Announcement

**gsgs** · June 17, 2009, 09:53 AM

Re: A/Shanghai/71T/2009 acquired E627K

I've just been wondering about this virus - but not because of E627K -
it has so many mutation.
Even more Shanghai/37T

**Mamabird** · June 17, 2009, 09:58 AM

Re: A/Shanghai/71T/2009 acquired E627K

Originally posted by gsgs View Post

I've just been wondering about this virus - but not because of E627K -
it has so many mutation.
Even more Shanghai/37T

I know what you mean. Something very strange going on here. I'm attempting to find time to look more closely at all the other gene segments and isolates from the area. So far, everything else looks like a concensus virus, however, PA position 224 has a bad nucleoid (y), and this is an important position in determining which variant.

**wotan** · June 17, 2009, 10:03 AM

Re: A/Shanghai/71T/2009 acquired E627K

Previous commentary about this type of change in this virus:

http://www.flutrackers.com/forum/sho...d.php?p=239031

For example, the E627K mutation in the former bird PB2 (substituting a K [lysine] for an E [glutamic acid] at position 627 of PB2) has been put forward as a sign that an avian virus is mutating to one adapted to humans. This virus retains E at 627 but is happily adapted to humans. Several other changes thought to be related to human adaptation are not present, either. The authors conclude the obvious:
Together these data suggest that other previously unrecognized molecular determinants are responsible for the ability of the 2009 A(H1N1) virus to replicate and transmit in humans.

I've done some cursory looking but so far I am not entirely sure what this change might portend. Would this make the virus potentially even more pathogenic? From browsing the site I see some reports that this change does just that in some of the H5N1 isolates. Unfortunately I am still out of my league here. I guess sometime I should buckledown and get a better understanding of genetics in general and flu genetics in particular.

**gsgs** · June 17, 2009, 10:07 AM

Re: A/Shanghai/71T/2009 acquired E627K

Code:

