Announcement

**NS1** · December 31, 2010, 06:29 PM

UK Rise in Neuraminidase Inhibitor Anti-Viral Drug Resistance

UK Rise in Neuraminidase Inhibitor Anti-Viral Drug Resistance

The UK HPA Weekly National Influenza Reports covering the emerging epidemic from the past two weeks (Week 51 and Week 52) provide insight into data scarcity surrounding anti-viral drug resistance.

Oseltamivir-resistance may be determined genetically from a Single Nucleotide Polymorphism (SNP) H275Y on the Neuraminidase. Clinical anti-viral resistance and / or ineffectiveness in Pandemic H1N1 Influenza continues to manifest much more widely than can be attributed to the genetic variance of NA 275Y. In the future, other factors may be identified as genetically leading to the clinical manifestations in cases that do not demonstrate H275Y, but for the moment, the measurement is at that single change.

The HPA Week 51 data reported 3 TmX cases from 402 tested (~0.75%).
The HPA Week 52 data reported 5 TmX cases from 336 tested (~1.49%).

As you can see, the percentage of resistant cases week over week increased by 99%. Unfortunately, data sparsity alongside the fact of taking percentages of percentages may not allow this figure to be fully reliable for decision-making.

On the other hand, in a crisis when faced with limited testing capacity and limited testing foundation, these are the types of acceleration / deceleration calculations that must be made. Data that is available is used. GeneWurx would like to see clinical meta-data paired with genetic sequences to assist in pinpointing various HA polymorphisms that may also be associated with drug resistance, such as those trailing HA aa500.

GeneWurx has prepared an Excel spreadsheet so that the public may track any ongoing official and / or unofficial data concerning Anti-Viral resistance patterns.

GeneWurx_UK_2010_2011_Severe_Wave_TmX_v0.xls

Bear in mind that a recent seasonal influenza rapidly progressed from Anti-Viral sensitivity to Anti-Viral resistance across the world in less than one full season when the percentage of strains demonstrating NA H275Y reached approximately 2%.

More than 100 drug-resistant human Pandemic H1N1 sequences are on file considering just North America and Asia. Washington01_2010_04_02_TmX from the United States registered with 33 polymorphisms across the HA and NA gene segments. In August 2010, GeneWurx evaluated 7 sequences from Japan with extensive HA diversity and H275Y TamiFlu Resistance.

With drug resistant, hypermorphic strains carrying shared HA polymorphisms now being documented across a wide geography, will the resistant 2% begin to spread in Winter 2010-2011?

**NS1** · January 1, 2011, 03:31 AM

HA 158E in Cameroon Pair with Additional HA Changes Correlated to Anti-Viral Resistance

HA 158E in Cameroon Pair with Additional HA Changes Correlated to Anti-Viral Resistance

The UK National Institute for Medical Research published a group of sequences on 2010-12-30 at GISAID.  One group originated from the Centre Pasteur du Cameroun.

HA 158E, a polymorphism associated with Vaccine Escape, appears in two Cameroon sequences upon a highly plastic background that is demonstrated worldwide, including multiple non-adjacent, coastal areas of the United States and in Australia on a background that may be permissive to HA 230I.

This Cameroon background has additionally been conserved in domestic poultry Pandemic H1N1 from Canada.

The most recent sequence taken in April 2010, Cameroon10v_1090_2010_04_08, also carries HA syn223V just upstream of the 225 amino acid position that is so often tracked.  HA syn223V has been co-located with 454N in Texas45131774_2009_09_13.  454N and other changes at 454 are highly correlated to the most recent UK sequences on file and to a chain of sequences spanning Australia before the UK and Iran after the UKWhiteChapel4880374_2M_2010_11_28 <a href="http://www.flutrackers.com/forum/showpost.php?p=384242&postcount=139" target="_blank">sample</a>.  The related hypermorphic Australian sequence, OzVictoria508_9F_2010_07_24, shares <a href="http://pf11.blogspot.com/2010/09/australia-shows-novel-ha-238d-in-august.html" target="_blank">8 changes </a>with Cameroon.

Notice that the syn254P is has been found on a Japanese TamiFlu Resistant sequence.  523A, which is found at various points on Vaccine Escape and TamiFlu Resistant sequences, is also contained within the potential UK donation reservoir from Australia.

Based on these updates from NIMR, potential exists for a 158E emergence in the UK.

GeneWurx has prepared an <a href="http://genewurx.com/data/GeneWurx_UK_December_Emerging_Genetics_v2.xls" target="_blank">Excel spreadsheet</a> investigating potential genetic acquisition in the currently <a href="http://www.flutrackers.com/forum/showthread.php?t=156569" target="_blank">uncharted severe</a> Pandemic H1N1 wave in the UK.  In Version 2 of this spreadsheet, the Cameroon 158E sequence takes Column W and provides homology with potential predecessors to one UK White Chapel <a href="http://www.flutrackers.com/forum/showpost.php?p=384072&postcount=119" target="_blank">sequence</a> of interest.

<a href="http://genewurx.com/data/GeneWurx_UK_December_Emerging_Genetics_v2.xls" target="_blank">GeneWurx_UK_December_Emerging_Gene tics_v2.xls</a>

. . . . Cameroon10v_1090_2010_04_08 (
. . . . . . . . 35I,
. . . . . . . . 114L,
. . . . . . . . syn152I,
. . . . . . . . 158E,
. . . . . . . . syn219I,
. . . . . . . . syn223V [Thailand34_9913_2010_07_14,
. . . . . . . . . . . . . . Texas45131774_2009_09_13],
. . . . . . . . syn254P [Kumamoto2_2010_01_14_TmX],
. . . . . . . . syn276H,
. . . . . . . . syn402H,
. . . . . . . . syn419L,
. . . . . . . . syn456L,
. . . . . . . . 463V,
. . . . . . . . 523A [OzSydney217_2010_09_19 with 188T,
. . . . . . . . . . . . . OzVictoria508_9F_2010_07_24,
. . . . . . . . . . . . . Montana02_2010_04_07_VxX,
. . . . . . . . . . . . . Shizuoka_C21_2010_01_20_TmX])

. . . . Cameroon10v_813_2010_03_23 (
. . . . . . . . 35I,
. . . . . . . . syn152I,
. . . . . . . . 158E mix wt,
. . . . . . . . syn219I,
. . . . . . . . syn254P,
. . . . . . . . syn276H,
. . . . . . . . HA truncated after aa396)

