• FluTrackers.com Inc. does not provide medical advice. Information on this web site is collected from various internet resources, and the FluTrackers board of directors makes no warranty to the safety, efficacy, correctness or completeness of the information posted on this site by any author or poster. The information collated here is for instructional and/or discussion purposes only and is NOT intended to diagnose or treat any disease, illness, or other medical condition. Every individual reader or poster should seek advice from their personal physician/healthcare practitioner before considering or using any interventions that are discussed on this website. By continuing to access this website you agree to consult your personal physican before using any interventions posted on this website, and you agree to hold harmless FluTrackers.com Inc., the board of directors, the members, and all authors and posters for any effects from use of any medication, supplement, vitamin or other substance, device, intervention, etc. mentioned in posts on this website, or other internet venues referenced in posts on this website.
  • We are not asking for any donations. Do not donate to any entity who says they are raising funds for us.

New Study Finds Wild Pikas Are Natural Mammalian Hosts To H5N1 Avian Influenza Virus

Re: New Study Finds Wild Pikas Are Natural Mammalian Hosts To H5N1 Avian Influenza Virus

Thanks to you AlaskaDenise for your welcome, and thanks Dutchy for your comments. :tiphat:

Hopefully someone will tip off the right people in Canada and Alaska will get samples from pikas there, as well as from eagles and bears to see if they've dined upon infected pikas. If so, the spread by migratory birds and then via poop vectors or prey ingestion contaminates other wild mammal populations and this increases the distribution of the virus from the wild animals to domestic animals and thus also contributes to evolution away from poultry vaccines serving to renew infections among poultry by providing the virus with an ever-present wild reservoirs that we can't eradicate. The contiguous placement of bird nests and pika nests highlights how a bird-to-mammal vector may enhance viral fitness for swine, so news of widespread pika populations carrying H5N1 would almost certainly indicate acceleration of the spread and widening transmission of H5N1 into a swine-fit strain and then ultimately into a human pathogen capable of pandemic H2H2H spreading.
Question: Is there being undertaken any widespread testing of swine for H5N1 as well as H1N1 in Canadian pikas and bears? And if there is, how readily available is the sequence data? How timely? It will take cohesion, timely responsiveness to quickly provide data to those who can determine which recombinants would be ideal candidates for rapid vaccine production.

I'm glad someone likes pikas, hooray for Japan :applause: And for all who love animals.
 
Re: New Study Finds Wild Pikas Are Natural Mammalian Hosts To H5N1 Avian Influenza Virus

And thank you Florida1 for the big cheerful welcome too :tiphat:

You and the team here at FluTrackers have done a great job and kept me busy reading all your work for these past years. Thank you again for the effort. I do appreciate all you good folks so much. :applause:
 
Re: New Study Finds Wild Pikas Are Natural Mammalian Hosts To H5N1 Avian Influenza Virus

I think any flu (human,swine,avian) in Canadian mammals other
then humans,pigs,horses would be a "sensation"
and has being searched for unsuccessfully.
No bear ever found with flu, this is the first time it was
found in rodent-like animals in nature.
 
Re: New Study Finds Wild Pikas Are Natural Mammalian Hosts To H5N1 Avian Influenza Virus

I updated the mutation table in #22 with more viruses.
http://www.flutrackers.com/forum/showpost.php?p=286352
(selected from the list of close realtives to /HMK/...
in either segment)

It shows multiple reassortments with geographically distant
viruses.
And the recombination in PA : /BI/ picked a head and tail
from /HMK/

Seems that the pikas have frequent double-infections.
Or the birds in that region where they get it from
 
Re: New Study Finds Wild Pikas Are Natural Mammalian Hosts To H5N1 Avian Influenza Virus

After re-reading the events and speculation around the Qinghai Lake wild bird dieoffs in early 2005, I'd say the Chinese were wise to test ALL possible vectors. Some reports speculated that wild birds ate some of the fingerlings from the fish hatcheries in Qinghai Lake, which were fed "chicken poop" - assumed to be contaminated by H5N1.

After reading about the Pikas, I assume the Chinese scientists are reconsidering those early assumptions. If the Pikas ate some of the early dead H5N1 contaminated wild birds, the virus could spread among the pikas. In a subsequent migratory season, as the birds took a rest stop at the Qinghai Wild Bird preserve, they probably dined on H5N1-infected pikas - accounting for all the dead wild birds.

Another matter is the Pika population manipulation in the Tibetan High Plateau, which was done to preserve grazing resources for livestock. For many years they assumed the Pikas were competing for grass resources, so they were poisoned. That set off a chain reaction - Pika/birds/grass/livestock - that still hasn't been resolved. Throwing the pika ecosystem out of balance may have contributed to irregular dietary habits, leading to them acquiring H5N1. There are lots of online resources about this issue.

