• FluTrackers.com Inc. does not provide medical advice. Information on this web site is collected from various internet resources, and the FluTrackers board of directors makes no warranty to the safety, efficacy, correctness or completeness of the information posted on this site by any author or poster. The information collated here is for instructional and/or discussion purposes only and is NOT intended to diagnose or treat any disease, illness, or other medical condition. Every individual reader or poster should seek advice from their personal physician/healthcare practitioner before considering or using any interventions that are discussed on this website. By continuing to access this website you agree to consult your personal physican before using any interventions posted on this website, and you agree to hold harmless FluTrackers.com Inc., the board of directors, the members, and all authors and posters for any effects from use of any medication, supplement, vitamin or other substance, device, intervention, etc. mentioned in posts on this website, or other internet venues referenced in posts on this website.
  • We are not asking for any donations. Do not donate to any entity who says they are raising funds for us.

H7N9 – Discussion, April 1, 2013 to June 3, 2013 (Closed)

Status
Not open for further replies.

JJackson

In Memoriam - Senior Moderator
H7N9 ?Discussion
Firstly it is very early days and the fog of war is thick so much of the information currently available is likely to be updated.



What we do seem to know, based on the currently available data, is this is a Low Pathogenic Avian Influenza (LP AI) (see Genewurx?s analysis ) caused by a reassortment of two avian type A influenza viruses. H7N9 (which supplied the two surface proteins HA & NA and determine the antigenic response) and H9N2 (which supplied the 6 remaining RNA strands which code for all the internal proteins - see Guiseppe?s post)


At this point I would be very cautious about attributing high virulence to the virus based on ?3 cases 2 deaths? as serious illness, and deaths, lead to lab analysis of the causative agent so it is often the exceptional that get initial attention. Media reports say family contacts are now being followed and this should lead to a better understanding of the virus? human-to-human (H2H) transmission potential. Serological testing, more generally, will be needed to find out how many subclinical and Influenza Like Illness (ILI) cases there have been underlying the 3 confirmed cases. This post, written at the start of the 2009 H1N1, may help clear up some of the confusion likely to occur by the reported case numbers.


It may be helpful to review the HP/LP nature of flu at this point. H7 ? like H5 ? flus have the potential to come in both flavours. The LP form can, at any point, become HP by the addition of basic amino acids at the point of cleavage on the HA protein. This change allows a much wider range of proteases (a common type of protein that is supplied by the infected host which cuts other proteins in two). As the cleavage of HA at this point is required for the virus to infect the host?s cell this change allows infection more generally around the body not just in the lungs. The name HP comes from the effect this change has on poultry where the HP form is far more deadly but in humans this is not necessarily the case. 1918 H1N1 was not HP (no H1 are) the H5N1 which has caused deaths, in humans, is HP (but there are also LP forms circulating in birds). This link is to a paper by Ilaria Capua which has an excellent listing - in Table 1 - of all the know human zoonotic flu infections.



For Media reports see this thread

For more on the genetics see this one
 
Last edited:
Re: H7N9 ?Discussion

Re: H7N9 ?Discussion

The full, but preliminary, GeneWurx Hemagglutinin overview demonstrates significant potential for pH1N1 influencer involvement at the sub-segment level.
 
Re: H7N9 ?Discussion

Re: H7N9 ?Discussion

H9N2 Influenza Viruses Possessing H5N1-Like Internal Genomes Continue To Circulate in Poultry in Southeastern China


  1. Y. Guan1,2,<sup>?</sup>,
  2. K. F. Shortridge2,
  3. S. Krauss1,
  4. P. S. Chin2,
  5. K. C. Dyrting3,
  6. T. M. Ellis3,
  7. R. G. Webster1,2,4,<sup>*</sup>, and
  8. M. Peiris2
+ Author Affiliations

  1. <address> Department of Virology and Molecular Biology<sup>1</sup> and </address>
  2. <address> Department of Pathology,<sup>4</sup> St. Jude Children's Research Hospital, Memphis, Tennessee 38105-2794, and </address>
  3. <address> Department of Microbiology, The University of Hong Kong, Queen Mary Hospital,<sup>2</sup> and </address>
  4. <address> Department of Agriculture, Fisheries and Conservation, Castle Peak Veterinary Laboratory,<sup>3</sup> Hong Kong SAR, China </address>

ABSTRACT

The transmission of H9N2 influenza viruses to humans and the realization that the A/Hong Kong/156/97-like (H5N1) (abbreviated HK/156/97) genome complex may be present in H9N2 viruses in southeastern China necessitated a study of the distribution and characterization of H9N2 viruses in poultry in the Hong Kong SAR in 1999. Serological studies indicated that H9N2 influenza viruses had infected a high proportion of chickens and other land-based birds (pigeon, pheasant, quail, guinea fowl, and chukka) from southeastern China.