Supporting Sequences

. . . . OzVictoria508_9F_2010_07_24 (
. . . . . . . . 35I [H5N1],
. . . . . . . . 88P [H2N3, H5N1, H11],
. . . . . . . . . . . [HunanHechengSWL1616_2009-11-23,
. . . . . . . . . . . KoreaAF2376_2009_10_27
. . . . . . . . . . . . . . . with 280A and 290K
. . . . . . . . . . . Nevada15_9F_2009_09_10
. . . . . . . . . . . . . . . with 22I, 225E, 256F, 299Y,
. . . . . . . . . . . . . . . . . . 299Y, 300S, syn384S,
. . . . . . . . . . . GermanyCologne13_2009_06_29
. . . . . . . . . . . . . . . with 35I, 38V, syn108L,
. . . . . . . . . . . . . . . . . . syn205G, 206s, syn276H],
. . . . . . . . syn102E [SingON2407_2009_12_13,
. . . . . . . . . . . . . . . Singapore544_2009_12_10,
. . . . . . . . . . . . . . . Brussels243_2009_11_09
. . . . . . . . . . . . . . . . . . . . with syn44L and 89G],
. . . . . . . . syn152I [CalifVRDL115_2009_12_04,
. . . . . . . . . . . . . . . NY6939_2009_12_11,
. . . . . . . . . . . . . . . tkOntarioFAV117_1C_2009_12_07
. . . . . . . . . . . . . . . . . . . . with 35I, syn219I, syn276H,
. . . . . . . . . . . . . . . . . . . . . . . syn456L, 463V, 523A,
. . . . . . . . . . . . . . . England1050_2009_12,
. . . . . . . . . . . . . . . Scotland103_2009_12,
. . . . . . . . . . . . . . . England1051_2009_12,
. . . . . . . . . . . . . . . ItalyAncona451_2009_11_27_f,
. . . . . . . . . . . . . . . NY6607_2009_11_24,
. . . . . . . . . . . . . . . CalifVRDL107_2009_11_15,
. . . . . . . . . . . . . . . CalifVRDL101_2009_11_05,
. . . . . . . . . . . . . . . DC_114_2009_11_04,
. . . . . . . . . . . . . . . England94800096_2009_11,
. . . . . . . . . . . . . . . Calif_SD35_2009_10_26,
. . . . . . . . . . . . . . . NY5447_2009_10_23,
. . . . . . . . . . . . . . . CalifVRDL84_2009_10_09,
. . . . . . . . . . . . . . . CalifVRDL87_2009_10_09,
. . . . . . . . . . . . . . . IndiaPune6196_2009_08,
. . . . . . . . . . . . . . . IndiaDhule9433_2009_08,
. . . . . . . . . . . . . . . SantoDomingoWR1057N_2009_07_02,
. . . . . . . . . . . . . . . SantoDomingoWR1058N_2009_07_02,
. . . . . . . . . . . . . . . SantoDomingoWR1059N_2009_06_30],
. . . . . . . . 206S,
. . . . . . . . syn219I [CalifVRDL115_2009_12_04
. . . . . . . . . . . . . . . . . with 35I, syn152I, syn276H,
. . . . . . . . . . . . . . . . . . . . syn456L, 463V, 523A,
. . . . . . . . . . . . . . FL_Pen213_2009_11_17
. . . . . . . . . . . . . . . . . . . . with 35I, syn152I, 273A,
. . . . . . . . . . . . . . . . . . . . syn456L, 463V, 523A,
. . . . . . . . . . . . . . CalifVRDL107_2009_11_15
. . . . . . . . . . . . . . . . . . . . with 35I, syn152I, syn276H,
. . . . . . . . . . . . . . . . . . . . syn456L, 463V, 523A,
. . . . . . . . 238D (GAc) [H2N3, H7N3, H7N7],
. . . . . . . . . . . . . . . . . . [Belgorod2_2010-03-15 (GAt),
. . . . . . . . . . . . . . . . . . Kaliningrad01_2009_11_02 (GAt)
. . . . . . . . . . . . . . . . . . . . . . . . with 225E and 226R,
. . . . . . . . . . . . . . . . . . AthensINS398_2010-01-24 GAt),
. . . . . . . . . . . . . . . . . . KaliningradCRIE_DA_2009-09-26 (GAt),
. . . . . . . . . . . . . . . . . . KaliningradCRIE_KG_2009-09-25 (GAt),
. . . . . . . . . . . . . . . . . . KaliningradCRIE_MA_2009-09-25 (GAt),
. . . . . . . . . . . . . . . . . . KaliningradCRIE_SHD_2009-09-25 (GAt),
. . . . . . . . . . . . . . . . . . KaliningradCRIE_ZD_2009-09-25 (GAt)],
. . . . . . . . syn247A [Belize8756_2009_10_08,
. . . . . . . . . . . . . . . Singapore93_2009_06_22]
. . . . . . . . syn254P,
. . . . . . . . 272G [Niigata19_2009_12_31,
. . . . . . . . . . . . GuangdongSWL36_2009_11_29],
. . . . . . . . syn276H [1918, S5],
. . . . . . . . syn388K [H5N1],
. . . . . . . . . . . . . . . [NagasakiHA_10_28_2010_03_23
. . . . . . . . . . . . . . . . . . . . . with 22I,
. . . . . . . . . . . . . . . NagasakiHA_10_26_2010_03_15
. . . . . . . . . . . . . . . . . . . . . with 22I, syn103E,
. . . . . . . . . . . . . . . NagasakiHA_10_24_2010_03_08
. . . . . . . . . . . . . . . . . . . . . with syn103E,
. . . . . . . . . . . . . . . GuangxiLonganSWL1990_2010_02_08
. . . . . . . . . . . . . . . . . . . . . with 453K, syn462E,
. . . . . . . . . . . . . . . JiangxiDonghuSWL15_2010_01_04
. . . . . . . . . . . . . . . . . . . . . with syn106E, 149R, syn456L (TTg),
. . . . . . . . . . . . . . . ViennaINS142_2009_11_26
. . . . . . . . . . . . . . . . . . . . . with syn97D, 99T,
. . . . . . . . . . . . . . . CzechUsti208_2009_11_25
. . . . . . . . . . . . . . . . . . . . . with 268T,
. . . . . . . . . . . . . . . GhanaFS_1921_2009_11_11,
. . . . . . . . . . . . . . . Alaska44_2009_11_17
. . . . . . . . . . . . . . . . . . . . . with syn275V, 276N,
. . . . . . . . . . . . . . . CalifVRDL76_2009_09_21
. . . . . . . . . . . . . . . . . . . . . with syn283Q,
. . . . . . . . . . . . . . . Taiwan206_2009_09_18,
. . . . . . . . . . . . . . . Taiwan177_2009_09_18,
. . . . . . . . . . . . . . . Taiwan167_2009_09_18,
. . . . . . . . . . . . . . . Taiwan156_2009_09_18,
. . . . . . . . . . . . . . . Taiwan143_2009_09_15
. . . . . . . . . . . . . . . . . . . . . with 205E mix,
. . . . . . . . . . . . . . . Utah20_C2_2_2009_07_25_VxX
. . . . . . . . . . . . . . . . . . . . . with 159D, 206S, 227G
. . . . . . . . . . . . . . . Slovenia2687_2009_07_01
. . . . . . . . . . . . . . . . . . . . . with 35I, 206S],
. . . . . . . . syn456L [H5N1],
. . . . . . . . 463V,
. . . . . . . . 523A [Nebraska02_2010_03_11,
. . . . . . . . . . . . NagasakiHA1022_2010_03_01_syn413K,
. . . . . . . . . . . . DomRepublic3768_2009_12_15,
. . . . . . . . . . . . NY6939_2009_12_11,
. . . . . . . . . . . . CalifVRDL115_2009_12_04,
. . . . . . . . . . . . NY6607_2009_11_24,
. . . . . . . . . . . . RheinlandPfalz81_2009_11_23,
. . . . . . . . . . . . Berlin210_2009_11_16,
. . . . . . . . . . . . BadenWurttemberg511_2009_11_16,
. . . . . . . . . . . . CalifVRDL107_2009_11_15,
. . . . . . . . . . . . FL_Pensacola40_2009_11_09,
. . . . . . . . . . . . CalifVRDL101_2009_11_05,
. . . . . . . . . . . . DC114_2009_11_04,
. . . . . . . . . . . . Calif_SD35_2009_10_26,
. . . . . . . . . . . . NY5447_2009_10_23,
. . . . . . . . . . . . CalifVRDL84_2009_10_09,
. . . . . . . . . . . . CalifVRDL87_2009_10_09,
. . . . . . . . . . . . KuwaitN13013_2009_08_31_syn413K])

. . . . CalifVRDL115_2009_12_04 (
. . . . . . . . . . . . 35I [H5N1],
. . . . . . . . . . . . 77N,
. . . . . . . . . . . . syn152I,
. . . . . . . . . . . . syn219I,
. . . . . . . . . . . . syn276H [1918, S5],
. . . . . . . . . . . . syn456L [H5N1],
. . . . . . . . . . . . 463V,
. . . . . . . . . . . . 523A)

. . . . FL_Pen213_2009_11_17 (
. . . . . . . . . . . . 35I [H5N1],
. . . . . . . . . . . . syn152I,
. . . . . . . . . . . . syn219I,
. . . . . . . . . . . . 273A,
. . . . . . . . . . . . syn276H [1918, S5],
. . . . . . . . . . . . syn456L [H5N1],
. . . . . . . . . . . . 463V,
. . . . . . . . . . . . 523A)

. . . . CalifVRDL107_2009_11_15 (
. . . . . . . . . . . . 35I [H5N1],
. . . . . . . . . . . . 39N,
. . . . . . . . . . . . syn152I,
. . . . . . . . . . . . syn219I,
. . . . . . . . . . . . syn276H [1918, S5],
. . . . . . . . . . . . syn456L [H5N1],
. . . . . . . . . . . . 463V,
. . . . . . . . . . . . 523A)

. . . . KoreaAF2376_2009_10_27 (
. . . . . . . . 88P [H2N3, H5N1, H11],
. . . . . . . . . . . . [Victoria508_2010_07_24 with ext changes,
. . . . . . . . . . . HunanHechengSWL1616_2009-11-23,
. . . . . . . . . . . Nevada15_9F_2009_09_10,
. . . . . . . . . . . GermanyCologne13_2009_06_29],
. . . . . . . . 131P,
. . . . . . . . 280A,
. . . . . . . . 290K [HunanHechengSWL1617_2009_11_23],
. . . . . . . . HA truncated after aa386)