No matter what the Pika outcome, it goes to show that we must consider the entire ecosystem of infected animals. Remember when a Scottish scientist was going (?2005 or 2006) to Indonesia to study H5N1 infected cats - remember Arrggghhh Plunk? He was going to look at poultry, birds, and cats. Some of us flubies speculated that he should test mice and even rats (prevalent in Jakarta). Scientists often refer to missing links or reservoirs, yet there is not thorough testing. Maybe that will change now.

.
 
Re: New Study Finds Wild Pikas Are Natural Mammalian Hosts To H5N1 Avian Influenza Virus

wasn't it Dutch who went to Indo for cats ?

The Qinghai-lake sequences are explained without the pikas.
(else we would have been wondering about missing links,
as we are now with newflu)

The pikas got sequences from different strains and created
crazy reassortments and maybe a recombination, which were
not seen elsewhere.
So I assume the pika-viruses are not (or rarely) being transported to
other places.
 
Re: New Study Finds Wild Pikas Are Natural Mammalian Hosts To H5N1 Avian Influenza Virus

gsgs said:
...this is the first time it was
found in rodent-like animals in nature.
Click to expand...

Pika is a rabbit-relative, not rodent.
(they even have a fluffy stubby tail hiding in their fur)

So we cannot apply conclusions from mice. :(

.
 
Re: New Study Finds Wild Pikas Are Natural Mammalian Hosts To H5N1 Avian Influenza Virus

Dutchy said:
Nigeria makes sense: H5N1 outbreak suspected to be related with imported live poultry (chicks) from China.
Click to expand...

but no such poultry viruses were found in China.
Looks more like the pikas got it from Nigeria.
 
Re: New Study Finds Wild Pikas Are Natural Mammalian Hosts To H5N1 Avian Influenza Virus

gsgs said:
I think any flu (human,swine,avian) in Canadian mammals other
then humans,pigs,horses would be a "sensation"
and has being searched for unsuccessfully.
No bear ever found with flu, this is the first time it was
found in rodent-like animals in nature.
Click to expand...

I can't speak for Canada, but I doubt many of the 112 mammal species have been tested for influenza here. I'd look at: lynx, coyotes, wolves, fox, mice/voles/shrews/pikas, hares, wolverines, martens, mink, & bears.

.
 
Re: New Study Finds Wild Pikas Are Natural Mammalian Hosts To H5N1 Avian Influenza Virus

Since the Pika samples were taken in 2007, I looked at it's HA and the HA from miratory birds that went through nearby countries. The pikas had picked up genes from most of them. Looks like recombination again.

ABF84066 A/chicken/Afghanistan/1207/2006(H5N1)
ACU24756 A/chicken/Bangladesh/FDIL(J)32/2007(H5N1)
ACU24774 A/chicken/Bangladesh/394/2007(H5N1)
ACU24775 A/chicken/Bangladesh/376/2007(H5N1)
ACU24777 A/chicken/Bangladesh/363/2007(H5N1)
ACN39415 A/chicken/Hunan/1793/2007(H5N1)
ACN39419 A/chicken/Hubei/2856/2007(H5N1)
ACN39420 A/duck/Hubei/2911/2007(H5N1)
ACN39421 A/chicken/Hubei/3002/2007(H5N1)
ACO83271 A/plateau pika/Qinghai/04/2007(H5N1)
ACT31467 A/pika/Qinghai/BI/2007(H5N1)
ACT31500 A/pika/Qinghai/SHK/2007(H5N1)
ACT31478 A/pika/Qinghai/HMH/2007(H5N1)
ACT31496 A/pika/Qinghai/GRL/2007(H5N1)
ACT31511 A/pika/Qinghai/QW/2007(H5N1)
ACN37879 A/chicken/Manipur/NIV9743/2007(H5N1) - India
ACI87705 A/chicken/Astana/6/2005(H5N1) - Kazakhstan
ACJ24139 A/swan/Mangystau/3/2006(H5N1) - "
BAH03520 A/chicken/Hmawbi/517/2007(H5N1) - Myanmar
BAH03521 A/guinea fowl/North Okkalarpa/834/2007(H5N1) - Myanmar
BAH03522 A/quail/Mingalardone/866/2007(H5N1) - Myanmar

.
 
