D., Myles, K. M., Pierro, D. J., Sanchez-Vargas, I., Uhlirova, M., Jindra, M., Beaty, B. J. & Olson, K. E. (2004) Insect Mol. Biol. 13, 89?100.<!-- HIGHWIRE ID="101:49:17240:30" -->[ISI][Medline] <!-- /HIGHWIRE --><!-- null --><LI value=31>Myles, K. M., Pierro, D. J. & Olson, K. E. (2003) J. Virol. 77, 8872?8881.<!-- HIGHWIRE ID="101:49:17240:31" --><NOBR>[Abstract/Free Full Text]</NOBR><!-- /HIGHWIRE --><!-- null --> <LI value=32>Bowers, D. F., Abell, B. A. & Brown, D. T. (1995) Virology 212, 1?12.<!-- HIGHWIRE ID="101:49:17240:32" -->[CrossRef][ISI][Medline] <!-- /HIGHWIRE --><!-- null --><LI value=33>Weaver, S. C., Scherer, W. F., Cupp, E. W. & Castello, D. A. (1984) Am. J. Trop. Med. Hyg. 33, 953?960.<!-- HIGHWIRE ID="101:49:17240:33" -->[ISI][Medline] <!-- /HIGHWIRE --><!-- null --><LI value=34>Shope, R. E. (1985) in Virology, ed. Fields, B. N. (Raven, New York), Vol. 3, pp. 931?951.<!-- HIGHWIRE ID="101:49:17240:34" --><!-- /HIGHWIRE --><!-- null --> <LI value=35>Carmell, M. A., Xuan, Z., Zhang, M. Q. & Hannon, G. J. (2002) Genes Dev. 16, 2733?2742.<!-- HIGHWIRE ID="101:49:17240:35" --><NOBR>[Free Full Text]</NOBR><!-- /HIGHWIRE --><!-- null --> <LI value=36>Williams, R. W. & Rubin, G. M. (2002) Proc. Natl. Acad. Sci. USA 99, 6889?6894.<!-- HIGHWIRE ID="101:49:17240:36" --><NOBR>[Abstract/Free Full Text]</NOBR><!-- /HIGHWIRE --><!-- null --> <LI value=37>Lowenberger, C. (2001) Insect Biochem. Mol. Biol. 31, 219?229.<!-- HIGHWIRE ID="101:49:17240:37" -->[CrossRef][ISI][Medline] <!-- /HIGHWIRE --><!-- null --><LI value=38>Gorman, M. J. & Paskewitz, S. M. (2001) Insect Biochem. Mol. Biol. 31, 257?262.<!-- HIGHWIRE ID="101:49:17240:38" -->[CrossRef][ISI][Medline] <!-- /HIGHWIRE --><!-- null --><LI value=39>Christophides, G. K., Zdobnov, E., Barillas-Mury, C., Birney, E., Blandin, S., Blass, C., Brey, P. T., Collins, F. H., Danielli, A., Dimopoulos, G., et al. (2002) Science 298, 159?165.<!-- HIGHWIRE ID="101:49:17240:39" --><NOBR>[Abstract/Free Full Text]</NOBR><!-- /HIGHWIRE --><!-- null --> <LI value=40>Kumar, S., Christophides, G. K., Cantera, R., Charles, B., Han, Y. S., Meister, S., Dimopoulos, G., Kafatos, F. C. & Barillas-Mury, C. (2003) Proc. Natl. Acad. Sci. USA 100, 14139?14144.<!-- HIGHWIRE ID="101:49:17240:40" --><NOBR>[Abstract/Free Full Text]</NOBR><!-- /HIGHWIRE --><!-- null --> <LI value=41>Scott, T. W. & Burrage, T. G. (1984) Am. J. Trop. Med. Hyg. 33, 961?964.<!-- HIGHWIRE ID="101:49:17240:41" -->[ISI][Medline] <!-- /HIGHWIRE --><!-- null --><LI value=42>Weaver, S. C. (1986) Am. J. Trop. Med. Hyg. 35, 624?631.<!-- HIGHWIRE ID="101:49:17240:42" -->[ISI][Medline] <!-- /HIGHWIRE --><!-- null --><LI value=43>Kamath, R. S. & Ahringer, J. (2003) Methods 30, 313?221.<!-- HIGHWIRE ID="101:49:17240:43" -->[CrossRef][ISI][Medline] <!-- /HIGHWIRE --><!-- null -->
  2. Kennedy, S., Wang, D. & Ruvkun, G. (2004) Nature 427, 645?649.<!-- HIGHWIRE ID="101:49:17240:44" -->[CrossRef][ISI][Medline] <!-- /HIGHWIRE -->
 