. . . . Nevada15_9F_2009_09_10 (
. . . . . . . . 22I,
. . . . . . . . 88P,
. . . . . . . . 225E,
. . . . . . . . 256F,
. . . . . . . . 299Y,
. . . . . . . . 300S,
. . . . . . . . syn384S)

. . . . GermanyCologne13_2009_06_29 (
. . . . . . . . HA truncated until aa28,
. . . . . . . . 35I,
. . . . . . . . 38V,
. . . . . . . . 88P,
. . . . . . . . syn108L,
. . . . . . . . syn205G,
. . . . . . . . 206S,
. . . . . . . . syn276H,
. . . . . . . . HA truncated after aa321)

. . . . Texas45131774_2009_09_13 (
. . . . . . . . syn223V [H5N1, H6N1],
. . . . . . . . 454N [H7N3, H7N7, H9N2]
. . . . . . . . . . . . . . [IndiaPune9355_2009_08 with 225G,
. . . . . . . . . . . . . . IndiaBlore236_2009_06 with 226R,
. . . . . . . . . . . . . . SouthCarolina18_2009_09_16_VxX,
. . . . . . . . . . . . . . FL_Pen210_2009_11_10 with 225E]),

. . . . Shizuoka_C21_2010_01_20_TmX (
. . . . . . . . 22I,
. . . . . . . . syn149K,
. . . . . . . . syn413K,
. . . . . . . . 523A [Extensive US 2010 April & May (10),
. . . . . . . . . . . . on entirely different background,
. . . . . . . . . . . . including Montana02_2010_04_07_VxX]),

. . . . Kumamoto2_2010_01_14_TmX (
. . . . . . . . syn10Y [China22811_2009_12
. . . . . . . . . . . . . . . . . . . with 14 HA changes],
. . . . . . . . 252L [Maryland03_2010_01_13,
. . . . . . . . . . . . Guangdong2361_2009_11_25],
. . . . . . . . syn254P [1918, tn, H5N1]),
. . . . . . . . . . . . . . [Ancona451_2009_11_27_f,
. . . . . . . . . . . . . . Iran15583_2009_11_21
. . . . . . . . . . . . . . . . . . with 16 HA (226R) + 3 NA changes,
. . . . . . . . . . . . . . Iran16677_2009_11_24],
. . . . . . . . syn320G [H5N1],
. . . . . . . . . . . . . . [Yamagata307_2009_09_24
. . . . . . . . . . . . . . . . . . . with 123T, syn134G,
. . . . . . . . . . . . . . Moscow_ION_2009_07_16,
. . . . . . . . . . . . . . Bolivia1263_2009_07_14 with syn107Q,
. . . . . . . . . . . . . . Mie41_2009_07_11 with syn107Q]
. . . . . . . . syn366A (GCa) [H5N1],
. . . . . . . . . . . . . . [Unique to PF11 Asia,
. . . . . . . . . . . . . . Netherlands2143_2009_11_16,
. . . . . . . . . . . . . . Maryland31_2009_11_09,
. . . . . . . . . . . . . . Calif_SD35_2009_10_26,
. . . . . . . . . . . . . . NY5297_2009_10_22,
. . . . . . . . . . . . . . NorthCarolina53_2009_10_18,
. . . . . . . . . . . . . . Stockholm67_2009_07_17,
. . . . . . . . . . . . . . MauritusMPn_2009_07_01,
. . . . . . . . . . . . . . MauritusMPt_2009_07_01,
. . . . . . . . . . . . . . ENG92860032_2009_07,
. . . . . . . . . . . . . . ENG520_2009_06,
. . . . . . . . . . . . . . ENG507_2009_06,
. . . . . . . . . . . . . . WiscS1416_2009_10_26_xL (GCt),
. . . . . . . . . . . . . . TexasJMS385_2009_12_04 (GCt)],
. . . . . . . . syn390N [H2, H3N8, H5, H6, H7N3, H7N7, H9N2, H11],
. . . . . . . . . . . . . . [Calif09_2010_05_11,
. . . . . . . . . . . . . . NY7480_2010_03_01,
. . . . . . . . . . . . . . NY03_2010_02_09,
. . . . . . . . . . . . . . Texas01_2010_01_13,
. . . . . . . . . . . . . . TexasJMS400_2009_12_31,
. . . . . . . . . . . . . . TexasJMS399_2009_12_31,
. . . . . . . . . . . . . . TexasJMS398_2009_12_30,
. . . . . . . . . . . . . . TexasJMS397_2009_12_30,
. . . . . . . . . . . . . . Washington73_2009_12_14,
. . . . . . . . . . . . . . NY6937_2009_12_11,
. . . . . . . . . . . . . . Bishkek03_2009_11_28
. . . . . . . . . . . . . .. . . . . . . . . . with syn131S, 175D,
. . . . . . . . . . . . . . Tomsk06_2009_11_22,
. . . . . . . . . . . . . . Russia200_2009_11_01
. . . . . . . . . . . . . .. . . . . . . . . . with syn131S, 175D,
. . . . . . . . . . . . . . NY5196_2009_10_20,
. . . . . . . . . . . . . . NY5141_2009_10_16
. . . . . . . . . . . . . .. . . . . . . . . . with syn131S,
. . . . . . . . . . . . . . ENG94280034_2009_10_06,
. . . . . . . . . . . . . . Texas45093846_2009,
. . . . . . . . . . . . . . Texas45024243_2009,
. . . . . . . . . . . . . . AfghanistanN10786_2009_09_07
. . . . . . . . . . . . . .. . . . . . . . . . with syn131S,
. . . . . . . . . . . . . . AfghanistanN10760_2009_09
. . . . . . . . . . . . . .. . . . . . . . . . with syn131S,
. . . . . . . . . . . . . . AfghanistanN09787_2009_08
. . . . . . . . . . . . . .. . . . . . . . . . with syn131S,
. . . . . . . . . . . . . . Nepal (Nov)
. . . . . . . . . . . . . . NeimengguHuimin11560_2009_12_30,
. . . . . . . . . . . . . . Kentucky16_2009_07_30],
. . . . . . . . syn466G [H5N1, tn],
. . . . . . . . . . . . . . [Unique to PF11 Japan,
. . . . . . . . . . . . . . ChongqingYuzhong11307_2009_12_15
. . . . . . . . . . . . . .. . . . . . . . . . with 219V,
. . . . . . . . . . . . . . NY6864_2009_12_02
. . . . . . . . . . . . . .. . . . . . . . . . with 530I,
. . . . . . . . . . . . . . NY6909_2009_11_29
. . . . . . . . . . . . . .. . . . . . . . . . with 530I,
. . . . . . . . . . . . . . GuangdongHaizhu1644_2009_11_25,
. . . . . . . . . . . . . . NY6675_2009_11_24
. . . . . . . . . . . . . .. . . . . . . . . . with 530I,
. . . . . . . . . . . . . . DC46_2009_11_03
. . . . . . . . . . . . . .. . . . . . . . . . with 530I,
. . . . . . . . . . . . . . NY4995_2009_10_04
. . . . . . . . . . . . . .. . . . . . . . . . with 530I,
. . . . . . . . . . . . . . CalifVRDL75_2009_09_19
. . . . . . . . . . . . . .. . . . . . . . . . with 119M,
. . . . . . . . . . . . . . Texas45130742_2009_09_13,
. . . . . . . . . . . . . .. . . . . . . . . . with syn227E,
. . . . . . . . . . . . . . Texas45132788_2009_09_13,
. . . . . . . . . . . . . . Texas45120922_2009_09_12,
. . . . . . . . . . . . . . Texas45122282_2009_09_12,
. . . . . . . . . . . . . . Texas45113882_2009_09_11],
. . . . . . . . syn548C [H5N1, 1918, tn]
. . . . . . . . . . . . . . [Unique to PF11 Asia,
. . . . . . . . . . . . . . Bishkek03_2009_11_28
. . . . . . . . . . . . . .. . . . . . . . . . with syn131S, 175D,
. . . . . . . . . . . . . . Russia200_2009_11_01
. . . . . . . . . . . . . .. . . . . . . . . . with syn131S, 175D,
. . . . . . . . . . . . . . NY5141_2009_10_16
. . . . . . . . . . . . . .. . . . . . . . . . with syn131S,
. . . . . . . . . . . . . . AfghanistanN10786_2009_09_07
. . . . . . . . . . . . . .. . . . . . . . . . with syn131S,
. . . . . . . . . . . . . . AfghanistanN10760_2009_09
. . . . . . . . . . . . . .. . . . . . . . . . with syn131S,
. . . . . . . . . . . . . . AfghanistanN09787_2009_08
. . . . . . . . . . . . . .. . . . . . . . . . with syn131S])

**NS1** · January 1, 2011, 09:25 AM

UK Homology on Cameroon Pair Carrying 230I Permissive SNPs

UK Homology on Cameroon Pair Carrying 230I Permissive SNPs

The UK National Institute for Medical Research published a group of sequences on 2010-12-30 at GISAID.  One group originated from the Centre Pasteur du Cameroun.