Re: New Study Finds Wild Pikas Are Natural Mammalian Hosts To H5N1 Avian Influenza Virus

here are the difference for the plateau pika to some selected
viruses (close in some segment).
No mutation table this time, since there are too many differences
in some other segments.


differences in promille of nucleotides.
The typical acquisition of differences is 3 per year.
There is evidence that in China avian or swine flu
sometimes survives for years without mutating.
See this thread:
http://www.flutrackers.com/forum/showthread.php?t=52214


Code: 
  4 >A/PlateauPika/Qinghai/04/2007/04/19(H5N1)     
  1:  5, 14,  1,401,  5,468, 15,  0   A/Sw/Shandong/fNY/2003(H9N2)
  2:  6,  7,  7,399,  1,466,  4,  1   A/SilkyCk/Shantou/1818/2000(H9N2)
  3:  5,  5,  6,402,  1,460,  5,  0   A/Ck/Shantou/212/2000(H9N2)
  4:  0,  0,  0,  0,  0,  0,  0,  0   A/PlateauPika/Qinghai/04/2007/04/19(H5N1)
  5:  3,  3,  2,  4, 49,  4,  2,  0   A/Dk/Fujian/19/2000(H5N1)
  6: 10,  7, 47,  2, 14,  2, 21,  0   A/Ck/Hubei/wn/2003(H5N1)
  7:  8,  4,  3,  4,  1,  4,  4,  0   A/Sw/Shandong/2/2003(H5N1)
  8:  8, 30,  4,  4,  1,  2,  3,  7   A/Environment/Qinghai/1/2008/06/12(H5N1)
  9:  0,  0,  0,  4,  3,  9,  0,  0   A/Ck/China/1/2002(H5N1)
 10: 67, 67, 58, 10, 37, 12, 62,288   A/Gs/Guangdong/1/1996(H5N1)
 11: 61, 62, 55, 13, 39,  8, 66,284   A/Gs/Guangdong/3/1997(H5N1)
 12: 40, 63, 56,  4, 39,  6, 67,312   A/Dk/Zhejiang/11/2000(H5N1)
 14: 51, 48, 43,  3,  7, 17, 20, 19   A/Ck/Hubei/wf/2002(H5N1)
 15: 72, 55, 78,  6, 62, 22, 54, 61   A/Ck/Hubei/wh/1997(H5N1)

 10 >A/Gs/Guangdong/1/1996(H5N1)                   
  1: 63, 75, 67,400, 28,468, 85,306   A/Sw/Shandong/fNY/2003(H9N2)
  2: 60, 69, 60,398, 41,465, 64,293   A/SilkyCk/Shantou/1818/2000(H9N2)
  3: 62, 67, 58,400, 39,457, 65,294   A/Ck/Shantou/212/2000(H9N2)
  4: 67, 67, 58, 10, 37, 12, 62,288   A/PlateauPika/Qinghai/04/2007/04/19(H5N1)
  5: 61, 68, 59,  9, 23, 12, 65,313   A/Dk/Fujian/19/2000(H5N1)
  6: 59, 73, 68,  9, 34, 10, 71,291   A/Ck/Hubei/wn/2003(H5N1)
  7: 62, 68, 57, 11, 37, 12, 65,288   A/Sw/Shandong/2/2003(H5N1)
  8: 59, 63, 59, 11, 38, 10, 68,300   A/Environment/Qinghai/1/2008/06/12(H5N1)
  9:  0,  0,  0,  9, 39, 15,  0,  0   A/Ck/China/1/2002(H5N1)
 10:  0,  0,  0,  0,  0,  0,  0,  0   A/Gs/Guangdong/1/1996(H5N1)
 11: 16, 10, 16,  4,  3,  7, 10, 10   A/Gs/Guangdong/3/1997(H5N1)
 12: 34, 12, 24, 11,  4, 10,  6,  7   A/Dk/Zhejiang/11/2000(H5N1)
 14: 56, 59, 64, 10, 36, 21, 59,285   A/Ck/Hubei/wf/2002(H5N1)
 15: 73, 76, 83, 13, 67, 27, 41,286   A/Ck/Hubei/wh/1997(H5N1)