Table 1

Table 1

Table 1. Primer pairs for amplification of dsRNA template from A. gambiae


<TABLE border=0><TBODY><TR><TD><TABLE cellSpacing=10 cellPadding=0 width="100%"><TBODY><TR><TD colSpan=3><HR noShade SIZE=1></TD></TR><TR><TD vAlign=bottom align=left>Target gene


<HR noShade SIZE=1></TD><TD vAlign=bottom align=middle>Forward primer, 5'-3'


<HR noShade SIZE=1></TD><TD vAlign=bottom align=middle>Reverse primer, 5'-3'


<HR noShade SIZE=1></TD></TR><TR><TD vAlign=top align=left>Ago1 </TD><TD vAlign=top align=left>GCAGGTGTCCCTGTTCAACCT </TD><TD vAlign=top align=left>GGTTTGGCCGTTCTCTAGCTG </TD></TR><TR><TD vAlign=top align=left>Ago2 </TD><TD vAlign=top align=left>GCATGAGCACGCTCAACAAC </TD><TD vAlign=top align=left>GTTCGAGTCGTCGTACAGCA </TD></TR><TR><TD vAlign=top align=left>Ago3 </TD><TD vAlign=top align=left>GTGTGGCATTGACACGTACC </TD><TD vAlign=top align=left>GCTCAGCTGCTGCAGAATGTC </TD></TR><TR><TD vAlign=top align=left>Ago4 </TD><TD vAlign=top align=left>GCGACTTCCTCAACTGCATGA </TD><TD vAlign=top align=left>GTGTTGAGCGGCAGATAGTTG </TD></TR><TR><TD vAlign=top align=left>Ago5 </TD><TD vAlign=top align=left>GACAAGTCGCTCTCGTACGGT </TD><TD vAlign=top align=left>GTCTCGTCGAAGATCACGTTG </TD></TR><TR><TD vAlign=top align=left>ONNV nsp3 </TD><TD vAlign=top align=left>CATGTGGCCAAAACAAACTG </TD><TD vAlign=top align=left>CGAATTTGCGTACATTGGTG </TD></TR><TR><TD vAlign=bottom align=left>
beta.gif
-gal


<HR noShade SIZE=1></TD><TD vAlign=bottom align=left>GGTCGCCAGCGGCACCGCGCCTTC


<HR noShade SIZE=1></TD><TD vAlign=bottom align=left>GCCGGTAGCCAGCGCGGATCATCGG
<HR noShade SIZE=1></TD></TR></TBODY></TABLE></TD></TR></TBODY></TABLE>
 
Figure 1

Figure 1

zpq0460464610001.jpeg



Fig. 1. Design and characterization of recombinant ONNV-eGFP. (A) p5'dsONNVic/Foy contains a full-length cDNA of the ONNV genome with a second subgenomic promoter inserted 3' of the original subgenomic promoter. eGFP was cloned into the MCS and is transcribed under control of the first subgenomic promoter. (B) Characterization of viral transcripts of ONNV after injection into adult female A. gambiae. Lanes 1 and 2 show the ONNV-eGFP transcript profile at 48 and 72 h after infection, respectively. The blot was hybridized by using a radiolabeled ONNV E2 gene as probe, and it shows the production of the full-length genomic and two subgenomic transcripts. (C) eGFP expression at 9 dpi occurs throughout the body.
 