                                       00000000000000000000000000000000000000000000111111111111111111111111111111111111111222222222222222222222 0000000000000000000000000000000000000000000011111111111111111111111111111111111222222222222 00000000000000000000000000000000000000000000001111111111111111111111111111111111112222222 00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000011111111111111111111111111111111111111111111111111111 000000000000000000000000000000000000000000000000000000000000000000111111111111111111111 0000000000000000000000000000000000000000000000000000000000000000000000111111111111111111111111 00000000000000000000000000000000000000000000 00000000000000000000000000000000000000000000000000000000 
                                       00000000000001112222333344444455556677788899000122223333333334444455555666677777889000000111111111222222 0000000111111111223333444445555666666778899900111112335566666667777789999999999000001112222 00000001111122333345555556666677777888888999990000111112222222333345556667777889990000111 00000011111111122222222333333333444444555555556666666667777777777777888888888888888999999900000000011111111122222222233333444444445555556666666 000000000001111111112222222223333333444445555566666777777888888899000111111112223334444 0000000111111111112222222233333333334444444566666667777777788889999999000000001111222223333334 01111112233333444445566666677788888888899999 00000011222222222333444444444555566666677777777788888888 
                                       00000111134782790248007824577844683714904857146701890135567891133433799368912258774233379000345569124478 0012334455678899290238156781147003689382601758068894891701244990456760012346999033471260026 00345696778905015794556780137902579024889012332246337891113356077835785670467470482479034 01112312334446800114699012345678033459002346773445566880011122557899022333567777799022338900011256824666777911125688923479002356783566781148899 001112466881135778894566677890167899024584567704668025668011457717228112334484672463449 0114679000000235663444889901125568990111256833569992445566814790234558044556893457234581233590 40125680800449233692500678912611124588935667 13578903025677799146003445688234745577722367888911223444 
                                       56789012562286787252399501313167104147980810370308148481367302728504705950512855295802803158323830144940 3598560369202956570171102095981036350295135389915825972140078261380621902672245013068442399 58001662050825684959891983600120277639452933064749189642490664446774563979153288468604595 46892728012576979699158827681631534565578477361037859172567936163158478237170137914014076615624528020148239845836312690918389755316836941747959 890127747464729230664134706281352467267907044649594171673439863928797783143668663984363 5256055012347676898047374835624881368158633807167893266728636346005451047592021256105637902271 52142598009396589422806595673656732923239093 26403423468215901197066496089027291913619895458556239012 
-codon-position------------------------2 12 12     1     2   11    21 1 112  11   12 1    1   1 1  121112 12 21   1     11 211 2122  21   1 2    2112 12   22  1    1    2 2 21    1       12 2   1  2 222  1 1   2 221221   2 2 2    1 1 1 22 1    21  1    1   1    1 11  2 221 2 1 12  11 1 1 1  21  212 21   2 1 211          2   11 111121211 1  2    112      1  121  1   1   111 12     2 2  1 21   2 12 2  1 1       12 2 11 22      12  12  22  1  12  211  1 2 1  1    1  1 2 12  211 2    12  1122     1112   1     11 1 112  21112    21    1 1121    1  1 2    2 2  1  212 122 2  11 1112 1  11 12     11  1  1  12  12 1        2   1 1  2     2     22  1 22     12  11  11 2 12     211   12 1121 11 2  1    121 1 1 112 2 211111 2 12 11121 22111  11122 2  12 12 
---Index-------------------------------AGAGAATAAGCTACAGGAAGGCCAAATGAGGCACGCGAGGCCGATCAGGAACGCCATAACCCAAGACCATCGGGATAATCTGGTAGGCGGAGTCAGGCAAGCCG GACCTTGAGAGCCAGCGCACGGATCCAAACGCGGAATTCCAACAAGCGTAGAGTTGTAAATAAATGTAGAATAATCTCCTAGGCGGGGACA AATGGATCGGATCCGTTGACTCAGATGTTGTCAAGGCGCGGATTCGCGTAAGTGAAGGATATTCTGCGCAGGGCACGCGGTGGTCCTTG AGAGCGGTACACTGGGGTCGCATATACGGGGACTCGAAGTACAACGAGTGTGCCGACATAAGGGCGAGGGAGCATCCGTATGAGCAGCTCGGAGCACGGGCTCGAGTACAGCAAAGCGGGAAGCACCGGAAGGGACCTGAATT CTCAAAGGATTACCTCACAACGACTGAAGGAACTTCTCGGTGAAGGAGTCACAGCTGAAATGTGCTGAGACGTCGAAGAAAGGCGTG ACAATATATTAGATTCTGGGTGAGTTTTGAGCCGCCAGTCCCTTCAGTTGTAAGATGCGCTGCGAGACACAATACCGCGCTTTAGGGCATCACT CAACTGGAGCCGCCCAGCGGAGCAGCCCGCACTTTCCGGGTTTG CCCGGTTGCATCTAGAATGATGCGTGGTAGGGCGGGGGAGGCTAACCAGCCGTGAT 

256 >A/Shanghai/71T/2009/05/31         .................................................................................A...AA..A.A....A....... ...............................................A........................................... ............................Y............................................................ ..................................................A............................................................................................ ............................A............................GT..A............AG.A......... ............................A..............C......................................C..AA....... ..................A..A...................... ...................G................................----       28     28 ,     24     24    256:>A/Shanghai/71T/2009/05/31  
268 >A/NY/20/2009/04/25                ................................................................................................A....... ........................................................................................... ......................................................................................... -----.............................................A......................................T.AG-------------------------------------------------- ............................A.............................................A..A......... ............................A.......................G.......................................-- ..................A..A...................... ...................G....................................       70     70 ,     13     13    268:>A/NY/20/2009/04/25                
274 >A/Shanghai/1/2009/05/23           .........................G........................G.............................................R....... ...............................................A........................................... ...A..................................................................................... ..................................................A................................................................A.......T................... ............................A.............................................A..A......... ............................A.......................G......................................... ..................A..A...................... ................G..G........G..A........A...........----       24     24 ,     20     20    274:>A/Shanghai/1/2009/05/23           
275 >A/Shanghai/37T/2009/05/24         ....................A....G........................G.............................................A....... ...............................................A........................................... ...A..................................................................................... ..................................................A................................................................A.......T................... ............T...............A.............................................A..A......... ............................A...................GTG.G..A.........T............................ ..................A..A......A............... ................G..G....................A...........----       30     30 ,     26     26    275:>A/Shanghai/37T/2009/05/24         



256 >A/Shanghai/71T/2009/05/31         


PB2:.......A...AA..A.A....A....... 