 15 >A/Ck/Hubei/wh/1997(H5N1)                      
  1: 72, 68, 97,402, 65,468, 70, 68   A/Sw/Shandong/fNY/2003(H9N2)
  2: 72, 56, 85,400, 62,469, 54, 64   A/SilkyCk/Shantou/1818/2000(H9N2)
  3: 70, 56, 80,403, 64,460, 55, 65   A/Ck/Shantou/212/2000(H9N2)
  4: 72, 55, 78,  6, 62, 22, 54, 61   A/PlateauPika/Qinghai/04/2007/04/19(H5N1)
  5: 68, 58, 80,  7, 72, 24, 51, 69   A/Dk/Fujian/19/2000(H5N1)
  6: 66, 60, 94,  4, 62, 22, 66, 63   A/Ck/Hubei/wn/2003(H5N1)
  7: 68, 58, 78,  6, 62, 24, 57, 61   A/Sw/Shandong/2/2003(H5N1)
  8: 67, 62, 80,  7, 63, 23, 57, 72   A/Environment/Qinghai/1/2008/06/12(H5N1)
  9:  0,  0,  0,  7, 65, 28,  0,  0   A/Ck/China/1/2002(H5N1)
 10: 73, 76, 83, 13, 67, 27, 41,286   A/Gs/Guangdong/1/1996(H5N1)
 11: 73, 72, 83, 15, 67, 22, 42,282   A/Gs/Guangdong/3/1997(H5N1)
 12: 59, 72, 84,  7, 66, 25, 38,300   A/Dk/Zhejiang/11/2000(H5N1)
 14: 69, 68, 81,  5, 63, 14, 57, 65   A/Ck/Hubei/wf/2002(H5N1)
 15:  0,  0,  0,  0,  0,  0,  0,  0   A/Ck/Hubei/wh/1997(H5N1)


So, a good match in all segments, the same reasortment-type, is A/Sw/Shandong/2/2003(H5N1)

A/Environment/Qinghai/1/2008/06/12(H5N1) is a good match in segments 1,3,4,5,6,7,8
but with another PB2.


------------edit-----------
/strain="A/environment/Qinghai/1/2008"
/isolation_source="fecal sample"
/country="China: Qinghai Lake"
/collection_date="12-Jun-2008"

hmm, did it come from the plateau-pikas or vice versa ?
I don't know how to see that from the sequences
 
Re: New Study Finds Wild Pikas Are Natural Mammalian Hosts To H5N1 Avian Influenza Virus

Nothing closer in time preceeding the pika samples, than the 2003 Shandong Swine?

those differences are interesting. I also like to look at the genes that are the same, since I figure those represent the acquisition of "successful" polymorphisms - evolving into a "fit" pathogen.

I'd love to know how many years the pikas have been carrying influenza. Hopefully, the Chinese scientists are doing yearly tests. :)

.
 
Re: New Study Finds Wild Pikas Are Natural Mammalian Hosts To H5N1 Avian Influenza Virus

apparantly they didn't find any other serotypes yet and H5N1 only "exists"
since 1997.
The plateau pika could have a virus which went to pikas in 2000.
Or existed in the environment since 2000.
 
Re: New Study Finds Wild Pikas Are Natural Mammalian Hosts To H5N1 Avian Influenza Virus

OK, I just 13 related viruses, deleted some segments with many
differences, formed an index = average of those.

Here is the mutation table with all mutations, (and not only those
which occur at least twice as usual)