Figure 4

Figure 4



Fig. 4. Northern blot analysis of AgAgo2 mRNA after injection of mosquitoes with ONNV-eGFP, dsRNA, or dsRNA and ONNV-eGFP. Injection of dsAgAgo2 results in the reduction of Ago2 transcript levels. Mosquitoes injected with dsAgAgo2 and virus showed partial recovery of the Ago2 mRNA accumulation. (Upper) Lane 1, mock injected; lane 2, ds
beta.gif
gal at 3 dpi; lane 3, dsAgAgo2 at 3 dpi; lane 4, dsAgAgo2 + ONNV-eGFP 3 at dpi; lane 5, ONNV-eGFP 2 dpi; and lane 6, ONNV-eGFP 3 dpi. (Lower) Ethidium bromide stain of Northern blot showing ribosomal RNA in each lane and verifying that equivalent amounts of total RNA were added to each lane.
 
Table 2

Table 2

Table 2. Dissemination of 5' dsONNic-Foy/eGFP after injection in A. gambiae
<TABLE border=0><TBODY><TR><TD><TABLE cellSpacing=10 cellPadding=0 width="100%"><TBODY><TR><TD colSpan=5><HR noShade SIZE=1></TD></TR><TR><TD vAlign=top align=left></TD><TD vAlign=bottom align=middle colSpan=2>Head
<HR noShade SIZE=1></TD><TD vAlign=bottom align=middle>Thorax and abdomen
<HR noShade SIZE=1></TD></TR><TR><TD vAlign=bottom align=left>dpi
<HR noShade SIZE=1></TD><TD vAlign=bottom align=middle>GFP, %
<HR noShade SIZE=1></TD><TD vAlign=bottom align=middle>IFA, %
<HR noShade SIZE=1></TD><TD vAlign=bottom align=middle>pfu (log<SUB>10</SUB>)
<HR noShade SIZE=1></TD></TR><TR><TD vAlign=top align=left>3 </TD><TD vAlign=top align=middle>24 (12/50) </TD><TD vAlign=top align=middle>24 (12/50) </TD><TD vAlign=top align=middle>2.1 </TD></TR><TR><TD vAlign=top align=left>6 </TD><TD vAlign=top align=middle>33 (16/49) </TD><TD vAlign=top align=middle>30 (15/50) </TD><TD vAlign=top align=middle>1.7 </TD></TR><TR><TD vAlign=bottom align=left>9
<HR noShade SIZE=1></TD><TD vAlign=bottom align=middle>52 (26/50)
<HR noShade SIZE=1></TD><TD vAlign=bottom align=middle>68 (34/50)
<HR noShade SIZE=1></TD><TD vAlign=bottom align=middle>2.3
<HR noShade SIZE=1></TD></TR></TBODY></TABLE></TD></TR></TBODY></TABLE>
<!-- tblfn -->IFA, immunofluorescence assay.
 
Figure 2

Figure 2



Fig. 2. eGFP expression at 3 dpi in mosquitoes coinjected with dsRNAs and ONNV-eGFP. (A) Coinjection of ONNV-eGFP and dsnsP3. (B) Coinjection of ONNV-eGFP and ds
beta.gif
gal. (C) Coinjection of ONNV-eGFP and dsAgAgo2. Mosquitoes injected with dsnsP3 show a dramatic reduction in eGFP expression when compared with ds
beta.gif
gal-injected controls, whereas mosquitoes injected with dsAgAgo2 show an increase in eGFP expression over controls.
 
