• FluTrackers.com Inc. does not provide medical advice. Information on this web site is collected from various internet resources, and the FluTrackers board of directors makes no warranty to the safety, efficacy, correctness or completeness of the information posted on this site by any author or poster. The information collated here is for instructional and/or discussion purposes only and is NOT intended to diagnose or treat any disease, illness, or other medical condition. Every individual reader or poster should seek advice from their personal physician/healthcare practitioner before considering or using any interventions that are discussed on this website. By continuing to access this website you agree to consult your personal physican before using any interventions posted on this website, and you agree to hold harmless FluTrackers.com Inc., the board of directors, the members, and all authors and posters for any effects from use of any medication, supplement, vitamin or other substance, device, intervention, etc. mentioned in posts on this website, or other internet venues referenced in posts on this website.
  • We are not asking for any donations. Do not donate to any entity who says they are raising funds for us.

A/Shanghai/60T/2009(H1N1) released 6/22

Re: A/Shanghai/60T/2009(H1N1) released 6/22

also 1 in PA (40) , also 2 in NS (291,729)
{enumerating nucleotides}

and Bayern/63 has also the mutation in PB1
 
Re: A/Shanghai/60T/2009(H1N1) released 6/22

Cyril said:
PB1 in the Shanghai isolates has a silent mutation: AAG387AAA

which is present in those isolates of the h1n1 outbreak (and those only):


On the other hand the shanghai isolates have two silent mutations in PB2 that 71T doesn't have : ACA147ACG and CGA427CGG.

Those two mutations are only found in the shanghai sequences :
Click to expand...
These are in the posted travel logs.
 
Re: A/Shanghai/60T/2009(H1N1) released 6/22

you had PB1 in #17, not PB2,
presumably a typo, which caused some confusion.
 
Re: A/Shanghai/60T/2009(H1N1) released 6/22

gsgs said:
you had PB1 in #17, not PB2,
presumably a typo, which caused some confusion.
Click to expand...
Yes, it should have said PB2 as implied by the description which notes the avian history (and PB2 is avian in the pandemic H1N1). The isolates in the travel log are also PB2, as indocated in several of the posted descriptions.

The travel logs are more comprehensive than the much shorter list of pandemic H1N1 sequences. Although the travel logs include the pandemic isolates, they also have the limited number of sequences that have the same polymorphsism and associated region that exactly matches the pandemic strain, identifying the most likely source of the acquisition. These travel logs show that the two defining PB2 polymorphisms are found in avian isolates. consistent with the PB2 origin in the pandemic sequences.

The Shanghai isolates that have the two avain PB2 polymorohisms also have a defining PB1 polymorphism, which is also in 71T, linking it to Shanghai and suggesting the acquisition E627K is Shanghai associated. The PB1 polymorphism found in all four Shanghai isoaltes traces back to human H3N2, which is also the origin of PB1 in pandmeic H1N1.

These associates are NOT coincidental nor are they random and do NOT represent de novo mutations created by a sloppy polymerase.
 
Re: A/Shanghai/60T/2009(H1N1) released 6/22

Sorry my post is being redundant.

and Bayern/63 has also the mutation in PB1
Click to expand...
That escaped me - I can only work with full sequences.

These are in the posted travel logs.
Click to expand...
Sorry I admit I actually have a hard time making sense of the travel logs you post.

I'm not trained in this field - I'm a programmer with some interest in artificial evolution and genetics. I devised my own tools/methods out of interest for browsing the outbreak sequences.

Would you be kind enough to give a clue as to what sequence you used in PB1 to build this travel log?

I assume you have been looking for a set sequence of nucleotides.

All recent isolates with that acquistion are from Shanghai (no lab error required - the isolate was cloned and sequenced again with IDENTICAL results).
Reality check - sequences that don't follow the random mutation dogma are NOT lab errors, no matter how many times lab error is cited or how vigorously hands are waved).
Click to expand...
I've spent a fair amount of time browsing the h1n1 isolates for mutations and lineages. I've encountered some instances of segments that bear the markers of different, not immediately related lineages. Only explanation I could come up with (for what it's worth) is for them to be recombinant. I just don't know better - they only seem to defy logic otherwise.
 
Re: A/Shanghai/60T/2009(H1N1) released 6/22

Cyril said:
Sorry my post is being redundant.


That escaped me - I can only work with full sequences.


Sorry I admit I actually have a hard time making sense of the travel logs you post.

I'm not trained in this field - I'm a programmer with some interest in artificial evolution and genetics. I devised my own tools/methods out of interest for browsing the outbreak sequences.

Would you be kind enough to give a clue as to what sequence you used in PB1 to build this travel log?