Two young boys, ages 10 and 7, are part of a transmission chain extended over 13 days. Cameroon10v_00812_7M_2010_03_23 is an exact HA match with Cameroon10v_00751_10M_2010_03_10.

These two sequences carry genetics common to the most recent October and November 2010 UK sequences while combining polymorphisms associated with RBD changes including 230I.  Using domaining produces a clear relationship between Cameroon and the 230I carrier and 230I permissive sequences.  Simple scrolling of the provided spreadsheet demonstrates the relationships.

GeneWurx has prepared an <a href="http://genewurx.com/data/GeneWurx_UK_December_Emerging_Genetics_v3.xls" target="_blank">Excel spreadsheet</a> investigating potential genetic acquisition in the currently <a href="http://www.flutrackers.com/forum/showthread.php?t=156569" target="_blank">uncharted severe</a> Pandemic H1N1 wave in the UK.  In Version 3 of this spreadsheet, this Cameroon representative sequence, Cameroon10v_00812_7M_2010_03_23, takes Column U and provides homology with UK <a href="http://www.flutrackers.com/forum/showpost.php?p=384072&postcount=119" target="_blank">sequences</a> of recent interest.

<a href="http://genewurx.com/data/GeneWurx_UK_December_Emerging_Genetics_v3.xls" target="_blank">GeneWurx_UK_December_Emerging_Gene tics_v3.xls</a>

. . . . Cameroon10v_00812_7M_2010_03_23 (
. . . . . . . . 100N [UKWhiteChapel4780352_2010_10_26
. . . . . . . . . . . . . . . . with 128D, syn131S, syn210S, 377K],
. . . . . . . . syn137A [UKCambridge118_2010_11_19
. . . . . . . . . . . . . . . . . . . . with syn363G, syn455Q, syn474C,
. . . . . . . . . . . . . . . . NorthCarolina56_2009_12_07
. . . . . . . . . . . . . . . . . . . . with 100N, 377K],
. . . . . . . . 218V [Minnesota04_18M_2010_03_22
. . . . . . . . . . . . . . . . with 165N, 230I, syn346G,
. . . . . . . . . . . . . Pennsylvania14_20M_2009_06_07
. . . . . . . . . . . . . . . . with 158E, 523I],
. . . . . . . . syn270I,
. . . . . . . . syn343G,
. . . . . . . . syn350G [IranShiraz1_2010_02
. . . . . . . . . . . . . . . . . . . . with 218A, 228R,
. . . . . . . . . . . . . . . . swThaiCURA4_2009_11
. . . . . . . . . . . . . . . . . . . . with 226R, syn484N],
. . . . . . . . 377K,
. . . . . . . . 457R [swJapanOkinawa2_2005
. . . . . . . . . . . . . . . . with 225G],
. . . . . . . . syn461K [Iran16273_2009_11_22
. . . . . . . . . . . . . . . . . . . . with syn55L, 226R],
. . . . . . . . syn466G [cheetahCA30954_2009_11_17
. . . . . . . . . . . . . . . . . . . . with syn169I, 200S])

. . . . Cameroon10v_00751_10M_2010_03_10 (
. . . . . . . . 100N,
. . . . . . . . syn137A,
. . . . . . . . 218V,
. . . . . . . . syn270I,
. . . . . . . . syn343G,
. . . . . . . . syn350G,
. . . . . . . . 377K,
. . . . . . . . 457R,
. . . . . . . . syn461K,
. . . . . . . . syn466G)

**NS1** · January 2, 2011, 07:26 AM

Cameroon 230I Permissive Sequences Carry H3N8 and H7N7 Zoonotic Matches

Cameroon 230I Permissive Sequences Carry H3N8 and H7N7 Zoonotic Matches

Recently published sequences from Cameroon show homology to backgrounds that have supported HA 230I. Several of these backgrounds carry homology to animal reservoirs and Cameroon follows suit. These two young boys, ages 10 and 7, who were part of a transmission chain extended over 13 days may or may not have had close contact with animals. Cameroon10v_00812_7M_2010_03_23 is an exact HA match with Cameroon10v_00751_10M_2010_03_10.

The sequences are potentially related to the severe wave in the UK that has filled hospitals and, more importantly, Intensive Care Units to capacity (edit S.S.). English elective surgeries are actively being cancelled. Families are being told not to attempt a hospital visit in the case of Influenza due to the infrastructure strain. Emergency departments are forced to place patients on gurneys due to no beds being available while operating theatres and lounges are being hastily converted to patient rooms. These and other escalation procedures are reported in the media to be underway in hospitals throughout the country with several institutions presently indicating "Red" or "Black" alert levels.

Animal influences on the genetics of human-infecting Influenza like the pH1N1 strain may generate extreme outcomes and variant clinical behaviour. In these cases from Cameroon, the syn350G, 457R, syn461K and syn466G, among others, share homology with animal reservoirs as noted on the sequence details. We have discussed widely the HA 188T found in the emerging sub-clade including Australia, the UK and Iran. HA 188T is also found in the H7N7 reservoir, as is the syn350G on these Cameroon sequences.

The 457R and syn466G appear together within the H3N8 reservoir and are paired on a particularly interesting set of related horse and dog sequences from Australia. These two changes fall into a domain band that is related to the emerging sub-clade from Australia to the UK.

canineSydney6525_2007_10_14
canineSydney6692_2007_10_15
equineSydney6085_2007_10_10

GeneWurx_UK_December_Emerging_Genetics_v3.xls

. . . . Cameroon10v_00812_7M_2010_03_23 (
. . . . . . . . 100N [UKWhiteChapel4780352_2010_10_26
. . . . . . . . . . . . . . . . with 128D, syn131S, syn210S, 377K],
. . . . . . . . syn137A [UKCambridge118_2010_11_19
. . . . . . . . . . . . . . . . . . . . with syn363G, syn455Q, syn474C,
. . . . . . . . . . . . . . . . NorthCarolina56_2009_12_07
. . . . . . . . . . . . . . . . . . . . with 100N, 377K],
. . . . . . . . 218V [Minnesota04_18M_2010_03_22
. . . . . . . . . . . . . . . . with 165N, 230I, syn346G,
. . . . . . . . . . . . . Pennsylvania14_20M_2009_06_07
. . . . . . . . . . . . . . . . with 158E, 523I],
. . . . . . . . syn270I,
. . . . . . . . syn343G,
. . . . . . . . syn350G [H7N3, H7N7],
. . . . . . . . . . . [IranShiraz1_2010_02
. . . . . . . . . . . . . . . with 218A, 228R,
. . . . . . . . . . . swThaiCURA4_2009_11
. . . . . . . . . . . . . . . with 226R, syn484N],
. . . . . . . . 377K,
. . . . . . . . 457R [H2N3, H3N8, H4, H5N1, H7N3],
. . . . . . . . . . . . . [swJapanOkinawa2_2005
. . . . . . . . . . . . . . . . . . . with 225G],
. . . . . . . . syn461K [H2N3, H5N1 Human, Civet & Avian, H6N1, H11],
. . . . . . . . . . . . . . . [Iran16273_2009_11_22
. . . . . . . . . . . . . . . . . . . . with syn55L, 226R],
. . . . . . . . syn466G [H2N3, H3N8, H4N8, H6N1, H7N3, H9N2, H10N7],
. . . . . . . . . . . . . . . [cheetahCA30954_2009_11_17
. . . . . . . . . . . . . . . . . . . . with syn169I, 200S])

. . . . Cameroon10v_00751_10M_2010_03_10 (
. . . . . . . . 100N,
. . . . . . . . syn137A,
. . . . . . . . 218V,
. . . . . . . . syn270I,
. . . . . . . . syn343G,
. . . . . . . . syn350G,
. . . . . . . . 377K,
. . . . . . . . 457R,
. . . . . . . . syn461K,
. . . . . . . . syn466G)

**NS1** · January 6, 2011, 07:06 AM

UK Sequences from 2009 Document Transmission of TamiFlu Resistance

UK Sequences from 2009 Document Transmission of TamiFlu Resistance

2011-01-06

The UK Health Protection Agency released a set of 38 English sequences on 2010-01-04 at GenBank, but not from the current 2010 severe wave. These 38 HA and NA publications are delayed more than one year, covering September 10 to November 25, 2009. No sequences are included from the pandemic wave currently circulating.