Two lineages of H9N2 influenza viruses present in the live-poultry markets were represented by A/Quail/Hong Kong/G1/97 (Qa/HK/G1/97)-like and A/Duck/Hong Kong/Y280/97 (Dk/HK/Y280/97)-like viruses. Up to 16% of cages of quail in the poultry markets contained Qa/HK/G1/97-like viruses, while about 5% of cages of other land-based birds were infected with Dk/HK/Y280/97-like viruses. No reassortant between the two H9N2 virus lineages was detected despite their cocirculation in the poultry markets. Reassortant viruses represented by A/Chicken/Hong Kong/G9/97 (H9N2) were the major H9N2 influenza viruses circulating in the Hong Kong markets in 1997 but have not been detected since the chicken slaughter in 1997.
The Qa/HK/G1/97-like viruses were frequently isolated from quail, while Dk/HK/Y280/97-like viruses were predominately associated with chickens. The Qa/HK/G1/97-like viruses were evolving relatively rapidly, especially in their PB2, HA, NP, and NA genes, suggesting that they are in the process of adapting to a new host. Experimental studies showed that both H9N2 lineages were primarily spread by the aerosol route and that neither quail nor chickens showed evidence of disease.
The high prevalence of quail infected with Qa/HK/G1/97-like virus that contains six gene segments genetically highly related to HK/156/97 (H5N1) virus emphasizes the need for surveillance of mammals including humans.



http://jvi.asm.org/content/74/20/9372.short
 
Re: H7N9 ?Discussion

Re: H7N9 ?Discussion

for virologistes :)
http://jvi.asm.org/content/81/6/2635.full
Evolution and Molecular Epidemiology of H9N2 Influenza A Viruses from Quail in Southern China, 2000 to 2005




However, the phylogenetic relationships of the NP genes suggest that a H9N2 virus, Ck/SH/F/98-like, may be a possible donor of H5N1/01-like internal genes. If this is the case, then the gene flow between those subtypes may be in the reverse direction. Furthermore, the dominant G1-like virus found in quail (genotype A3) along with all Ck/Bei-like viruses isolated in this study since 2003 all incorporate an H5N1/01-like PA gene that is also found in current H5N1 genotype Z viruses. In this regard, quail may serve as a ?mixing vessel? to facilitate reassortment events for H9N2, H5N1, and H6N1 viruses and the emergence of pandemic potential virus in this region (6, 18, 19).
 
Re: H7N9 ?Discussion

Re: H7N9 ?Discussion

http://jvi.asm.org/content/85/16/8413.full
4 groups of H9N2

G1 and Y280

Cluster D consists only of viruses from Iran (Iran-1) that, based on the HA phylogeny,
circulated from 1998 to 2007.

Viruses from Pakistan (2006 to 2008) and Afghanistan (2008 to 2009),
A/ck/Iran/10vir854-5/2008, and A/ck/Iran/10vir854-3/2009 were identified as group B.

Our analysis of the NS1 protein revealed the existence of two mutations,
at positions 92 and 227, which have previously been demonstrated to
modulate avian influenza virus pathogenicity.



new H7N9-like H9N2 genomes:

Code:
                                                          000000000000000000000000000000000000000000000011111111111111111111111111111111111111111111111111111111111111222222222 00000000000000000000000000111111111111111122222222222 00000000000000000000000000000000000011111111111111111111111111111111111111111111111111111111111222 0000000000000000000000000000000000000000000111111111111111111111 000000000000000000000000000000000000000001111111111111111111111 00000000000000000000000000000000000000011111111111111111 000000 000000000000000000000000000000000000 
                                                          000111111222333334445555666666677788888889999900000011111112222222333344555555566667777777777778888888899999000011222 01122344455555666677888899122333455667889900000111122 00001111223333344444455677788888999900000111111111222222223333334455555556666677777788888899999001 0000011111222333344455555566667777777888999001122222333344444456 011222223333344455555666677777788888999990000001111222222222334 00001111222222333344445566677788888999900000111122222333 234669 000111122222333344444445566666677777 
                                                          036012459017125690380257144566714634467781338812234600147890123578333634011338915880122457888990112378912459078805148 53433067801116333637134948158068157122061804579113507 15894677110136902369948257703479034901345013346679015677890224672601389992678801113504677900255354 0003604899166124802811477903590014567077157452502338035800569902 507556993456828811469044401134601138047782447781238011235689059 00361133012258145724470134815823489003611367344702444389 380297 167167900123338922355673713457733445 
                                                          699843465403617606594589258169814240344658361473684524600519276721238540058074043031328680258243584357973298162837110 12217357675691036422944787047259412406307913867589784 27164214143876083226802751710001998951229061764767701758795077545163040360076970394231958328109715 6788028768925272157902369330963471051769575132297174880945071793 121587249543460469044328981527873615652826171203512968494946536 69333728104828287621741652140024321063917851806467025563 478107 239481817329130003236816344656706287 
-codon-position-------------------------------------------            1    1                    1             1              1        1                1           1              1       2      1 1  1         1    1                        11  1      1    2   2          1 2        11 1      1      1      1          2      1   2   122  111  11     1  2   2  2 12                 11      11            1        1        1  1            1    1      1         2     2     2      12     2                   1  1  1    1      2   1        21 2        2 21111211111 
---Index--------------------------------------------------AGAGAGGGGGAGATTCCCCCCACTAAATAGTGGTTTGGAAGGCGTCAAAACACACACCAGCTGCGGGCTCGTTACCCTAGAAGCAGACACGCAGGGCAGCGTCCGGTAGATTCGGTA TCACGGGAGCATAGAAGCCCCGTCGGGCGCTGTTCTACCCCATGACCCGCGGG TGTGCTACTTGTAACTGCGGAGCAACATCGACGGGTCTAAGAGGGACCGGCGGGTTGCCCCGTCGCAATCAGGTGGTGGCCCTCCAATGTAGCTAAAA GACTAATACTTCTTCATCACTTACACTGCTCACGACATAACATCCATTCGACGATAAAAAGGAT GCTAAGAGAGGTTCTCTGTAACAGAGAAGGCATTTGTCTCTGCGGCTGCTAAGCTGTAATTCG TACTGGCGTTAACGCGACACATTATTGATACCCTCGTTCTCCCGGTTACCGCAAGA GTGTAA CGCGCAGAGACCGGAGAGAGTAGGAGCCGATGGATA 
   7 >A/swine/Taizhou/5/2008,2008/10/,China,H9N2          GACAG.AT.CG....TT.T.T.AC.CGCTAC.A.AAAA...A.AC.G.G.T..GT.TTG..CATAA....A...T.TA.AG...GAG..TATGAAA..ATACTTACCCTGC....CG ..C...A....GGA...........A.................A.T....... ..C.................G....T.......AA........A................A.........G...............G.........G. .................T..C...C...........G.C.................GGGG...- .T.G.......................................AA.................. ..A....................G...............C................ ..A... ...A.C..A...........................      429    112 ,    416    111       7:>A/swine/Taizhou/5/2008,2008/10/,China,H9N2          
   8 >A/pigeon/Xuzhou/1/2011,2011/01/31,China,H9N2        ..C.GAAATTGAG.CTT.TATGAC.C.CC....CAC.A...A.A..GG.C..A..G....TC.T...TC..CCG...ATA.GA.T..TG.AT.A..TG..ACT..C..A..CT.AC- .TC..A..A.GGGAGGA.T.A..TAAT.A.....TCGTT..GC..TT....T- .AC.T..T....C...ATAA.A.GG.GCTTG..AACTC..AG.AA.TTAAT.AACCA..TA.C....G..GAACA.CAAT.A.TTC.C.CGTTC.TG- .......G....CC.G.T.....TCTC.......G...C...C..TC...G.A......G.A.A A.CG..CAG...C.CAC.AG.A.AGA.G.A.TC..ACACTCA...TC..CGGAT..CGG..A- ..AC.T.A.C.GTT..GA..T.C..CAC.........CT..A..A...TT.T.G.. .C...- TAAATTAGACTGAA..GTG.ATAA..TAAGCAAG.G      302    268 ,    291    263       8:>A/pigeon/Xuzhou/1/2011,2011/01/31,China,H9N2        
   9 >A/chicken/Dawang/1/2011,2011/01/31,China,H9N2       G.C.GAAATTGAG.C.T.TATGAC.C.CC....CAC.A...A.A..GG.C..A.TG....TC.T...TC..CCG...ATA.GA.T..TG.AT.A..TG..ACT..C..A..CT.AC- .TC..A..A.GGGAGGA.T.A..TAAT.A.....TCGTT..GC..TT....T- .A..T..T....C...ATAA.A.GG.GCTCG..AACTC..AG.AA.TTAAT.AACCA..TA.C....G..GAACA.CAAT.A.TTC.C.CGTTC.TG- .......G....CC.G.T.....TC.C.......G...C...C..TC...G.A......G.A.A A.CG..CAG...C.CAC.AG.A.AGA.G.A.TC..ACACTCA...TC..CGGAT..CGG..A- ...C.T.A.C.GTT..GA..T.C..CAC......A..CT..A..A...T.AT.G.. .C...- TAAATTAGACTGAA..GTG.ATAA..TAAGCAAG.G      316    267 ,    305    262       9:>A/chicken/Dawang/1/2011,2011/01/31,China,H9N2       
   3 >A/chicken/Zhejiang/329/2011,2011/03/,China,H9N2     .A...........C..........T.....C...........T................A....A................G.T..........TA.......T...G.G...A..G C..T...T.........T.T.......A.TCT.......T....G..TAT..A ......G........C...........A....A.....GC...AA..T.AT.AA.CA...A...T.GG.TGA.CA.CAATT..TACGC.C.T....GG ...CGGC..CCT..T.G.TT..G.....TCATT..TGA.GTC.TT...TA.T.CCGGGG.A.G. .....T.A.AAA...A......G...G...T...........T....A.......A....... ....A..............A.............C....T................. T..CG. ........................T.........C.      159    126 ,    159    126       3:>A/chicken/Zhejiang/329/2011,2011/03/,China,H9N2     
   5 >A/chicken/Zhejiang/607/2011,2011/06/,China,H9N2     ............G...........C................A.AA.GG....A.TG......A..AT..TA...TT.........AG.................A...........G C..T...T.........T.T...........T............G..T.T..A ...A.C..CCAC.GT.......T........T..........A..G...........T.....TAT..C......A............A.G...G... AGT.G.C..C.T..T.G.TTCC.......CATT..TGA.GTC..T......T.C.GGGG.A.G. .T.GG........T...A..........A.T.C.....................C.C...... .G....T...G....AG....C..C....G.TTC.........A..CG..A.G.AG ...... ...................A....TA.........G      173    116 ,    173    116       5:>A/chicken/Zhejiang/607/2011,2011/06/,China,H9N2     