I assume you have been looking for a set sequence of nucleotides.


I've spent a fair amount of time browsing the h1n1 isolates for mutations and lineages. I've encountered some instances of segments that bear the markers of different, not immediately related lineages. Only explanation I could come up with (for what it's worth) is for them to be recombinant. I just don't know better - they only seem to defy logic otherwise.
Click to expand...
Yes, they are polymophisms that jump from one background to the next, which is precisely what happens in recombination.

The travel logs are created by taking the newly acquired polymorphism and the adjacent sequence (usually about 15 BP) and the searching the entire database at Genbank (which takes a few seconds). The isolates listed have the polymorphism and exactly match the adjacent region.

The sequences used for the two PB1 travel logs were

aaaaaaaTTGAGAAAA

and

GAACCCTGGCCATGCAGATC

Since the search uses a short sequence, it will find matches in full or partial sequences that have exact matches.
 
Re: A/Shanghai/60T/2009(H1N1) released 6/22

The sequence used to create the PB2 travel log was

GCTGAACCCCATGCACCAAC

The fact that the only matches in the entire database are the three closley related Shanghai sequences and a series of avian isolates is NOT a coincidence (as I am sure you and anyone else who frequently analyzes data realizes in a nanosecond or less).

gb|GQ290434.1| Influenza A virus (A/Shanghai/60T/2009(H1N1)) ... 40.1 0.046
gb|GQ253489.1| Influenza A virus (A/Shanghai/37T/2009(H1N1)) ... 40.1 0.046
gb|GQ225354.1| Influenza A virus (A/Shanghai/1/2009(H1N1)) se... 40.1 0.046
gb|EU980493.1| Influenza A virus (A/mallard/MD/865/2002(H5N2)... 40.1 0.046
gb|EU980501.1| Influenza A virus (A/mallard/MD/898/2002(H5N2)... 40.1 0.046
gb|EU980508.1| Influenza A virus (A/mallard/MD/185/2003(H5N2)... 40.1 0.046
gb|CY029936.1| Influenza A virus (A/blue-winged teal/Ohio/186... 40.1 0.046
gb|EU050626.1| Influenza A virus (A/chukkar/Shantou/1530/2005... 40.1 0.046
gb|EU050621.1| Influenza A virus (A/chukkar/Shantou/89/2005(H... 40.1 0.046
gb|EU050619.1| Influenza A virus (A/chukkar/Shantou/7964/2004... 40.1 0.046
gb|EU050615.1| Influenza A virus (A/chukkar/Shantou/6865/2004... 40.1 0.046
gb|EU050613.1| Influenza A virus (A/quail/Shantou/6651/2004(H... 40.1 0.046
gb|EU050610.1| Influenza A virus (A/quail/Shantou/6060/2004(H... 40.1 0.046
gb|EU050609.1| Influenza A virus (A/guinea fowl/Shantou/6042/... 40.1 0.046
gb|EU050608.1| Influenza A virus (A/chukkar/Shantou/5651/2004... 40.1 0.046
gb|EU050606.1| Influenza A virus (A/partridge/Shantou/5028/20... 40.1 0.046
gb|EU050600.1| Influenza A virus (A/guinea fowl/Shantou/3431/... 40.1 0.046
gb|EU050591.1| Influenza A virus (A/guinea fowl/Shantou/2418/... 40.1 0.046
gb|EU050550.1| Influenza A virus (A/quail/Shantou/1811/2001(H... 40.1 0.046
gb|CY023317.1| Influenza A virus (A/chicken/Shantou/2402/2004... 40.1 0.046
gb|EU026013.1| Influenza A virus (A/mallard/Maryland/887/2002... 40.1 0.046
gb|CY021596.1| Influenza A virus (A/mallard/Maryland/899/2002... 40.1 0.046
gb|CY020868.1| Influenza A virus (A/blue-winged teal/Ohio/907... 40.1 0.046
gb|CY020860.1| Influenza A virus (A/mallard/Ohio/664/2002(H6N... 40.1 0.046
gb|CY011119.1| Influenza A virus (A/mallard/Maryland/881/2002... 40.1 0.046
gb|CY020820.1| Influenza A virus (A/mallard/Maryland/470/2002... 40.1 0.046
gb|CY020804.1| Influenza A virus (A/mallard/Ohio/671/2002(H4N... 40.1 0.046
gb|CY020780.1| Influenza A virus (A/mallard/Ohio/655/2002(H4N... 40.1 0.046
gb|CY014525.2| Influenza A virus (A/mallard/Ohio/657/2002(H4N... 40.1 0.046
gb|CY020772.1| Influenza A virus (A/black duck/Maryland/834/2... 40.1 0.046
gb|CY020740.1| Influenza A virus (A/mallard/Maryland/750/2002... 40.1 0.046
gb|EF063554.1| Influenza A virus (A/quail/Dubai/303/2000(H9N2... 40.1 0.046
gb|EF063553.1| Influenza A virus (A/quail/Dubai/302/2000(H9N2... 40.1 0.046
gb|EF063552.1| Influenza A virus (A/quail/Dubai/301/2000(H9N2... 40.1 0.046
gb|CY017732.1| Influenza A virus (A/pintail/Ohio/25/1999(H1N1... 40.1 0.046
gb|CY017724.1| Influenza A virus (A/green-winged teal/Ohio/72... 40.1 0.046
gb|CY016962.1| Influenza A virus (A/mallard/Ohio/66/1999(H1N1... 40.1 0.046
gb|CY014805.1| Influenza A virus (A/turkey/Minnesota/1012/199... 40.1 0.046
gb|CY014701.1| Influenza A virus (A/gull/Maryland/704/1977(H1... 40.1 0.046
gb|CY012831.1| Influenza A virus (A/mallard/Ohio/56/1999(H1N1... 40.1 0.046
gb|AY619970.1| Influenza A virus (A/swine/Ontario/42729A/01(H... 40.1 0.046
gb|AY619962.1| Influenza A virus (A/swine/Ontario/K01477/01(H... 40.1 0.046
gb|AF508647.1| Influenza A virus (A/Pheasant/Ireland/PV18/97(... 40.1 0.046
gb|CY005071.1| Influenza A virus (A/laughing gull/DE/2838/198... 40.1 0.046
gb|CY004567.1| Influenza A virus (A/herring gull/DE/712/1988(... 40.1 0.046
gb|CY004457.1| Influenza A virus (A/herring gull/NJ/782/1986(... 40.1 0.046
gb|CY003901.1| Influenza A virus (A/herring gull/DE/475/1986(... 40.1 0.046
gb|CY005865.1| Influenza A virus (A/gull/Minnesota/945/1980(H... 40.1 0.046
gb|CY005858.1| Influenza A virus (A/shoveler/Netherlands/19/1... 40.1 0.046
gb|CY004880.1| Influenza A virus (A/herring gull/DE/665/1988(... 40.1 0.046
gb|CY004389.1| Influenza A virus (A/herring gull/New Jersey/7... 40.1 0.046
gb|M73525.1|FLAH13N6B Influenza A virus (A/gull/Maryland/704/... 40.1 0.046
 