Code: 
                                                  00000000000000000001111111112222222222222222222 0000000000000000000000111111111111111111111111112222222 00000000011111111111111112222 00000000000000000000000000000000000111111111111111111111111 0000000000000000000000000111111111111111111 00000000000000000000000000000000000000000000011111111111111 000000000000000000000000000000000000011 0000000000000000000000 
                                                  00000000122344467990112467890112222222222233333 0001111111223444556778000011111111122333556678880000022 01344447900111111123367990122 00000000011111222334555567788888999000111111233334566667777 0000133334456666688888889111333344445555555 00000000000000011112222333333344444555566668800011233344444 000001123344555567777777888899999999900 0011137777777778888888 
                                                  01125678202218956082442446502092237778888801222 0060244459554589493096006834477788923228473870444455989 33522387728000237721909084900 01112237856789018294455965704555288446445689001272204785678 5677856997753445801345791346013901180233346 01111123456779922561445012345955789237813492205519045903444 037781594604033491122669001911355556900 0502292457778891466666 
                                                  81371657658779548210033014455090184781346727345 3405923492896765396221250613703935211295885699050958405 36779569193019490311268509901 46785890355300978796201544026014225284031291423833493903632 1928040691459581716163138764522500656102616 43567908309487812542681580716925794162479737865649502939012 414768197427536315906072169558614893905 4322569791340624335678 
-codon-position-----------------------------------221      1       2    2         1   11 1 11112   1   12    111   2      1   1   1 1 12 2      1          1 1   22  2 222     11    12 112 11 122 2 121   221211121 122111112  211 1 2221 122 12                        112     1  2      2 2  11 1212212 2 1212222 222 2122 22  222222 2 2 12 12222122 12 1122211221  122 112  12  2 1     12  1  12 22     2    1 212 1 
---Index------------------------------------------GGTTAACAGGTCTCTACTGAATTTGGAGAGGGGGAGAAAAGATGAAA CGGTAATGAAGCCATCAAAAAGAAAAATACGAAGATCAATGCTTAGAATTCCGAA CATGCGGAGCAATAAAATGATAGGTCATC ACCACATCAAACACAACGTAAAAGCGAATGAGGCCAGCAAGCTATGATGCAGGTGAATT GATGTGAAACAAAGCTAACCAACTCAAATGCTACTCTTGACAT AATTCAAGTCAAGTTTCAAGGTGCCCTGGTCCAAGCACCCACAGGAGGTCAATGTAAAA ACTGACCCGAAGGCCAAATGAGACAGAAAGGGAAATGCG ACATAGAGAGGTTAATTATGAT 
   1 >A/Gs/Guangdong/1/1996(H5N1)                 ----------------------------------------------- ------------------------------------------------------- ----------------------------- -AT..........T.GT.C.G..AT..G.......G.A...T...AC..T.......-- ------------------------------------------- ..A.T....TGGA......AA.A....A................A.A.C..G.AC.... --------------------------------------- ----------------------      270    270 ,     32     32       1:>A/Gs/Guangdong/1/1996(H5N1)                 
   2 >A/Gs/Guangdong/3/1997(H5N1)                 ----------------------------------------------- ------------------------------------------------------- ----------------------------- -.TGT........T.GT.C.G..AT..G.........AG..TC..ACC.T.....C..- ------------------------------------------- -----....T..........A..T...A.C..G...........A.A.C..G...---- --------------------------------------- ----------------------      276    276 ,     30     30       2:>A/Gs/Guangdong/3/1997(H5N1)                 
   3 >A/Dk/Zhejiang/11/2000(H5N1)                 ----------------------------------------------- ------------------------------------------------------- ----------------------------- ------.....T.....A................T.A.......C..........---- ------------------------------------------- -------A...........-AC.....................A....CT.G...---- --------------------------------------- ----------------------      269    269 ,     12     12       3:>A/Dk/Zhejiang/11/2000(H5N1)                 
   4 >A/Ck/China/1/2002(H5N1)                     ----------------------------------------------- ------------------------------------------------------- ----------------------------- ---T-GC.................................................-AA T......................C..........C...A..GG -.GATTC............-.........................G.........GTCG --------------------------------------- ----------------------      220    220 ,     21     21       4:>A/Ck/China/1/2002(H5N1)                     
   5 >A/SilkyCk/Shantou/1818/2000(H9N2)           --------------------...AA.T.C.A............---- --.C..........CT.G.G..G..T.......T.C...C--------------- --------.TG...G.G..G..AACT--- ----------------------------------------------------A------ ....................G....------------------ ----------------------------------------------------------- -........................A.......GG.--- -....A............----      226    226 ,     30     30       5:>A/SilkyCk/Shantou/1818/2000(H9N2)           