   4 >A/chicken/Shanghai/C1/2012,2012/01/,China,H9N2      .............C...A......T.....CA......GTT...CT..G....G.....A....A.C.........T...G..T........G.TA..A....T...G.G...A..G C......T.........T.T.......A.TCT.......T....G..TAT..A ...A.C..CCAC.GT.......T......................G...........TT....TAT..C......A............A.G...G..G AGTCGGC.ACCT..T.G.T...G....ATCATTT.TGA.GTC.TT...T..T.CCGGGG.A.G. .T...T...AAA........G..A...G..T..C....C.......AAA...A..A...CC.A .G....T...G....AG....C..C....G.TTC.........A..CG..A.G.AG T...GG ........................T...........      247    143 ,    247    143       4:>A/chicken/Shanghai/C1/2012,2012/01/,China,H9N2      
   6 >A/brambling/Beijing/16/2012,2012/11/07,China,H9N2   ...A...A.....C...A......T..C..C.......GTT.T.......T........A....A.C.........................G.TA..A....T..C..G....... ...T..............T..................T..A............ ...A.C..CCAC.GT.......T..T................A..G............T....TAT.........A............A.G...G... ....G.C.AC.T....A.TT.C.......CATTA.T...GTC..T..C...T.C.TGGG.A.G. .T...............A.........................AA....C............. C....TT............A.C..C....GTT.C.A..A.T......G....G..G T.ACG. .AAATT.GACTG.ACAG.G.AT.A...AAGCAAG.G      236    125 ,    236    125       6:>A/brambling/Beijing/16/2012,2012/11/07,China,H9N2   