Re: A/Shanghai/60T/2009(H1N1) released 6/22

Thanks, that's gold. I'm going to give this method a try and see if I can make sense out of it.

hey, programmer.
Let's share (processed) data, programs,utilities,work...
Click to expand...
We actually met on a french forum :)
my tools are dead simple - they just compare sequences and search for triplets of nucleotides. I've been reluctant towards using the tools available at ncbi - I like to experiment by myself.
 
Re: A/Shanghai/60T/2009(H1N1) released 6/22

Cyril said:
Thanks, that's gold. I'm going to give this method a try and see if I can make sense out of it.


We actually met on a french forum :)
my tools are dead simple - they just compare sequences and search for triplets of nucleotides. I've been reluctant towards using the tools available at ncbi - I like to experiment by myself.
Click to expand...
You will find this to be very simple and very powerful (searching the flu database will give cleaner results, but it frequently trails the full database -sequences greater that 15 bp will eliminate most noise).
 
Re: A/Shanghai/60T/2009(H1N1) released 6/22

Sorry but I fail to see what it entails, and if I'm entitled to a dumb question:

If I look for the sequence GCTGAACCCCATGCACCAAC (PB2 427CGG) I obtain the travel log you posted, with many avian isolates involved.

If on the other hand I search for the consensus sequence, ACTGAACCCCATGCACCAAC (PB2 427CGA), I obtain (obviously) the isolates from the h1n1 outbreak, as well as many (other) avian isolates - for instance some of them are:

A/northern pintail/Alaska/44203-079/2006(H4N6)
A/turkey/WI/1966(H9N2)
A/chukkar/Shantou/13393/2005(H6N1)
A/quail/Shantou/9399/2005(H6N2)
A/quail/Shantou/6825/2005(H6N2)
A/chukkar/Shantou/5275/2005(H6N1)
A/quail/Shantou/5017/2005(H6N2)
A/quail/Shantou/4106/2005(H6N2)
A/pheasant/Shantou/114/2005(H6N1)
A/pheasant/Shantou/113/2005(H6N1)
A/pheasant/Shantou/7503/2004(H6N2)
A/guinea fowl/Shantou/7211/2004(H6N1)
Click to expand...