1111111111111222222222222222222222
5666677777889000000111111111222222
9368912258774233379000345569124478
5950512855295802803158323830144940

CGGGATAATCTGGTAGGCGGAGTCAGGCAAGCCG

G1879A,G2032A,G2038A,G2101A,G2108A,G2163A

G1879A must be E627K with amino-acids

**gsgs** · June 17, 2009, 10:09 AM

Re: A/Shanghai/71T/2009 acquired E627K

I'm wondering whether they maybe grew it extensively in monkey cells or such.
The numbering 71T looks unusual

**Mamabird** · June 17, 2009, 10:18 AM

Re: A/Shanghai/71T/2009 acquired E627K

Originally posted by gsgs View Post

I'm wondering whether they maybe grew it extensively in monkey cells or such.
The numbering 71T looks unusual

Cannot tell by looking at the GenBank description. But something is very strange about PB2.

Please be aware also that this virus looks in all respects like the variant "iv" types dominated by the New York sequences, however, NA is a mixture that is predominately found in swine viruses. I have not found any human infection isolates with this mix at positions 106 and 247 of NA.

**gsgs** · June 17, 2009, 10:24 AM

Re: A/Shanghai/71T/2009 acquired E627K

some other (amino-acid) mutations in the neighborhood.
So, this was a difficult task for the virus ?!

Code:

   601 qqmrdvlgtf dtvqiikllp faaappkqsr mqfssltvnv rgsglrilvr gnspvfnynk
                                   E
   661 atkrltvlgk dagaltenpn egtsgvesav lrgflilgke nkkygpalsi nelsnlakge
                         D D                       D R

**Mamabird** · June 17, 2009, 10:32 AM

Re: A/Shanghai/71T/2009 acquired E627K

Originally posted by gsgs View Post

some other (amino-acid) mutations in the neighborhood.
So, this was a difficult task for the virus ?!

Code:

   601 qqmrdvlgtf dtvqiikllp faaappkqsr mqfssltvnv rgsglrilvr gnspvfnynk
                                   E
   661 atkrltvlgk dagaltenpn egtsgvesav lrgflilgke nkkygpalsi nelsnlakge
                         D D                       D R

Yes, and the interesting thing is that with respect to this last set of changes shown above, an exact match is with:

A/swine/Hong Kong/NS29/2009

So, we have either had some sort of reassortment/recombination event, or this is simply "lab error". If the former, then "Houston, ugh, we have a problem."

**HenryN** · June 17, 2009, 10:37 AM

Re: A/Shanghai/71T/2009 acquired E627K

Originally posted by wotan View Post

Previous commentary about this type of change in this virus:

EM - Swine flu: genetics of the novel virus - FluTrackers News and Information

http://www.flutrackers.com/forum/showthread.php?p=239031

Commentary and analysis by FT member Revere: The Editors of Effect Measure are senior public health scientists and practitioners. Paul Revere was a member of the first local Board of Health in the United States (Boston, 1799). The Editors sign their posts "Revere" to recognize the public service of a professional forerunner better known for other things.

I've done some cursory looking but so far I am not entirely sure what this change might portend. Would this make the virus potentially even more pathogenic? From browsing the site I see some reports that this change does just that in some of the H5N1 isolates. Unfortunately I am still out of my league here. I guess sometime I should buckledown and get a better understanding of genetics in general and flu genetics in particular.

This was discussed in May as a "likely" acquisition

<a rel="nofollow" href="http://www.recombinomics.com/News/05100901/Swine_H1N1_WA_Fatality.html">Commentary</a>

The rapid spread in the human population increases the likelihood of co-infection with H1N1 seasonal flu and the acquisition of key polymorphisms linked to adaptation in human hosts. Two likely acquisitions are NA H274Y and PB2 E627K, which are fixed in human H1N1.