   1 >A/chicken/Jiangsu/Q3/2010,2010/02/,China,H9N2       ........................C.............GTT...CT.....G..............T.......TT..........G............T................. ....A....T...........AC.........CC......A.........T.. C.....G........C...............T......GC.......................................................... AGT....G....C..........TCT........G...C...C...C...G.A......G.... .....T...AAA..........G...................T....A.......A......A C............AT...G...C.....A.......C.....T..C.......... .....G ....................................       84     60 ,     84     60       1:>A/chicken/Jiangsu/Q3/2010,2010/02/,China,H9N2       
   2 >A/chicken/Anhui/HF/2010,2010/04/,China,H9N2         ........................C.G...........GTT.........TG.............AT..TA...TT..........G............T................. ....A................AC.........CC......A.........T.. C.....G........C.............T..A.....GC...........A.........A....G...............C..............G .......G....C....T.....TC.........G...C...C..CC...G.A......G.... .....T...AAA..........G...........A.......T....A.......A....... ........C.....T...G.........A.......C.....T..C.......... T...G- ............................--------      149     74 ,    110     65       2:>A/chicken/Anhui/HF/2010,2010/04/,China,H9N2         
  10 >A/equine/Guangxi/3/2011,2011/03/18,China,H9N2       ...........A.................A.AA...A.GTT.......G.......TTG......AT......G............G..TA...T.T.............C...... ....A.A..T...........AC.........CC......G..A......... C.....T........C....G.................GCA.A........A.........A.......T..........T.C............... A........G.......TT........A....TA..GA..T...T..CTA...C.......... .TCGG.C......TCAC...G....AG.A...CCAA...T.A..AT..AC..A.C..G.CC.A ..TCAT..CC....T.G......G.C.G.GT...AA..TCTT.AA...TT....A. .....G .A....A...T...CA...AC....A..A..AA.C.      493    124 ,    493    124      10:>A/equine/Guangxi/3/2011,2011/03/18,China,H9N2       
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               

---Index--------------------------------------------------AGAGAGGGGGAGATTCCCCCCACTAAATAGTGGTTTGGAAGGCGTCAAAACACACACCAGCTGCGGGCTCGTTACCCTAGAAGCAGACACGCAGGGCAGCGTCCGGTAGATTCGGTA TCACGGGAGCATAGAAGCCCCGTCGGGCGCTGTTCTACCCCATGACCCGCGGG TGTGCTACTTGTAACTGCGGAGCAACATCGACGGGTCTAAGAGGGACCGGCGGGTTGCCCCGTCGCAATCAGGTGGTGGCCCTCCAATGTAGCTAAAA GACTAATACTTCTTCATCACTTACACTGCTCACGACATAACATCCATTCGACGATAAAAAGGAT GCTAAGAGAGGTTCTCTGTAACAGAGAAGGCATTTGTCTCTGCGGCTGCTAAGCTGTAATTCG TACTGGCGTTAACGCGACACATTATTGATACCCTCGTTCTCCCGGTTACCGCAAGA GTGTAA CGCGCAGAGACCGGAGAGAGTAGGAGCCGATGGATA 
-codon-position-------------------------------------------            1    1                    1             1              1        1                1           1              1       2      1 1  1         1    1                        11  1      1    2   2          1 2        11 1      1      1      1          2      1   2   122  111  11     1  2   2  2 12                 11      11            1        1        1  1            1    1      1         2     2     2      12     2                   1  1  1    1      2   1        21 2        2 21111211111 
                                                          000000000000000000000000000000000000000000000011111111111111111111111111111111111111111111111111111111111111222222222 00000000000000000000000000111111111111111122222222222 00000000000000000000000000000000000011111111111111111111111111111111111111111111111111111111111222 0000000000000000000000000000000000000000000111111111111111111111 000000000000000000000000000000000000000001111111111111111111111 00000000000000000000000000000000000000011111111111111111 000000 000000000000000000000000000000000000 
                                                          000111111222333334445555666666677788888889999900000011111112222222333344555555566667777777777778888888899999000011222 01122344455555666677888899122333455667889900000111122 00001111223333344444455677788888999900000111111111222222223333334455555556666677777788888899999001 0000011111222333344455555566667777777888999001122222333344444456 011222223333344455555666677777788888999990000001111222222222334 00001111222222333344445566677788888999900000111122222333 234669 000111122222333344444445566666677777 
                                                          036012459017125690380257144566714634467781338812234600147890123578333634011338915880122457888990112378912459078805148 53433067801116333637134948158068157122061804579113507 15894677110136902369948257703479034901345013346679015677890224672601389992678801113504677900255354 0003604899166124802811477903590014567077157452502338035800569902 507556993456828811469044401134601138047782447781238011235689059 00361133012258145724470134815823489003611367344702444389 380297 167167900123338922355673713457733445 
                                                          699843465403617606594589258169814240344658361473684524600519276721238540058074043031328680258243584357973298162837110 12217357675691036422944787047259412406307913867589784 27164214143876083226802751710001998951229061764767701758795077545163040360076970394231958328109715 6788028768925272157902369330963471051769575132297174880945071793 121587249543460469044328981527873615652826171203512968494946536 69333728104828287621741652140024321063917851806467025563 478107 239481817329130003236816344656706287
 
Re: H7N9 ?Discussion

Re: H7N9 ?Discussion

Please be aware this this post is going to be more speculative than my first and based on not much hard data.

