• FluTrackers.com Inc. does not provide medical advice. Information on this web site is collected from various internet resources, and the FluTrackers board of directors makes no warranty to the safety, efficacy, correctness or completeness of the information posted on this site by any author or poster. The information collated here is for instructional and/or discussion purposes only and is NOT intended to diagnose or treat any disease, illness, or other medical condition. Every individual reader or poster should seek advice from their personal physician/healthcare practitioner before considering or using any interventions that are discussed on this website. By continuing to access this website you agree to consult your personal physican before using any interventions posted on this website, and you agree to hold harmless FluTrackers.com Inc., the board of directors, the members, and all authors and posters for any effects from use of any medication, supplement, vitamin or other substance, device, intervention, etc. mentioned in posts on this website, or other internet venues referenced in posts on this website.
  • We are not asking for any donations. Do not donate to any entity who says they are raising funds for us.

Alberta Swine Pandemic H1N1 Sequences Released

Re: Alberta Swine Pandemic H1N1 Sequences Released

> It wasn't withdrawn

so, where is it ? Post a link or an accession number

> The are multiple polymorphisms that have a limited distribution, but found in multiple
> sequences (some in other Alberta swine,

then see here: http://bit.ly/jTpLV and compare this sprinkled table with normal flu mutation lists !
One pig-farm, so many mutations and so few given to other pigs


> I have looked at HA and NA and multiple isolates have the same number or more changes
> than Alberta swine. You are using a VERY selected database (which you selected).
> You ignore all of the sequences at GISAID.

I'm using all available public sequences. I doubt that any sequence at GISAID has more mutations
than 42. Restricting to HA and NA is rather limited. You only consider ~25% of available nucleotides.
There was a time (2006) when you opposed non-public databases like GISAID.

> Long time periods average out the LARGE fluctuations over short time frames.

and so do many sequences --> statistics

I can't see the polymorphisms (position-number) in your travel-logs
 
Re: Alberta Swine Pandemic H1N1 Sequences Released

beudant said:
Do these sequences indicate anything from a layman's point of view?
Click to expand...

Based on the genetic signature of the isolates and the dates that they were collected, it appears that the virus in Mexico and California worked its way throught the midsection of the US and was transported into Canada. The poor Canadian pigs were then infected.

It just goes to show that us animals are more than willing to share our bugs with each other, and while we have them, each of us serves as a "mixing bowl" changing the viruses in various ways as it passes through the population.

None of the changes noted in any of these isolates suggests that the Swine Flu pandemic virus has changed for the worse. It is basically of the same character as far as we know.
 
Re: Alberta Swine Pandemic H1N1 Sequences Released

Mamabird said:
Based on the genetic signature of the isolates and the dates that they were collected, it appears that the virus in Mexico and California worked its way throught the midsection of the US and was transported into Canada. The poor Canadian pigs were then infected.

It just goes to show that us animals are more than willing to share our bugs with each other, and while we have them, each of us serves as a "mixing bowl" changing the viruses in various ways as it passes through the population.

None of the changes noted in any of these isolates suggests that the Swine Flu pandemic virus has changed for the worse. It is basically of the same character as far as we know.
Click to expand...

Thanks Mamabird.

GW
 
Re: Alberta Swine Pandemic H1N1 Sequences Released

from your link:
> This record has been replaced by GQ253501.2

it doesn't show up with genbank search.
I didn't even know it's still there and how to find it

"replaced" means, it is withdrawn (IMO)
 
Re: Alberta Swine Pandemic H1N1 Sequences Released

gsgs said:
> It wasn't withdrawn

so, where is it ? Post a link or an accession number

> The are multiple polymorphisms that have a limited distribution, but found in multiple
> sequences (some in other Alberta swine,

then see here: http://bit.ly/jTpLV and compare this sprinkled table with normal flu mutation lists !
One pig-farm, so many mutations and so few given to other pigs


> I have looked at HA and NA and multiple isolates have the same number or more changes
> than Alberta swine. You are using a VERY selected database (which you selected).
> You ignore all of the sequences at GISAID.

I'm using all available public sequences. I doubt that any sequence at GISAID has more mutations
than 42. Restricting to HA and NA is rather limited. You only consider ~25% of available nucleotides.
There was a time (2006) when you opposed non-public databases like GISAID.

> Long time periods average out the LARGE fluctuations over short time frames.

and so do many sequences --> statistics

I can't see the polymorphisms (position-number) in your travel-logs
Click to expand...

Please. There are more HA and NA than other gene segments. There is nothing unusal about the swine HA or NA relative to the number of polymorphisms. Many isolates have the same number or more.

The NA and HA address the "lab error" argument. The HA and NA are closely related to the human sequences and are not changing at an unusual rate. Moreover, the swine sequences are in swine, not humans, so the rates of change are not expected to be the same.

The number of isolates with sequences for all 8 gene segments is limited, which is how you keep your hypothesis alive (by limiting the sequences to a biased set generated by a small number of labs).
 
Re: Alberta Swine Pandemic H1N1 Sequences Released

no, I'm not restricting to full genomes.
http://h5n1experts.org/forum/showthread.php?t=738
(2998 sequences, 2801 segments , 681 hosts , ~4M nucleotides )
all the newflu sequences from genbank 27.June in my format here:
http://easyurl.net/aff92
391K,compressed with gzip,630 viruses ,
149+30+16+19+14+12+10+10+21+15+13+173+148 from the 13 subgroups


restricting to HA and NA makes it hard to keep an overview of mutation-counts over time.
Better use full genomes here.


for the sprenkling of mutations
compare the two tables here:

http://h5n1experts.org/forum/showpost.php?p=1144

everyone will easily see the difference
 
Re: Alberta Swine Pandemic H1N1 Sequences Released

segment 5 of 7 swine viruses had been released.
Fewer mutations now.
I assume they improved the sequencing method.