**gsgs** · June 17, 2009, 10:40 AM

Re: A/Shanghai/71T/2009 acquired E627K

maybe I can add the HK sequence later...

Code:

                             001122222 1 0 011 00000111 00000000111 000 00000 
                             342800111 1 0 624 12888112 35666779222 467 23457 
                             048733006 6 4 580 19015444 18999453258 902 96842 
                             311928183 1 0 828 78436368 68789270163 203 17979 
-codon-position--------------   11112    1 111  1  1    1 12 11  22      1 1  
Index------------------------GAAGGGGGA G G AGT CAAAGAAA ATTGTGTGTGG AAG AGAGG 
A/Shanghai/71T/2009/05/31    ...AAAAA. A . ..C ..GTA.G. .C...A..CAA ... .....
A/Shanghai/1/2009/05/23      .GG.....R A A .A. ........ ........... ... G.GAA
A/Shanghai/37T/2009/05/24    AGG...... A A .A. T....... ..GTG.AT... ..A G...A
A/******/index/2009-02-01    ........G . . T.C .G...G.G G....A..... GG. .A...
A/******/Cancun/2009-04-15   ......... . . ... ........ ........... ... .....

**sharon sanders** · June 17, 2009, 10:45 AM

Re: A/Shanghai/71T/2009 acquired E627K

Doesn't this change make Swine flu more transmissible? It is very transmissible already. Does this make a swine flu infection more lethal?

**Mamabird** · June 17, 2009, 10:52 AM

Re: A/Shanghai/71T/2009 acquired E627K

Originally posted by Florida1 View Post

Doesn't this change make Swine flu more transmissible? It is very transmissible already. Does this make a swine flu infection more lethal?

The acquisition of Lysine at 627 of PB2 allows the virus to replicate more readily at cooler temperatures, meaning upper respiratory system, and therefore could make the virus more transmissable. Sneezes and coughs would spread higher viral loads into the air than is likely going at present with the Swine Flu viruses.

Once the virus spreads more readily throughout a population with no immunity to the virus, then one would expect substantially more hospitalizations and deaths, especially for those with underlying health conditions. So, one (transmission) sort of goes with the other (pathogenicity) to some extent for those at risk.

**kent nickell** · June 17, 2009, 10:59 AM

Re: A/Shanghai/71T/2009 acquired E627K

It would also seem that with the development of a more mammalian type of replication gene that higher viral loads could develop quicker in individual patients perhaps leading to some of the faster development of disease we are seeing and be more difficult to fight off. Also the shortened incubation time could increase transmission rates...

**HenryN** · June 17, 2009, 11:00 AM

Re: A/Shanghai/71T/2009 acquired E627K

Travel log

gb|GQ229297.1| Influenza A virus (A/swine/Hong Kong/NS1659/20... 30.2 45
gb|GQ253501.1| Influenza A virus (A/Shanghai/71T/2009(H1N1)) ... 30.2 45
gb|DQ991325.2| Influenza A virus (A/chicken/Italy/5093/99(H7N... 30.2 45
gb|DQ991309.1| Influenza A virus (A/ostrich/Italy/2332/00(H7N... 30.2 45
gb|DQ991301.1| Influenza A virus (A/ostrich/Italy/2332/00(H7N... 30.2 45
gb|AF258847.1| Influenza A virus (A/Hong Kong/485/97(H5N1)) R... 30.2 45
gb|AF258839.1| Influenza A Virus (A/Hong Kong/483/97(H5N1)) R... 30.2 45
gb|AY342413.1| Influenza A virus (A/Netherlands/219/03(H7N7))... 30.2 45
gb|CY004101.1| Influenza A virus (A/laughing gull/NJ/276/1989... 30.2 45
gb|AF084263.1|AF084263 Influenza A virus (A/HongKong/485/97(H... 30.2 45
gb|AF084262.1|AF084262 Influenza A virus (A/HongKong/483/97(H... 30.2 45
emb|AJ404632.1| Influenza A virus pb2 gene for polymerase Pb2... 30.2 45