I think this is not going to be a flash-in-the-pan outbreak. I base this on the fact that the 3 confirmed cases are two in Shanghai and the other in Anhui which is about 470km away. Further more in Mixin's post (see genetics link in first post for thread) she says
When I aligned the HA amino acids, Anhui and Shanghai/2 are identical but Shanghai/1 has a number of differences. These sequences surprise me often; I would have thought the 2 from Shanghai would have been identical.
So there seem to be infections from two different strains and the 'odd man out' is one of the Shanghai pair, making any link between the two geographically close cases genetically distant. This leads me to believe there is at least one strain, and possibly two, infecting humans. Now the authorities know what they are looking for I would expect a lot more cases to start to appear and many of these will be much less clinically severe. What we are now seeing is likely just to be the tip of the iceberg.

If the above is close to the mark then we may see a pandemic or, like H5N1, an ongoing splattering of isolated zoonotic emergences and small clusters.

Unfortunately Mixin's BLAST results concentrated on recent matches and so does not go back far enough to tie in to the clades mentioned in Anne's posts and they may not be very relevant now as so many years have past both the sequence data and circulating strains are likely to have change significantly.

Both these papers, and NS1's link, are mainly concerned with reassortment and recombination potential and at present I suspect we have enough to concern ourselves with dealing with and understanding the current new strain. It obviously has a fairly sound understanding of how to jump to humans and given enough practice is a pandemic threat.

Note that Andrew Rambaut's phylogenic tree, posted by Pathfinder, is on the PB2 segment and grouped with H9N2 (not H7N9) sequences which ties in with the Chinese CDC graphic of the internal proteins coming from an H9N2 donor.

Looking at GS's sequence alignment the most striking feature, to me who is more used to H5N1 sequences, is how poor the homology is to the consensus strain and between the aligned sequences. This is concerning as it presents a very varied palette for reassortment and recombination.

Two apologies. Firstly that I have not looked at any sequences myself - due to time and computer problems - and therefore am just using everyone else's work. Secondly that in this post I have used rather more jargon - which I tried to avoid in the first post. If anyone would like more explanation of anything please just post the bit of interest and I will try and clarify if I can.
 
Re: H7N9 ?Discussion

Re: H7N9 ?Discussion

Monday, April 1, 2013

<META content=7063504707869324345 itemprop="blogId"><META content=1357582690781207098 itemprop="postId">3 human infections with H7N9 avian influenza, two fatal

Three people have been infected with an H7N9 subtype of influenza virus in the last two month in central China. Two, an 87 year-old man and a 27 year-old man, became infected in February and died within a week. A third case, a 35 year-old woman, became infected March 9th and is recovering in the hospital.

88 close contacts of these three individuals have been sampled and monitored for influenza and influenza like illness. To date, it does not appear that these viruses have been able to transmit from human to human. The source of all three infections is currently unknown.

Initial fears were that a new highly pathogenic avian influenza (HPAI) strain of H7 was the culprit. However, recent information from the CDC indicates that these viruses lack the polybasic cleavage site that defines a highly pathogenic strain. Additionally, the virus seems to be a reassortant with internal genes that are very similar to H9N2 viruses.

This marks the second time that a virus containing genes from an H9N2 via reassortment has caused deaths in humans. The HPAI H5 virus isolated in the Hong Kong outbreak of 1997 also contained internal gene segments that matched H9N2 viruses.

My own personal research has focused on the threat that H9N2 viruses could pose to the human population. Our research has focused on reassortant viruses of the H9 subtype, and we have found that H9 viruses can gain infectivity, pathogenicity, and aerosol transmissiblity in ferrets and swine via reassortment, especially in regards to the 2009 pandemic H1N1.

The results we have gathered from lab and the recent outbreak once again highlight the potential dangers of H9N2 influenza viruses to humans. The viruses can infect humans, readily reassort with other viruses, and twice now have created viruses with significant effects in a human host.