   6 >A/Ck/Shantou/212/2000(H9N2)                 ----.........A......G....A.T...A...........---- --.............T.G....G............C......CC..C.CC..A.. T.C..AA....G....GCAG..A..T--- ----------------------------------------------------A------ ...........................C.T............. ----------------------------------------------------------- -.....TT.........................GG.--- -.................----      172    172 ,     33     33       6:>A/Ck/Shantou/212/2000(H9N2)                 
   7 >A/Dk/Fujian/19/2000(H5N1)                   ----............T....A.....................---- --..........A..........G................A..C...G.C....G .C..T.A......G......C.....--- ------..............G.G..........T.....G........A......---- ------------------------------------------- -------A.....CC....-...................T...............---- -.......A..............---------------- -.....----------------      136    136 ,     24     24       7:>A/Dk/Fujian/19/2000(H5N1)                   
   8 >A/PlateauPika/Qinghai/04/2007/04/19(H5N1)   CTACC....A....G...A................TT.G....CGGG ....G....................................T............. ...T...G.....G............... .........G......................A.......................C.. ........................................... .G......C..........-......................G................ ..........G............................ ......................       28     28 ,     27     27       8:>A/PlateauPika/Qinghai/04/2007/04/19(H5N1)   
   9 >A/Sw/Shandong/2/2003(H5N1)                  ..........C......C.G..C........................ .A..G...........T...GA..G..........CTGG................ ........A...C..G.....G....... ........G...G............T..C...........A.................. ......G..................G................. ...............C...-.............G................G........ .........G...T..G..........G........... ......................       33     33 ,     32     32       9:>A/Sw/Shandong/2/2003(H5N1)                  
  10 >A/Environment/Qinghai/1/2008/06/12(H5N1)    ----.GT.A..TG..G.................A......A.A.... ------------------------------------------------------- ........A...C..G.....G....TAT ------.......................AGA.....................CT---- ......G..................G................. -------............-..C...A................................ --..T.....G..........T.............C--- -................TATTG      117    117 ,     34     34      10:>A/Environment/Qinghai/1/2008/06/12(H5N1)    
  11 >A/Sw/Shandong/fNY/2003(H9N2)                -------G.........C...........A..C.G--T.TTG----- --------------------------.CGTAGG.G.........GA--------- -------......G.....---------- ----------------------------------------------------A------ --------------------------G..........A----- ----------------------------------------------------------- --AA-...A..CC.AT----------------------- -...............------      276    276 ,     29     29      11:>A/Sw/Shandong/fNY/2003(H9N2)                
  12 >A/Ck/Hubei/wn/2003(H5N1)                    .....GT.A..TG..G.................A......A.A.... G.AC.TATGTCT.T....T.......T.......................GT.G. ----------------------------- ............G.............................................. .GCAAA.GGTGGGATCGGAT.GT.........G.......A.. ...................-....................................... --------------------------------------- ......................      117    117 ,     48     48      12:>A/Ck/Hubei/wn/2003(H5N1)                    
  13 >A/Ck/Hubei/wh/1997(H5N1)                    ----------------------------------------------- ------------------------------------------------------- ----------------------------- G......T....G.G....G.C....T................C......G........ ------------------------------------------- ----------------------------------------------------------- --------------------------------------- ----------------------      303    303 ,      9      9      13:>A/Ck/Hubei/wh/1997(H5N1)                    
  14 >A/Ck/Hubei/wf/2002(H5N1)                    ----------------------------------------------- ------------------------------------------------------- ----------------------------- ---------.T.T......................................A....... ...A....................T...C.TCGT.TC..TG.. G.......C.......TGG.A..TTT.AA.TT..ATGTT.CT....AA...GC...... GT...T...........GCAC.GTC.C.GAAAG.G.ATA GTGCT.GAGAACCGGCC..A..      215    215 ,     75     75      14:>A/Ck/Hubei/wf/2002(H5N1)                    
  15 >Index                                       ............................................... ....................................................... ............................. ........................................................... ........................................... ........................................................... ....................................... ......................        0      0 ,      0      0      15:>Index