65% of the English sequences are cross-linked with HA syn413K and NA syn407V. 225E occurs in 5 sequences and 225G in 2 sequences. Person to person transmission of oseltamivir-resistance via NA H275Y is noted within a hematology unit that encompasses 15 of these 38 sequences. All but one of the anti-viral resistant sequences are on a cross-linked background. One simple drug resistant sequence carries 225G on the cross-linked background.

The drug-resistant 15 are unremarkable, but for their simplicity. The 225G sequences and a representative sample of the anti-viral resistant sequences is presented after the complete listing of TmX sequence names sorted by date.

TamiFlu-Resistance by Date

UKEngland94640080_2009_11_04_xL_TmX
UKEngland94640078_2009_11_05_xL_TmX
UKEngland94740137_2009_11_07_xL_TmX
UKEngland00380009_2009_11_07_xL_TmX
UKEngland94740049_2009_11_10_xL_TmX
UKEngland94740139_2009_11_10_xL_TmX
UKEngland00380013_2009_11_12_xL_TmX
UKEngland94740138_2009_11_16_xL_TmX
UKEngland94740140_2009_11_16_xL_TmX
UKEngland94780019_2009_11_17_xL_TmX
UKEngland00380015_2009_11_17_xL_TmX
UKEngland00380018_2009_11_19_xL_TmX
UKEngland94840152_2009_11_19_TmX
UKEngland00380020_2009_11_20_xL_TmX
UKEngland94840153_2009_11_20_xL_TmX

Representative Sequences

. . . . UKEngland93960032_2009_09_10_xL (
. . . . . . . . 225G,
. . . . . . . . 273A,
. . . . . . . . syn413K)

. . . . UKEngland94640080_2009_11_04_xL_TmX (
. . . . . . . . syn77S,
. . . . . . . . 225G,
. . . . . . . . syn413K)

. . . . UKEngland94740049_2009_11_10_xL_TmX (
. . . . . . . . syn77S,
. . . . . . . . syn413K,
. . . . . . . . 475N mix wt)

. . . . UKEngland00380018_2009_11_19_xL_TmX (
. . . . . . . . syn77S,
. . . . . . . . syn96G,
. . . . . . . . 237I,
. . . . . . . . syn413K)

. . . . UKEngland94840152_2009_11_19_TmX (
. . . . . . . . syn77S)

. . . . UKEngland94840153_2009_11_20_xL_TmX (
. . . . . . . . syn77S,
. . . . . . . . syn331G,
. . . . . . . . syn413K)

**NS1** · January 7, 2011, 06:19 AM

Fatal Divergency on 4 UK Zoonotic Sequences

http://pf11.blogspot.com/2011/01/fatal-divergency-on-4-uk-zoonotic.html

** Error on spacing prior to table with sequence name norming **

2011-01-07

Fatal Divergency on 4 UK Zoonotic Sequences

The UK Health Protection Agency released an analysis of the early severe wave today in Eurosurveillance. The requested citation is:

Ellis J, Galiano M, Pebody R, Lackenby A, Thompson C, Bermingham A, McLean E, Zhao H, Bolotin S, Dar O, Watson JM, Zambon M. Virological analysis of fatal influenza cases in the United Kingdom during the early wave of influenza in winter 2010/11. Euro Surveill. 2011;16(1):pii=19760.
Available online:

Eurosurveillance | Virological analysis of fatal influenza cases in the United Kingdom during the early wave of influenza in winter 2010/11

http://www.eurosurveillance.org/ViewArticle.aspx?ArticleId=19760

The 2010/11 winter influenza season is underway in the United Kingdom, with co-circulation of influenza A(H1N1)2009 (antigenically similar to the current 2010/11 vaccine strain), influenza B (mainly B/Victoria/2/87 lineage, similar to the 2010/11 vaccine strain) and a few sporadic influenza A(H3N2) viruses. Clinical influenza activity has been increasing. Severe illness, resulting in hospitalisation and deaths, has occurred in children and young adults and has predominantly been associated with influenza A(H1N1)2009, but also influenza B viruses.

Date of submission: 31 December 2010

No additional sequences appear to have been released with the paper though a very useful phylogenetic chart is provided as Figure 3: Phylogenetic relationship of full-length HA sequences of influenza A(H1N1)2009 viruses from fatal, severe and mild cases in the United Kingdom during 2010.

All four previously released UK sequences from 2010-12-20 are on the Ellis Figure3 1 chart marked as fatality and all four were updated yesterday on GISAID as "Deceased". Two were recent and all four are divergent.

Fatal Sequences from Ellis Figure 3 In GISAID 2010-12-20 Deposit
<TABLE><TBODY><TR><TD>* UKWhiteChapel4880374_2M_2010_11_28_f</TD><TD>= A/England/4880374/2010</TD></TR>
<TR><TD>* UKCambridge118_4F_2010_11_19_f</TD><TD>= A/England/118/2010</TD></TR>
<TR><TD>* UKWhiteChapel4780352_5M_2010_10_26_f</TD><TD>= A/England/4780352/2010</TD></TR>
<TR><TD>* UKBirmingham3220137_44F_2010_08_07_f</TD><TD>= A/England/3220137/2010</TD></TR>
</TBODY></TABLE>

GeneWurx has annotated the Ellis Figure3 1 phylogenetic chart with green boxes next to the four fatal GISAID 2010-12-20 deposited sequences and has proposed a 225G branch due to lack of data transparency.

Preliminary Comments on the Ellis Figure 3
(without the essential corroborating sequences)

The numbering system employed in our analyses requires adding 3 to the amino acid positions indicated in the UK chart.

Notice that the branch polymorphisms are not labeled from that top D97N (100N) upwardly.

The accumulation of 100N, 188T, 377K, 225G and 454N patterns onto the OzBrisbane209_51F_2010_08_09 sequence from the late winter in the Southern Hemisphere. Though parameters are adjustable for the phylogenetic chart, the top section may indicate one or more unmarked branches near the top right. Either publication of the sequences or the notation for the branching polymorphism would be very useful at this time. Are these strictly indicative of the high variability head and tail changes being seen frequently (under aa100, over aa499)?

Is it probable that no instance of change at any amino acid position from 156 to 159 has been elucidated from this wide inspection of the severe wave?

Alternate sub-clade:

By chart appearances, the accumulation of 128D onto the more established backgrounds with 100N and 377K (lower section) creates a fatality risk similar to more recognised severity markers. The bottom fatal sequence designated on the lower branch as A/England/4780352/2010 is identified as UKWhiteChapel4780352_2010_10_26_f in v3 of the GeneWurx Emerging Genetics spreadsheet within column AY and carries three additional silent (synonymous) changes at syn58C, syn131S and syn210S.

Hyper-Zoonotic Polymorphism Details

Please excuse the intermediate markings on these sequences. The following are rough lab notes, but divergence may be ascertained easily.

The common ground among these sequences and those in the database on either side of them temporally, from Cameroon (Sub-clade 1 & Sub-clade 2) and especially Iran, is the high quantity of polymorphisms that are novel or rare to pH1N1 and that also appear in zoonotic reservoirs, particularly H3N8, H5N1 and H7N7.

Even small genetic adjustments from animal vectors into human infections, especially H3N8, may create variant behaviour. This potential era of zoonotic sub-segment spillover merits as much investigation for severity (in combination) as does the recognised 225G.