Posted by <META content=http://www.blogger.com/profile/01531305430278331548 itemprop="url">Brian Kimble at <META content=http://bkviroblog.blogspot.com/2013/04/3-human-infections-with-h7n9-avian.html itemprop="url"><A class=timestamp-link title="permanent link" href="http://bkviroblog.blogspot.com/2013/04/3-human-infections-with-h7n9-avian.html" rel=bookmark><ABBR class=published title=2013-04-01T14:10:00-04:00 itemprop="datePublished">2:10 PM</ABBR>

College Park, Maryland
Science news and life in general from a research virologist


http://bkviroblog.blogspot.com/2013/04/3-human-infections-with-h7n9-avian.html


<DD class=profile-textblock><DD class=profile-textblock>

</DD>
 
Re: H7N9 ?Discussion

Re: H7N9 &#150;Discussion

Mixin thank you, but I do not want to make work for you and all we would really learn is the parentage of the reassortment strain which is only of historical interest.

You have an almost perfect homology on HA between the released sequences (100, 99 & 99% and the Zhejiang ducks are nearly as good at 96% but they are H7N3 and the Chinese CDC said the donor for both HA and NA were H7N9. The only H7H9 in your list is A/duck/Mongolia/119/2008 (A/H7N9) at 94%.
If you can be bothered then BLAST the NA and see if A/duck/Mongolia/119/2008 (A/H7N9) comes up again (assuming a single reassortment) then we have probably found a close relative of a 5 year old ancestral virus. There are so many virus in the wild, compared to published sequences, that is probably as good as you will get. It is a billion to one chance that anyone actually sequenced a direct ancestor of our reassortment donors. For the internal strands you would be looking for an H9N2 virus that keeps appearing in the lists for all 6 strands (again assuming we are looking at a single reassortment event). However all we will get is something to point at and say 'this H7N9 and that H9N2 seems to be related to the two viruses that combined to form our troublesome new H7N9'
 
Last edited:
Re: H7N9 ?Discussion

Re: H7N9 ?Discussion

...
You have an almost perfect homology on HA between the released sequences (100, 99 & 99%)
...

There are 12/13 nucleotide differences between Shanghai/1 and the other two. That's not many compared to other sequences; but considering the other two are identical except for 1 mutation, I thought it might be important to note.
 
Re: H7N9 ?Discussion

Re: H7N9 ?Discussion

We seem to have a winner on the internal proteins parent in A/brambling/Beijing/16/2012 (A/H9N2) which is not-less than 97%; homologous on any of the BLASTs for the 6 segments that code for all but the two surface proteins. They do not feature in the HA & NA BLASTS which came from an H7N9 virus. It is also a good fit geographically and temporally.

A/duck/Mongolia/119/2008 (A/H7N9) seems a fairly close match to the other donor with 94% on the HA & 95% on the NA and of course nothing on the internal lists. This is not as good a match but is both older and farther away geographically. We just got lucky that someone in Beijing was out netting Bramblings last year.

Thanks for that Mixin. What I do not get is why when you do a BLAST you get lots of the best alignments from sero-types other than the one you provided. The HA & NA numbers are used for strains so far apart they give a very weak HI test and are so deemed to be a new group - as happened with the new bat flu. How then can all the closest matches to your HA7 BLASTs be HA9s and we get both HA5 & HA6 before we get our first HA7 and that is an H7N2? Like you I just apply what I pick up and have no formal training in genetics or virology but I wish someone would clear this up for me as it just makes no sense.
A question for Vincent R. I think.

Re.
There are 12/13 nucleotide differences between Shanghai/1 and the other two. That's not many compared to other sequences; but considering the other two are identical except for 1 mutation, I thought it might be important to note.
It was one of the things that made me think this virus is fit in its avian wildtype form. I am going to assume that the reassortment event is unique and occurred within a bird. With that given it will start to mutate from case zero in the original host forming a quasi species a subset of which will be ingested by the next host etc. If there is a noticeable difference in the sequences then the branching point is, on average, older. Ergo it has been kicking about in birds for a while. It is also common enough to cause infections with different strains in disparate cities and all of that in the first 3 cases we found. I do not know what the Chinese have in terms of a sentinel network but if they have the data I hope they are looking at ILI numbers and 'Type A - unsubtyped' test returns data for any significant deviation from back ground.
 
Last edited:
Re: H7N9 ?Discussion

Re: H7N9 ?Discussion

Regarding the negative test results on undefined respiratory disease, or H7N9 contacts, etc.: If the primer is not set to look for H7N9 (assuming RT-PCR) or H7Nx, doesn't that mean they can acually miss it? But if a new primer can be developed quickly, I assume they can retest samples.

.
 
Re: H7N9 ?Discussion

Re: H7N9 ?Discussion

seems that we have multiple consecutive reassortments,
at least 2, maybe 3 or 4.