Code: 
                                             00001111 01111122 00111122 0000000000000000000000111111 000000000011111 00000000000000000000111111111 00000000000000000000000 000 
                                             45793568 91345902 56266701 0000233455666677788999022377 123466778911235 01112233333455678899001112223 02233344444555667888999 347 
                                             87492511 23823615 71129652 1556814699467724438456803457 304314155166864 94566700189734100647260381372 01512402458567491178122 326 
                                             04171772 73716083 32808529 8140278429125921814566496816 147499065138484 60444637883266998401050203341 11801935069377404474529 764 
-codon-position------------------------------ 1 11     212 12       1 2      2 21222 12 1 2 2 1  12  2 22112  221  2  212   1 1 12 111 12  2111 21 11 1 1122  1 12  112 12 1 2 
---Index-------------------------------------TCGACCTC ACATTACC CAAGGAGT AGCTTCACGATGTTAGAGTAAACAAACC TTACGATATACGAAG ATAATGAGTCTAATAATTAAATGTTAAAA ATGATGTAATCATTAAAGTCGAG TTC 
  1 >A/swine/Alberta/OTH-33-7/2009/05/05/    -------- -------- -------- .AA...G..GC..............C.. --------------- ......G....GG.G...T........G. G...A.....T...........A --- 
  2 >A/swine/Alberta/OTH-33-25/2009/05/02/   -------- -------- -------- ---------------------------- --------------- ......G...................... .C....................A --- 
  3 >A/swine/Alberta/OTH-33-1/2009/05/03/    -------- -------- -------- .AA.C.............CG........ ........G.TA... ......G.........CC.G......... ...G............G...... --- 
  4 >A/swine/Alberta/OTH-33-23/2009/05/03/   -------- -------- -------- .AA....A................G... ..........T.... ....A.G..............CA...... ..A......C.......A..... --- 
  5 >A/swine/Alberta/OTH-33-24/2009/05/03/   -------- -------- -------- .AA........T..GA............ ..........T.T.. G..G..G...C.................. ........G...C.......A.. --- 
  6 >A/swine/Alberta/OTH-33-21/2009/05/05/   -------- -------- -------- .AA.C........CGA.....G...... --------------- ..G...G.................C.... ....................... --- 
  7 >A/swine/Alberta/OTH-33-22/2009/05/05/   -------- -------- -------- ---------------------------- ..G.......T..G. ......G......C..............G ...........G.C......... --- 
  8 >A/swine/Alberta/OTH-33-3/2009/05/03/    -------- -------- -------- .AAC.T..A.......TA.....G.... ...T...G.TT.... .....AG...................... ......C.......G.G...... --- 
  9 >A/swine/Alberta/OTH-33-14/2009/05/05/   -------- -------- -------- ---------------------------- ..........T.... ......G...................G.. .....................G. --- 
 10 >A/Mexflu/index/2009-02-01               ........ ........ ........ -.........................-- ..............- ............................. -...................... ... 
 11 >A/swine/Alberta/OTH-33-2/2009/05/03/    -------- -------- -------- CAA.........A.......G.T...TA .A.T......T.... .C....G........C.......C.G... .......G..........C.... --- 
 12 >A/swine/Alberta/OTH-33-8/2009///        ATTCTTCT GG.CCGTT AGG..CAC CAA.........A.......G.T...TA C...AGC...TT..A ......GACT..........T........ ...............G...T... CAA 
 13 >A/swine/Alberta/OTH-33-8b/2009///       ATTCTTCT GG.CCGTT AGG..CAC CAA.........A.......G.T...TA C...AGC...TT..A ......GACT..........T........ ...............G...T... CAA 
 14 >A/Canada-AB/RV1644/2009/05/01           .TT....T ..G.C... .G.AAC.. .AA........................- ..........T.... ......G...................... -....T................. ..A
 
Re: Alberta Swine Pandemic H1N1 Sequences Released

well, same method :

segment 7 , uploaded VRL 09-JUL-2009
http://www.ncbi.nlm.nih.gov/nuccore/253584608?report=genbank
/lab_host="embryonated chicken eggs passage 1CE-6dpi"

segment 5 , uploaded VRL 17-AUG-2009
http://www.ncbi.nlm.nih.gov/nuccore/255988304?report=genbank
/lab_host="embryonated chicken eggs passage 1CE-6dpi"



taking 9 viruses with available segments 4,5,6,7 ,
not counting the obvious markers (mutations in all
9 swine viruses),
I count 35,16,21,18 mutations in segments 4,5,6,7
out of 1797,1565,1459,1027 nucleotides
 
Re: Alberta Swine Pandemic H1N1 Sequences Released

Closest human match:

A/Canada-AB/RV1644/2009

Part of the CDC variant ii that is slowly giving way to variant iv (Cancun).
 
Re: Alberta Swine Pandemic H1N1 Sequences Released

yes !
I didn't notice.

uploaded 11.August, sampling date 1.May, no age or gender

seems to be the source of the outbreak

included now in the updated mutation table above





> on May 1st, 2009
> The government of Alberta has confirmed two more cases of H1N1 in Calgary.
> Both of them female adults, including a woman who recently travelled to Tennessee.
> This is the first case of an Albertan being infected without traveling to Alberta.
> Both cases are considered mild and no hospitalization is required.
> This brings the total number of Calgarians with swine flu to seven, and the total in Alberta to eight.
 
You must log in or register to reply here.
Back
Top Bottom