. . . . UKWhiteChapel4880374_2M_2010_11_28_f (
. . . . . . . . 0A (gCC) [1918 (GCT), S7 (GCT), S5 (GCA)]
. . . . . . . . syn55L [S9, H5N1],
. . . . . . . . . . . . . . [Darwin47_2010_08_09 with syn529L,
. . . . . . . . . . . . . . Iran16273_2009_11_22 with 226R
. . . . . . . . . . . . . . NZ_Waikato2_2010_01_04 with 233H,
. . . . . . . . . . . . . . tkOntarioFAV117_1C_2009_12_07 mult domain matches, et al],
. . . . . . . . 188T [H6N1, H7N7],
. . . . . . . . syn338G [H3N8, H4, H5, H6, sw],
. . . . . . . . . . . . . . . [OzBrisbane209_51F_2010_08_09
. . . . . . . . . . . . . . . . . . . . with 156E & 225G,
. . . . . . . . . . . . . . . Arizona05_2010_05_11 with 0A,
. . . . . . . . . . . . . . . Swine Asia 2005 with 0A, et al]
. . . . . . . . 377K,
. . . . . . . . 454N [H7N3, H7N7, H9N2]
. . . . . . . . . . [Florida14_24M_2010_08_05
. . . . . . . . . . . . . . . . . . with 188T, 454N,
. . . . . . . . . . FL_Pen210_2009_11_10
. . . . . . . . . . . . . . . . . . with 225E,
. . . . . . . . . . SouthCarolina18_2009_09_16_VxX
. . . . . . . . . . . . . . . . . . with 159D, 224K, et al],
. . . . . . . . syn529L (CTt) [Unique to PF11]
. . . . . . . . . . . . . . . . . . . . [S7 (CTt), tn with syn338G (GGg)]
. . . . . . . . . . . . . . . . . . . . [PF11 32 Worldwide (CTa),
. . . . . . . . . . . . . . . . . . . . PF11 5 North America (tTG)],
. . . . . . . . . . . . . . . . . . . . [swThailandCU_CHK4_2009_01 (tTG)
. . . . . . . . . . . . . . . . . . . . . . . . . . with 0A, syn338G, 189T, 377G, syn451K, syn456L])

. . . . UKCambridge118_4F_2010_11_19_f (
. . . . . . . . syn118E tcatttgaaaggtttgaA,
. . . . . . . . 137T [MoldovaG170_2009,
. . . . . . . . . . . . . 41 sequences at GISAID],
. . . . . . . . syn163K,
. . . . . . . . 186P,
. . . . . . . . syn251L gaagcaactggaaatctG,
. . . . . . . . syn293L gctataaacaccagcctT,
. . . . . . . . syn363G [21 sequences at GISAID],
. . . . . . . . syn455Q caAttaaaaaacaatgcc ,
. . . . . . . . syn474C [H3N8],
. . . . . . . . 504G ttaaacagagaagaaatagGt,
. . . . . . . . 513V [1918, S5, tn] Gtttaccagattttggcgatc)

. . . . UKWhiteChapel4780352_5M_2010_10_26_f (
. . . . . . . . syn58C,
. . . . . . . . 100N,
. . . . . . . . 128D,
. . . . . . . . syn131S tcaaacaaaggtgtaacggca,
. . . . . . . . syn210S,
. . . . . . . . 377K)

. . . . UKBirmingham3220137_44F_2010_08_07_f (
. . . . . . . . #8A gcagttctgctatatacattt,
. . . . . . . . 175K aaagtcctcgtgctatgg,
. . . . . . . . 311E Gaaagcacaaaattgaga,
. . . . . . . . 377K,
. . . . . . . . syn385V gtCattgaaaagatgaat,
. . . . . . . . syn451K aagaacttatatgaaaaA,
. . . . . . . . syn454S agTcagttaaaaaacaatgcc,
. . . . . . . . syn494E,
. . . . . . . . 537G [S5] tccctgggggcaatcGgt)

1. Ellis J, Galiano M, Pebody R, Lackenby A, Thompson C, Bermingham A, McLean E, Zhao H, Bolotin S, Dar O, Watson JM, Zambon M. Virological analysis of fatal influenza cases in the United Kingdom during the early wave of influenza in winter 2010/11. Euro Surveill. 2011;16(1):pii=19760. Available online: http://www.eurosurveillance.org/View...rticleId=19760

**NS1** · January 7, 2011, 10:23 AM

Re: UK: Reports of Approximately 57 Deaths and 800+ Patients in intensive care (50 deaths confirmed by HPA as for Jan. 06 2011) due to influenza

The HPA released sequences today at GISAID. 225G only appears twice while instances of 221L and 224K enter the UK geography.

Multiple, hyper-zoonotic sub-clades are circulating with the well-discussed Australian 188T base in place.

Genetic Diversity is the norm.

**NS1** · January 7, 2011, 10:32 AM

Re: UK: Reports of Approximately 57 Deaths and 800+ Patients in intensive care (50 deaths confirmed by HPA as for Jan. 06 2011) due to influenza

A group of the UK sequences appear to be predecessors to Iran. The H3N8 homologies are in place in the UK and Iran while Iran then acquired the H7N7 syn411N. Multi-zoonotic.

Wisconsin08_2010_08_10 has 7 of the same SNPs as IranShahriar5336_2010_12_06. 5 of those 6 are from H3N8 animals.

. . . . IranShahriar5336_2010_12_06 (
. . . . . . . . 137T (aCA) [H3N8 donor aAT, aGT, aGC],
. . . . . . . . 186P,
. . . . . . . . syn297N [H3N8 gadwallRussiaAltai1325_2007_09],
. . . . . . . . . . . . . . . [H5N1],
. . . . . . . . . . . . . . . [Wisconsin08_2010_08_10
. . . . . . . . . . . . . . . . . . . . . . with 39R, syn78S, 137T, 186P, syn297N,
. . . . . . . . . . . . . . . . . . . . . . . . . . syn326S, syn346G, syn388K,
. . . . . . . . . . . . . . . . . . . . . . . . . . syn413K, 444K, syn474C,
. . . . . . . . . . . . . . . CalifVRDL2_2010_01_11
. . . . . . . . . . . . . . . . . . . . . . with syn121P & 502K,
. . . . . . . . . . . . . . . YaroslavlIIV196_2009_12_04_f
. . . . . . . . . . . . . . . . . . . . . . with syn159N, 225G,
. . . . . . . . . . . . . . . WiscD0128_2009_11_15
. . . . . . . . . . . . . . . . . . . . . . with syn343G, 377G, 471H,
. . . . . . . . . . . . . . . Brussels243_2009_11_09
. . . . . . . . . . . . . . . . . . . . . . with syn44L, syn159N & syn323N,
. . . . . . . . . . . . . . . Australia6_2009_07_18
. . . . . . . . . . . . . . . . . . . . . . with syn159N, 233H]
. . . . . . . . syn326S [Wisconsin08_2010_08_10
. . . . . . . . . . . . . . . . . . . . . . with 39R, syn78S, 137T, 186P, syn297N,
. . . . . . . . . . . . . . . . . . . . . . . . . . syn326S, syn346G, syn388K,
. . . . . . . . . . . . . . . . . . . . . . . . . . syn413K, 444K, syn474C,
. . . . . . . . . . . . . . . Zhongyuan1643_2009_11_16
. . . . . . . . . . . . . . . . . . . . . . with 208G],
. . . . . . . . syn383N [H3N8],
. . . . . . . . syn388K [H3N8, H5N1, S7],
. . . . . . . . . . . . . . . [OzVictoria508_2010_07_24
. . . . . . . . . . . . . . . . . . . . . . . with 238D,
. . . . . . . . . . . . . . . swIowa44837_1_2009_11_08_xL
. . . . . . . . . . . . . . . . . . . . . . . with 188R, 225N & 230I,
. . . . . . . . . . . . . . . Utah20_C2_2_2009_07_25_VxX
. . . . . . . . . . . . . . . . . . . . . . . with 159D & 227G, et al],
. . . . . . . . syn411N (AAc) [H7N3 & H7N7 donor ATc],
. . . . . . . . 444K (AAg) [H3N8 gAg],
. . . . . . . . syn474C [H3N8, Avian H1N1 2010],
. . . . . . . . . . . . . . . [Michigan10_2009_06_03 with 137T, 225N, et al])

**NS1** · January 7, 2011, 10:42 AM

Re: UK: Reports of Approximately 57 Deaths and 800+ Patients in intensive care (50 deaths confirmed by HPA as for Jan. 06 2011) due to influenza

158E in a mix found on 188T background. 159K with 128D.

As expected.