the Qinghai-lake environment sample from 2008
exactly matches the Ck/Hubei/wn from 2003 in PB2 !
Also close match in HA and NA.
While PA is very close to the swine in Shandong from 2003.

You have to wonder, how flu spreads in China in birds and swine !


--------edit-----------
better table:

Code: 
                                            00000000000000000001111111112222222222222222222 0000000000000111111111111111111112222222 00000000011111111111111112222 0000000000000000000000000000000000011111111111111111111111 0000000000111111111111111111 00000000000000000000000000000111111111111 00000000000000000000 000000
                                            00000000122344467990112467890112222222222233333 0113444556778000011122333556678880000022 01344447900111111123367990122 0000000001111122233455556778888899900011111123333456667777 0038888889111333344445555555 00000000000000122223333446688001123344444 00012334455556788999 388888
                                            01125678202218956082442446502092237778888801222 0024589493096006838923228473870444455989 33522387728000237721909084900 0111223785678901829445596570455528844644568900127220885678 5761345791346013901180233346 11111234567799214450349781922051904903444 77859460403349609556 966666
                                            81371657658779548210033014455090184781346727345 4596765396221250615211295885699050958405 36779569193019490311268509901 4678589035530097879620154402601422528403129142383349014743 1806163138764522500656102616 35679083094878126815719797378654950939012 47619742753631065893 635678
-codon-position-----------------------------221      1       2    2         1   11 1 11112  1  11   2      1   1 12 2      1          1 1   22  2 222     11    12 112 11 122 2 121   221211121 122111112  211 1 2221 1 12 11       112     1  2      2 2  1 1212212 2 1212 22212   2 2 121222122 12 2221221  122 112112   212 1
---Index------------------------------------GGTTAACAGGTCTCTACTGAATTTGGAGAGGGGGAGAAAAGATGAAA GTACATCAAAAAGAAAAAGATCAATGCTTAGAATTCCGAA CATGCGGAGCAATAAAATGATAGGTCATC ACCACATCAAACACAACGTAAAAGCGAATGAGGCCAGCAAGCTATGATGCAGTGAATT GGACCAACTCAAATGCTACTCTTGACAT ATTCAAGTCAAGTTTGGTGCTGTAACAGGAGTCAAGTAAAA TGACCGAAGGCCAAGGAAAT GATGAT
   1 >A/Gs/Guangdong/1/1996(H5N1)           ----------------------------------------------- ---------------------------------------- ----------------------------- -AT..........T.GT.C.G..AT..G.......G.A...T...AC..T......-- ---------------------------- .A.T....TGGA...AA.A..A......A.AC..GAC.... -------------------- ------
   2 >A/Gs/Guangdong/3/1997(H5N1)           ----------------------------------------------- ---------------------------------------- ----------------------------- -.TGT........T.GT.C.G..AT..G.........AG..TC..ACC.T....C..- ---------------------------- ----....T.......A..T.ACG....A.AC..G..---- -------------------- ------
   3 >A/Dk/Zhejiang/11/2000(H5N1)           ----------------------------------------------- ---------------------------------------- ----------------------------- ------.....T.....A................T.A.......C.........---- ---------------------------- ------A........-AC.........A...CT.G..---- -------------------- ------
   4 >A/Ck/Hubei/wf/2002(H5N1)              ----------------------------------------------- ---------------------------------------- ----------------------------- ---------.T.T......................................A...... .A.......T...C.TCGT.TC..TG.. ----------------------------------------- -------------------- ------
   5 >A/Ck/Hubei/wh/1997(H5N1)              ----------------------------------------------- ---------------------------------------- ----------------------------- G......T....G.G....G.C....T................C......G....... ---------------------------- ----------------------------------------- -------------------- ------
   6 >A/Ck/Hubei/wn/2003(H5N1)              .....GT.A..TG..G.................A......A.A.... ----T....T.......T.................GT.G. ----------------------------- ............G............................................. ---AT.GT.........G.......A.. ...............-......................... -------------------- ......
   7 >A/Env/Qinghai/1/2008/06/12(H5N1)      ----.GT.A..TG..G.................A......A.A.... ---------------------------------------- ........A...C..G.....G....TAT ------.......................AGA......................---- ..G.......G................. ------.........-..C.A.................... ..T....G......T....C .TATTG
   8 >A/Sw/Shandong/2/2003(H5N1)            ..........C......C.G..C........................ A.G....T...GA..G....CTGG................ ........A...C..G.....G....... ........G...G............T..C...........A................. ..G.......G................. ..............C-........G........G....... ......G...T..G..G... ......
   9 >Index                                 ............................................... ........................................ ............................. .......................................................... ............................ ......................................... .................... ......
  10 >A/PPika/Qinghai/04/2007/04/19(H5N1)   CTACC....A....G...A................TT.G....CGGG ..G.......................T............. ...T...G.....G............... .........G......................A......................C.. ............................ G......C.......-..........G.............. .......G............ ......
  11 >A/Ck/Shantou/212/2000(H9N2)           ----.........A......G....A.T...A...........---- -.....T.G....G......C......CC..C.CC..A.. T.C..AA....G....GCAG..A..T--- ----------------------------------------------------AT---- ............C.T............. ----------------------------------------- ...TT............GG. ..----
  12 >A/SilkyCk/Shantou/1818/2000(H9N2)     --------------------...AA.T.C.A............---- -C...CT.G.G..G..T.T.C...C--------------- --------.TG...G.G..G..AACT--- ----------------------------------------------------AT---- .....G....------------------ ----------------------------------------- ...............A.GG. A.----
  13 >A/Ck/China/1/2002(H5N1)               ----------------------------------------------- ---------------------------------------- ----------------------------- ---T-GC................................................-AA T.......C..........C...A..GG .GATTC.........-.............G.......GTCG -------------------- ------
  14 >A/Dk/Fujian/19/2000(H5N1)             ----............T....A.....................---- -..A..........G..........A..C...G.C....G .C..T.A......G......C.....--- ------..............G.G..........T.....G........A.....---- ---------------------------- ------A.....CC.-.........T...........---- .....A.........----- .-----
  15 >A/Sw/Shandong/fNY/2003(H9N2)          -------G.........C...........A..C.G--T.TTG----- -------------------G.........GA--------- -------......G.....---------- ----------------------------------------------------AT---- -----------G..........A----- ----------------------------------------- AA-..A..CC.AT------- .-----
 
Re: New Study Finds Wild Pikas Are Natural Mammalian Hosts To H5N1 Avian Influenza Virus

I assume plateau pika is from the big Qinghai high level "plateau", not from
Qinghai-lake area.
http://en.wikipedia.org/wiki/Plateau_Pika

There is permafrost, almost no travel since 2006
http://en.wikipedia.org/wiki/Qing-Zang_railway