Table 3

Table 3

Table 3. Percentage of injected mosquitoes displaying eGFP expression in body tissues after coinjection of ONNV-eGFP and dsnsP3 or dsAgAgo2 at 3 and 6 dpi
<TABLE border=0><TBODY><TR><TD><TABLE cellSpacing=10 cellPadding=0 width="100%"><TBODY><TR><TD colSpan=11><HR noShade SIZE=1></TD></TR><TR><TD vAlign=top align=left></TD><TD vAlign=bottom align=middle colSpan=3>3 dpi
<HR noShade SIZE=1></TD><TD vAlign=bottom align=middle colSpan=3>6 dpi
<HR noShade SIZE=1></TD></TR><TR><TD vAlign=bottom align=left>Treatment
<HR noShade SIZE=1></TD><TD vAlign=bottom align=middle>Head
<HR noShade SIZE=1></TD><TD vAlign=bottom align=middle>Thorax
<HR noShade SIZE=1></TD><TD vAlign=bottom align=middle>Abdomen
<HR noShade SIZE=1></TD><TD vAlign=bottom align=middle>Head
<HR noShade SIZE=1></TD><TD vAlign=bottom align=middle>Thorax
<HR noShade SIZE=1></TD><TD vAlign=bottom align=middle>Abdomen
<HR noShade SIZE=1></TD></TR><TR><TD vAlign=top align=left>ONNV-eGFP + no dsRNA </TD><TD vAlign=top align=left>10% (4/40) </TD><TD vAlign=top align=right>85% (34/40) </TD><TD vAlign=top align=middle>0% (0/40) </TD><TD vAlign=top align=right>36% (14/44) </TD><TD vAlign=top align=right>93% (41/44) </TD><TD vAlign=top align=middle>20% (9/44) </TD></TR><TR><TD vAlign=top align=left>ONNV-eGFP + ds
beta.gif
gal </TD><TD vAlign=top align=left>34% (20/58) </TD><TD vAlign=top align=right>86% (50/58) </TD><TD vAlign=top align=middle>34% (20/58) </TD><TD vAlign=top align=right>57% (30/53) </TD><TD vAlign=top align=right>89% (47/53) </TD><TD vAlign=top align=middle>57% (30/53) </TD></TR><TR><TD vAlign=top align=left>ONNV-eGFP + dsnsP3 </TD><TD vAlign=top align=left>23% (12/52) </TD><TD vAlign=top align=right>38% (20/52) </TD><TD vAlign=top align=middle>0% (0/52) </TD><TD vAlign=top align=right>36% (20/55) </TD><TD vAlign=top align=right>71% (39/55) </TD><TD vAlign=top align=middle>16% (9/55) </TD></TR><TR><TD vAlign=bottom align=left>ONNV-eGFP + dsAgAgo2
<HR noShade SIZE=1></TD><TD vAlign=bottom align=left>98% (62/63)
<HR noShade SIZE=1></TD><TD vAlign=bottom align=right>100% (63/63)
<HR noShade SIZE=1></TD><TD vAlign=bottom align=middle>97% (61/63)
<HR noShade SIZE=1></TD><TD vAlign=bottom align=right>100% (36/36)
<HR noShade SIZE=1></TD><TD vAlign=bottom align=right>100% (36/36)
<HR noShade SIZE=1></TD><TD vAlign=bottom align=middle>100% (36/36)
<HR noShade SIZE=1></TD></TR></TBODY></TABLE></TD></TR></TBODY></TABLE>
 
Figure 3

Figure 3



Fig. 3. Viral titers of ONNV-eGFP in mosquitoes coinjected with dsRNA homologous to ONNV nsP3 and AgAgo2. Compared with the nonspecific ds
beta.gif
gal, mosquitoes coinjected with virus and dsnsP3 had statistically significant decreases in infection at both 3 and 6 dpi (P < 0.0001). Viral titers of ONNV-eGFP increased significantly in mosquitoes at 3 and 6 dpi after coinjection with dsRNAs homologous with AgAgo2 (P < 0.0001 and P = 0.0006 at 3 and 6 dpi, respectively).
 
Figure 5

Figure 5



Fig. 5. Viral titers of ONNV-eGFP in mosquitoes at 3 and 6 dpi after coinjection of dsRNA homologous to AgAgo1, AgAgo3, AgAgo4, and AgAgo5. Compared with the nonspecific ds
beta.gif
gal, only mosquitoes coinjected with virus and dsAgAgo3 had statistically significant increases at 3 and 6 dpi (P
le.gif
0.0141).
 
Back
Top Bottom