**NS1** · January 8, 2011, 02:57 AM

377G in UK Not Notated on HPA Chart

The 377G that is emergent in 2009 Human H5N1 from Dakahlia is also emergent in <?xml:namespace prefix = st1 ns = "urn:schemas-microsoft-com:office:smarttags" /><st1:country-region w:st="on">England</st1:country-region> and <st1:country-region w:st="on"><st1:place w:st="on">Iran</st1:place></st1:country-region>. A recent fatal case from England, UKEngland4500186_2010_11_f, carries the same coding for 377G combined with a 190Y only found elsewhere in 2010 Malmoe Sweden pH1N1 and in Avian H6N1.

The HPA chart of sequences did not notate the 377G branch though 5 English sequences, including this fatal one, appear on the chart carrying the H5N1 Human adaptation.

UKEngland83_2010_10
UKEngland87_2010_10
UKEngland5500192_2010_10
UKEngland119_2010_11
UKEngland4500186_2010_11_f

<?xml:namespace prefix = o ns = "urn:schemas-microsoft-com:office:office" /><o:p></o:p>
Data indicates that this disease is rapidly diversifying by accumulating data from multiple animal reservoirs. The most recent <st1:country-region w:st="on"><st1:place w:st="on">UK</st1:place></st1:country-region> release is essentially divergent using hyper-zoonoses.

**NS1** · January 9, 2011, 07:32 AM

225G Only in 2 Sequences from Severe UK Wave

The UK Health Protection Agency released a group of 37 sequences at GISAID dated 2010-01-05 that appeared sometime after that date. Some of the sequences in this deposit also appear on the Figure 3 Phylogenetic Tree from the HPA Eurosurveilance paper requested to be cited as:
<?xml:namespace prefix = o ns = "urn:schemas-microsoft-com:office:office" /><o:p></o:p>
Ellis J, Galiano M, Pebody R, Lackenby A, Thompson C, Bermingham A, McLean E, Zhao H, Bolotin S, Dar O, Watson JM, Zambon M. Virological analysis of fatal influenza cases in the United Kingdom during the early wave of influenza in winter 2010/11. Euro Surveill. 2011;16(1):pii=19760.
Available online:
http://www.eurosurveillance.org/ViewArticle.aspx?ArticleId=19760
Date of submission: 31 December 2010

The science community expected a full deposit to back the paper, but not all sequences noted on the phylogenetic table were in place at GISAIS as of this 2nd deposit.

The recent GISAID deposit added 4 of the fatalities noted on the phylogenetic tree to the 4 fatalities previously released on 2010-12-20. The previously released sequences were not marked at GISAID with a fatality notation, but now have been notated as "Deceased" as of yesterday. Oddly enough, on the 2010-01-05 deposit, none of the sequences notated as fatal on the phylogenetic tree were marked as to outcome at GISAID?

None of the sequences at the GISAID database that correspond to notated fatalities on the Eurosurveillance paper carry the severity marker of HA 225G.

225G is found on identical HA sequences noted as 2 severe cases.

UKEngland4880378_2010_12
UKEngland4940476_2010_12

The two sequences fall on a 100N, 188T, syn338G, 377K with 454N background. Appended to that background is a silent 179L previously found in US military sequences and as a regional marker in an alternate coding. A silent 448L completes the 225G sequences and is demonstrated in at least on fatal case, including in Russia.

. . . . UKEngland4940476_2010_12 (
. . . . . . . . 100N,
. . . . . . . . syn179L (CTg) [Regional Marker 2009 (tTA)]
. . . . . . . . . . . . . . . . . . . . [TexasAF2588_2009_10_04,
. . . . . . . . . . . . . . . . . . . . TexasJMS404_2010_01_08],
. . . . . . . . 188T,
. . . . . . . . 225G,
. . . . . . . . syn338G,
. . . . . . . . 377K,
. . . . . . . . syn448L [Yakutsk_EAV_2009_11_18,
. . . . . . . . . . . . . . . Yaroslavl_CHMV_2009_11_10_f with 224K & 225G mix],
. . . . . . . . 454N)

. . . . UKEngland4880378_2010_12 (
. . . . . . . . 100N,
. . . . . . . . syn179L,
. . . . . . . . 188T,
. . . . . . . . 225G,
. . . . . . . . syn338G,
. . . . . . . . 377K,
. . . . . . . . syn448L,
. . . . . . . . 454N)

**mixin** · January 9, 2011, 05:33 PM

Re: UK Genetic Evaluation thread

I ran all the HA nucleotides of the UK sequences with gs's program and then grouped them together in a way that looked right. Keep in mind that I'm no scientist. Maybe someone else will see different clades; please feel free to offer opinions.

The severe and fatal cases are marked; notice that about half of them appear on clade B.

Clade A: 451,598,658,1408,1464
G451A,T598C,T658A,T933C,T1020C,T1191C,G1206A,C1245 T,T1374G,C1408T,C1464T(4)
G451A,T598C,T658A,T933C,T1020C,T1191C,G1206A,C1245 T,T1374G,C1408T,C1464T(4)
G451A,T598C,T658A,T933C,T1020C,T1191C,G1206A,C1245 T,T1374G,C1408T,C1464T(4)
G451A,T598C,T658A,T933C,T1020C,T1191C,G1206A,C1245 T,T1374G,C1408T,C1464T(4)
G451A,T598C,T658A,T933C,T1020C,T1191C,G1206A,C1245 T,T1374G,G1403A,C1408T,C1464T(4)
G451A,T598C,T658A,T933C,T1020C,T1191C,G1206A,C1245 T,T1374G,G1403A,C1408T,C1464T(4)

G451A,T598C,T658A,T879C,C1098T,A1172G,G1266A,C1408 T,C1464T,A1568G,G1577T,G1630A(4)
G451A,T598C,T658A,T879C,C1098T,A1172G,G1266A,C1408 T,C1464T,A1568G,G1577T,G1630A(4)
G451A,T598C,T658A,T858C,T879C,C1098T,A1172G,G1266A ,C1408T,C1464T,A1568G,G1577T,G1630A
G451A,T598C,G605A,T658A,A1172G,A1213G,G1266A,C1408 T,C1464T,G1577T,G1630A(4)
G451A,T598C,G610T,T658A,A1172G,G1266A,C1408T,C1464 T,G1577T,G1630A(4) F

G451A,G531A,T598C,T658A,C921T,A1131G,C1408T,C1464T (4)

Clade B: 340,658,1056,1171,1403,1408
G340A,G605C,T658A,T1056C,G1171A,G1403A,C1408T,T165 3C(4)
G340A,G605C,T658A,T1056C,G1171A,G1403A,C1408T,T165 3C(4)
G340A,G605C,T658A,T680C,T1056C,G1171A,G1403A,C1408 T,T1653C(4) F
G340A,G605C,C612T,T658A,T1056C,G1171A,G1403A,C1408 T,T1653C(4)

G340A,A579G,G605C,T658A,C704T,T1056C,G1171A,A1386G ,G1403A,C1408T(4)
G340A,A579G,G605C,T658A,T1056C,G1171A,A1386G,G1403 A,C1408T(4) S
G340A,A579G,G605C,T658A,T1056C,G1171A,A1386G,G1403 A,C1408T(4) S
G340A,A579G,G605C,A611G,T658A,T1056C,G1171A,A1386G ,G1403A,C1408T(4) F
G340A,A579G,G605C,T658A,A716G,T1056C,G1171A,A1386G ,G1403A,C1408T(4) S
G340A,A579G,G605C,T658A,A716G,T1056C,G1171A,A1386G ,G1403A,C1408T(4) S

Clade C: 40,207,605,658,1056,1171,1403,1408,1629
A40G,G207A,G302T,C573A,G605C,T658A,T1056C,G1171A,G 1403A,C1408T,G1629T(4)
A40G,G207A,G515R,G605C,T658A,C816T,T1056C,G1171A,G 1396A,G1403A,C1408T,G1629T(4)
A40G,G340A,A579G,G605C,T658A,C672T,T1056C,G1171A,A 1386G,G1403A,C1408T,G1624A(4)
A40G,G207A,G605C,T658A,T834A,T1056C,G1171A,G1403A, C1408T,G1473A,G1629T(4)
A40G,G207A,G605C,T658A,G832A,T1056C,G1171A,G1403A, C1408T,G1629T(4)
A40G,G207A,G605C,T658A,G1005A,T1056C,G1171A,G1403A ,C1408T,G1629T(4)
A40G,G207A,G605C,T658A,T1056C,G1171A,G1403A,C1408T ,G1629T(4) F
A40G,G207A,G605C,T658A,T1056C,G1171A,C1182T,G1403A ,C1408T,G1629T(4)
A40G,G207A,G605C,T658A,T834A,T1056C,G1171A,G1403A, C1408T,G1629T(4)
A40G,G207A,G605C,T658A,T1056C,G1171A,G1403A,C1408T ,A1435G,G1629T(4) (? F/S)