Those are exact matches.

What I understand is that it points out to an avian lineage, but I fail to see what it implies in regard to Shanghai's 427CGG genotype and the "single point mutation vs recombination" argument?

Welcome Cyril!
Click to expand...
Thanks!
 
Re: A/Shanghai/60T/2009(H1N1) released 6/22

Unless of course the whole idea is that both genotypes exist locally in avian species and the similarities in sequence made the shanghai strain "pick up" the polymorphism through recombination.

I guess the whole question then would be "how did two strains that affect different species recombine?".
 
Re: A/Shanghai/60T/2009(H1N1) released 6/22

Swine is infected by human, swine, and avian influenza. Your consensus search just confirms that swine acquired an avian PB2 decades ago (which you could also see by searching the whole gene and look for most closely related).
The fact that the pandemic H1N1 is a "triple reassortant" (swine, avain, and human) was know from the first isolates (and the presence of triple reassortants has been known since the 1990's).
 
Re: A/Shanghai/60T/2009(H1N1) released 6/22

> I've encountered some instances of segments that bear the
> markers of different, not immediately related lineages.
> Only explanation I could come up with (for what it's worth) is for
> them to be recombinant. I just don't know better - they only
> seem to defy logic otherwise.

give an example
 
Re: A/Shanghai/60T/2009(H1N1) released 6/22

Well for instance Texas/15.
I was considering building lineages and thought every isolate would fall into place until I stumbled upon such cases.

Texas/15 shares 406CAG with isolates from nearby California (+one in NY). The three isolates from California (but not the one in NY) bear an additional marker (624GCC).

Texas/15 also shares 317TTA with South Carolina/09, which otherwise has itself the markers of a wildly distributed variant that spans America, Europe, China...

If it's not for recombination I can't explain why this latter mutation appears in both a member of a well-established lineage and this Texas/15 isolate that bears a marker from the California variant.

But again I don't pretend this is a correct explanation - it's basically the only explanation I could come up with myself. It might just show the limitation in my understanding.
 
Re: A/Shanghai/60T/2009(H1N1) released 6/22

Cyril said:
Well for instance Texas/15.
I was considering building lineages and thought every isolate would fall into place until I stumbled upon such cases.

Texas/15 shares 406CAG with isolates from nearby California (+one in NY). The three isolates from California (but not the one in NY) bear an additional marker (624GCC).

Texas/15 also shares 317TTA with South Carolina/09, which otherwise has itself the markers of a wildly distributed variant that spans America, Europe, China...

If it's not for recombination I can't explain why this latter mutation appears in both a member of a well-established lineage and this Texas/15 isolate that bears a marker from the California variant.

But again I don't pretend this is a correct explanation - it's basically the only explanation I could come up with myself. It might just show the limitation in my understanding.
Click to expand...

Texas/15 is a consensus virus and genetically distint from the two variants that include the CA viruses. The earliest known source for TX/15 is Mex/4115.
 
Re: A/Shanghai/60T/2009(H1N1) released 6/22

OK, I localized your mutations in PB2 (segment 1).
I think it's a coincidence that South Carolina/09 developed the same
mutation. There are not so many mutations available (13000 in total,
but some are much preferred, e.g. 3rd position A-G,C-T, so basically
~5000)
There are also biological constraints which favour some mutations over others
 
Re: A/Shanghai/60T/2009(H1N1) released 6/22

gsgs said:
OK, I localized your mutations in PB2 (segment 1).
I think it's a coincidence that South Carolina/09 developed the same
mutation. There are not so many mutations available (13000 in total,
but some are much preferred, e.g. 3rd position A-G,C-T, so basically
~5000)
There are also biological constraints which favour some mutations over others
Click to expand...
More coincidences!!!!
 
Re: A/Shanghai/60T/2009(H1N1) released 6/22

gsgs said:
OK, I localized your mutations in PB2 (segment 1).
I think it's a coincidence that South Carolina/09 developed the same
mutation. There are not so many mutations available (13000 in total,
but some are much preferred, e.g. 3rd position A-G,C-T, so basically
~5000)
There are also biological constraints which favour some mutations over others
Click to expand...
Speaking of PB2 and coincidences, China has switched E627K back to wildtype!

It is still E627K at GISAID, but 4 of the 5 polymorphisms on PB2 have been switch to wild type at Genbank. Several other genes were also switch. I suspect there is a mixture and they found a wild type clone (sounds a lot like Hong Kong and their recombinant H5N1 isolates) and now are replacing the novel sequence with a much more generic sequence.

China deposited TWO PB2 sequences at GISAID last week, and both had (and at least one, if not both STILL have, E627K).
 
You must log in or register to reply here.
Back
Top