These must have happened in birds, probably poultry,
since those big variations hardly occur in humans yet.

So I assume the first reassortment
H9N2+H7N9-->H7N9 with 6 internal segments from H9N2
happened ~ 1/2 year ago in chickens
and then it reassorted again with other H9N2.

So that virus should be pretty widespread in chickens already
 
Re: H7N9 ?Discussion

Re: H7N9 ?Discussion

I have a sidescroll in this thread, probably due to the big picture in post #3.

I had these sidescrolls before, but I never read whether other
readers experience the same thing.
It also seems that they may be gone when I reboot but appear
again on the next reboot, unpredictable.

The lines are very long and you have to shift on the bottom bar
to read each line and then back for the next line.

And when you post the "edit","quote",save","go advanced" icons may be
far right, only visible after scrolling

that's why I usually use short lines, so the text is still readable
when someone adds big pictures
 
Re: H7N9 ?Discussion

Re: H7N9 ?Discussion

now I'm reading about more cases ...

the Chinese authorities might have known this
and maybe that was the reason for their
unprecedented quick uploading of sequences
and the examination teams
 
Re: H7N9 ?Discussion

Re: H7N9 ?Discussion

Regarding the negative test results on undefined respiratory disease, or H7N9 contacts, etc.: If the primer is not set to look for H7N9 (assuming RT-PCR) or H7Nx, doesn't that mean they can acually miss it? But if a new primer can be developed quickly, I assume they can retest samples.

.
I briefly covered this in a link in the first post but this is in a little more detail. My understanding, which might be wrong, is that it depends on the labs equipment and staff. Simpler regional labs will have RT-PCR and staff trained to run a supplied primer against samples looking for matches. The 'supplied primers' are likely to sort out Type B, Type A and then differentiate the Type As into the seasonal flu sero-types H3N2 and H1N1. Our new flu would pass the Type A test but fail on both sero-types giving a 'Type A - un-subtyped' result. It was the increasing number of these returning from the Mexico boarder States of the USA at the start of the 2009 H1N1 pandemic that lead to its sequencing by the CDC in Atlanta. Note here that there was already an H1N1 test in these primers but the new strain was sufficiently different to not be a match. I recall reading at the time that prior to sequences being available - based solely on antigenic testing - the HA from H1N1(2009) would probably have been classified as an new sero-type and, presumably, been designated H17.
Samples of the 'Type A - unsubtyped' would then be forwarded to a lab with real time RT-PCR and primer generating capacity. They can then generate and test primers until they have a match, grow product to sequence and send out the new primer to the client labs which will then be able to correctly identify the new strain in their samples.
This link is to a beginners guide to RT-PCR produced by a company which sells kits for producing primers. They have a list of their kits at the end of the .pdf with a brief description of what each is capable of doing.
 
Re: H7N9 ?Discussion

Re: H7N9 ?Discussion

I have a sidescroll in this thread, probably due to the big picture in post #3.
Had the same problem but resolved it by shrinking my text font until it all fitted in one screen width. A better solution might be to use one of those natty scroll bars you use on some of your longer sequence list but I am not sure how you generate them. Just shrinking the graphic might lead to the sequence font becoming unresolvable, being bit-mapped rather than vectored.
 
Re: H7N9 ?Discussion

Re: H7N9 ?Discussion

HK SFH said that H7N9 virus gene sequences demonstrated that the virus has a 'signature' that indicates its ability to infect human. See main forum post... It remains sensitive to NAI drugs.
 
Re: H7N9 ?Discussion

Re: H7N9 ?Discussion

I have a sidescroll in this thread, probably due to the big picture in post #3.

I had these sidescrolls before, but I never read whether other
readers experience the same thing.
It also seems that they may be gone when I reboot but appear
again on the next reboot, unpredictable.

The lines are very long and you have to shift on the bottom bar
to read each line and then back for the next line.

And when you post the "edit","quote",save","go advanced" icons may be
far right, only visible after scrolling

that's why I usually use short lines, so the text is still readable
when someone adds big pictures

I moved that post to the archives where I am going to try to fix the side scroll. I will move the post back onto this thread afterwards.
 
Re: H7N9 ?Discussion

Re: H7N9 ?Discussion

well, we all know where to find the info, even if links are not allowed.

signature= E627K(PB2),Q226L(HA),new 5aa deletion in N9

quails have both receptors, quail/G1/1997 is one of the
H9-strains, see e.g. the Peiris paper.
But the new H7N9 is not from that strain
 
Status
Not open for further replies.
Back
Top Bottom