Odd Ones
C148T,G340A,A424G,A566G,T658A,G684A,C870T,T927C,G1 171A,A1230G,G1326A,C1408T,A1536G(4)
T216C,G340A,A424G,G435A,T658A,C672T,G1171A,C1408T( 4) F
T243C,G340A,A424G,C473T,T658A,G713A,A747G,G1171A,C 1408T,C1627A(4) F
C172T,G360A,A424G,T519A,T658A,G1171A,C1408T(4)
G154A,G207A,G605C,T658A,T1056C,G1171A,C1383A,G1403 A,C1408T,G1524K,G1629T(4)
T17C,G565A,T658A,A973G,G1171A,T1197C,G1395A,C1404T ,C1408T,G1524A,A1651G(4) F
G396A,G451A,G531A,T598C,T658A,A795G,C921T,A1131G,G 1407A,C1408T,C1464T,A1553G,A1579G(4)
G451A,T598C,T658A,T933C,T1020C,T1191C,G1206A,C1245 T,T1374G,C1408T,C1464T(4)

By areas
1 Coventry
4 Newcastle-upon-tyne
3 Oxford
1 Durham
2 Leeds
1 Manchester
4 Birmingham
1 Leicester
1 York
1 Cambridge (Fatal)
6 London
2 Nottingham
3 Whitechapel (2 Fatal)
1 Middlesex
1 North Yorkshire

8 Severe/fatal with no locations given
1 Possible severe/fatal no location

**NS1** · January 9, 2011, 10:01 PM

Re: UK Genetic Evaluation thread

Thank you for evaluating these sequences, mixin.

Bear in mind that a program is most useful when the heuristics and assumptions are fully externalised. We are not in receipt of those information points, so our comments here will be given as one in the dark. We've attempted to gain this required insight in the past without success.

From your narrative and the block of output, we can ascertain that the program did some level of data organisation (unstated) and that you then re-arranged parts of the output based on some secondary heuristics.

Does each line represent one sequence and the nucleotide changes on that sequence? Does the program have a method to effectively label those lines with the sequence names (at the beginning and end)? Does any possibility exist to manage ambiguity codes? Does any possibility exist to notate the amino acid positions in parentheses next to the nucleotide positions [e.g. G451A (137T), T1056C (syn338G), et al] or to provide a separate report notated by amino acid position with silent changes differentiated?

Per line, could we see an automated count of the SNPs (silent and non-syn) and have highlighted the SNPs matching the selected sub-clade standards:

Clade A: 451,598,658,1408,1464
G451A,T598C,T658A,T933C,T1020C,T1191C,G1206A,C1245T,T1374G,C1408T,C1464T[x SNPs, x Silent, x Non-syn] (4)

An output format of .csv would increase ease of visualisation if the changes are properly aligned per dataset. Input into a spreadsheet allows additional automated analyses. Output designed for insertion / update into a relational database is even more useful.

Also note that the sequence deposit does not directly match the Ellis Figure 3 Phylogenetic Tree. So overall count and category counts are very dependent on identifying the individual sequence / sample name.

==

At any rate, the output and the post-processing organisation appears to demonstrate that the selected sub-clades demonstrate a lower CFR than the "Odd Ones"? The odd ones, we suggest, are the sequences that do not pattern onto the major groupings using the unstated parameters and hueristics of the program?

If this statement is true concerning the method of selecting the "Odd Ones", then we may conclude that this category has a CFR of 37.5% (3 of 8) as opposed to much lower death rates on the selected larger groups? In fact, the largest suggested sub-clade has the lowest CFR signalling that transmission v. severity are two different concerns with the current circulating reservoir combinations in the UK.

CFR by Suggested Sub-Clade

37.5% - Odd Ones (3 of 8)
20.0% - Clade B (2 of 10)
20.0% - Clade C (1 or 2 of 10)
08.3% - Clade A (1 of 12)

A higher death rate among unpatterned sequences may potentially signal that the hyper-morphic phase has re-initiated. Our analyses indicate that many of the novel and rare changes incoming to PF11 at this time also exist in animal reservoirs that have been previously related to human infection. Small changes in human influenza matching animal genetics are known to create significant changes in severity levels and viral behaviour.

Hyper-morphism (high change rate) with a significant percentage of animal-matched intake equates to a present hyper-zoonotic set of strains.

This hypothesis appears to agree with your data . . . if we are guessing correctly at the underlying parameters.

**gsgs** · January 9, 2011, 10:07 PM

Re: UK Genetic Evaluation thread

I just found this thread.
When will the sequences be published so we can
verify and discuss it freely ?

Earlier attempts to assign differences in virulence to
different substrains had failed.
Remember Argentina last year, Ukraine, early Mexico.

A complete statistic with the proportion of deaths in the
published (or GISAID) substrains would be useful, though.

calculating % of deaths (or ICU) per mutation is straight forward,
then assign the sums of the values to each virus
then calculate the average for each month and chart
it over time, per country,continent

it has been speculated that more middle-age people are infected
this season vs. more children last season.
And the children die less often from ***, more are immune now,
and that that allone could explain the increased number of deaths.

Do we have UK-deaths by age 2009/10 vs. 2010/11 ?

Virologically it's remarkable that these substrains are new,
they emerged from early Cancun viruses, presumably in Asia
and have nothing in common with the strains circulating
in USA,Europe last season.

These mutations do not occur e.g. in my list of 28 substrains
from Nov.2010

**NS1** · January 9, 2011, 11:07 PM

Re: UK Genetic Evaluation thread

Originally posted by gsgs View Post

I just found this thread.
When will the sequences be published so we can
verify and discuss it freely ?

According to the narrative, these sequences have apparently been
processed through a program of your authorship?

Earlier attempts to assign differences in virulence to
different substrains had failed.
Remember Argentina last year, Ukraine, early Mexico.

Clear indications of severity markers and Vaccine Escape domains are available as are indications of drug resistance.

A complete statistic with the proportion of deaths in the
published (or GISAID) substrains would be useful, though.

Some outdated material has been produced and analysed to little effect due to scarcity and unreliable parameters.

calculating % of deaths (or ICU) per mutation is straight forward,
then assign the sums of the values to each virus
then calculate the average for each month and chart
it over time, per country,continent

Such small point factors are unreliable for many reasons, but, most importantly, due to various synergies among combinations of polymorphisms, some that produce little net effect and others that produce multiplicative effect. The record is observable on these matters.

Calculations based on selected combinations of polymorphisms chosen by frequency / absence on a background among other factors may provide comparisons that feedback to the choice of SNPs to include on that calculation. Due to sparsity of data and clinical meta-data, the calculations must be iterated and interpreted with a high level of earnestness and objectivity.

it has been speculated that more middle-age people are infected
this season vs. more children last season.
And the children die less often from ***, more are immune now,
and that that allone could explain the increased number of deaths.

Do we have UK-deaths by age 2009/10 vs. 2010/11 ?

The data have been produced by HPA and provided in spreadsheet format. Transparency and timely reporting is not occurring, nor do we expect valid data in the near term.

GeneWurx_UK_ICU_Categories_v1.xls

Virologically it's remarkable that these substrains are new,
they emerged from early Cancun viruses, presumably in Asia
and have nothing in common with the strains circulating
in USA,Europe last season.

These mutations do not occur e.g. in my list of 28 substrains
from Nov.2010

Though novelty and divergency is now the norm in the UK reservoir, one of the strains that was previously found in a robust form during the late Australia winter season is easily trackable.

Emergence began in late 2009 in the United States of the most frequent background and continued via domaining during the early part of 2010 and the summer in the Northern Hemisphere, translating well into the winter in the Southern Hemisphere.

GeneWurx analyses show a pattern of emergence throughout the world of this particular currently low CFR strain. What will happen next may be more predictable should sequences be provided in a timely fashion in conjunction with mild, severe and fatal cases.

GeneWurx_UK_December_Emerging_Genetics_v3.xls