Range Description:Ochotona curzoniae can be found throughout the Tibetan Plateau (Smith and Xie 2008). The geographic distribution extends through northern Nepal and Sikkim, India, north into Xizang, and the western regions of Sichuan, Qinghai and the southern regions of Xinjiang (Smith et al. 1990), and Gansu (CSIS 2008). It occurs at elevations of 3,000-5,000 m (Smith and Xie 2008).
Countries:Native:
China (Gansu, Qinghai, Sichuan, Tibet [or Xizang], Xinjiang); India (Sikkim); Nepal
http://www.iucnredlist.org/details/41258/0
 
Re: New Study Finds Wild Pikas Are Natural Mammalian Hosts To H5N1 Avian Influenza Virus

there is a popular game called "pikachu".
I think people may get a disease in that game called
"pika-flu" and they can spread it to others.

http://www.smashboards.com/showthread.php?t=244284



http://en.wikipedia.org/wiki/Pikachu

Collectible cards featuring Pikachu have appeared since the
initial Pokémon Trading Card Game released in October 1996,


An inability to discharge electricity, as occurs in the presence of a strong magnetic field,
causes an illness with flu-like symptoms



so, that pika-flu game was created before they found the H5N1 in pikas ?
 
Re: New Study Finds Wild Pikas Are Natural Mammalian Hosts To H5N1 Avian Influenza Virus

where is niman ?

isn't 1 week ban/suspension enough ? (for now)
 
Re: New Study Finds Wild Pikas Are Natural Mammalian Hosts To H5N1 Avian Influenza Virus

so, how did the virus(-part) come from
Nigeria, 23.Jan.2007
to
Qinghai lake region, 02.Dec.2007



A/chicken/Nigeria/1071-1/2007,EMA1/EMA2-2:6-R07,Plateau,Jan 2
A/chicken/Nigeria/1071-3/2007,EMA2,Sokoto,Jan 5
A/chicken/Nigeria/1071-4/2007,EMA1/EMA2-2:6-R07,Borno,Jan 5
A/chicken/Nigeria/1071-5/2007,EMA1/EMA2-2:6–R07,Plateau,Jan 6
A/chicken/Nigeria/1071-7/2007,EMA2,Sokoto,Jan 10
A/chicken/Nigeria/1071-9/2007,EMA1/EMA2-2:6-R07,Bauchi,Jan 12
A/chicken/Nigeria/1071-10/2007,EMA1/EMA2-2:6-R07,Anambra,Jan 13
A/chicken/Nigeria/1071-15/2007,EMA1/EMA2-2:6-R07,Kaduna,Jan 23
A/chicken/Nigeria/1071-22/2007,EMA1/EMA2-2:6-R07,Kano,Jan 31
A/duck/Nigeria/1071-23/2007,EMA1/EMA2-2:6-R07,Borno,Feb 1
A/chicken/Nigeria/1071-29/2007,EMA1/EMA2-2:6-R07,Lagos,Feb 9
A/chicken/Nigeria/1071-30/2007,EMA1/EMA2-2:6-R07,Kaduna,Feb 10

http://www.cdc.gov/eid/content/14/4/637.htm?s_cid=eid637_e
 
Re: New Study Finds Wild Pikas Are Natural Mammalian Hosts To H5N1 Avian Influenza Virus

I for one wish Niman were back. He has a great insight into these genetic changes and stabilization of clades too.
Birds...Raptors must love feeding on pikas and on other birds, and perhaps vultures/griffins could be feeding on dead pika corpses too. The eagles and falcons would also feed on migrating wild birds that move across flyways into Africa, the Middle East, and on into Asia. That would increase the chances for evolutionary changes via recombination, and birds nesting above pika dens would give the recombinants ample opportunity to become endemic to pikas and other mammals, so the simplest thesis would be one of stabilization of each new recombinant as well as stablization of early genotypes via maximizing spread to numerous host reservoirs, birds AND mammals. If H5N1 continues to evolve at this rate, perhaps there are more reservoir species as yet undetermined where H5N1 has been able to sustain itself via subliminal low-pathogenic infections and wider prevalence of recombinant forms are out there but as yet haven't been sequenced because they may not harm those hosts, whether bird, mammal or human in their current low path phenotypic expression.
It may be that H5N1 recombinants that are non-symptomatic in ducks or geese or poultry may also be non-symptomatic after the initial waves of infection kill the most susceptible in a pika or other mammals, and eventually there are so many recombinants that one will achieve high pathogenic H2H spread. If that is a product of the high rate of change under the old theories of mutation and reassortment, or whether it is as a more likely consequence of conserved recombinational forms, it's only a matter of time til we wish we were pikas, naturally immune to this pathogen.
 
You must log in or register to reply here.
Back
Top Bottom