Announcement

Collapse
No announcement yet.

PNAS: A distinct lineage of influenza A virus from bats

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • PNAS: A distinct lineage of influenza A virus from bats

    Published online before print February 27, 2012, doi: 10.1073/pnas.1116200109 PNAS February 27, 2012


    A distinct lineage of influenza A virus from bats

    Suxiang Tonga,1,
    Yan Lia,
    Pierre Rivaillerb,
    Christina Conrardya,
    Danilo A. Alvarez Castilloc,
    Li-Mei Chenb,
    Sergio Recuencod,
    James A. Ellisond,
    Charles T. Davisb,
    Ian A. Yorkb,
    Amy S. Turmelled,
    David Moranc,
    Shannon Rogersa,
    Mang Shia,
    Ying Taoa,
    Michael R. Weile,
    Kevin Tangf,
    Lori A. Rowef,
    Scott Sammonsf,
    Xiyan Xub,
    Michael Fracef,
    Kim A. Lindbladeg,
    Nancy J. Coxb,
    Larry J. Andersona,
    Charles E. Rupprechtd,1, and
    Ruben O. Donisb,1

    + Author Affiliations

    aDivision of Viral Diseases,
    bInfluenza Division,
    dDivision of High Consequence Pathogens and Pathology, and
    fDivision of Scientific Resources, Centers for Disease Control and Prevention, Atlanta, GA 30333;
    eEmory University, Atlanta, GA 30322;
    cCenter for Health Studies, Universidad del Valle de Guatemala, 01015, Guatemala City, Guatemala; and
    gInternational Emerging Infections Program, Centers for Disease Control and Prevention Regional Office for Central America and Panama, 01015, Guatemala City, Guatemala

    Edited by Robert A. Lamb, Northwestern University, Evanston, IL, and approved January 17, 2012 (received for review October 7, 2011)

    Abstract

    Influenza A virus reservoirs in animals have provided novel genetic elements leading to the emergence of global pandemics in humans. Most influenza A viruses circulate in waterfowl, but those that infect mammalian hosts are thought to pose the greatest risk for zoonotic spread to humans and the generation of pandemic or panzootic viruses. We have identified an influenza A virus from little yellow-shouldered bats captured at two locations in Guatemala. It is significantly divergent from known influenza A viruses. The HA of the bat virus was estimated to have diverged at roughly the same time as the known subtypes of HA and was designated as H17.

    The neuraminidase (NA) gene is highly divergent from all known influenza NAs, and the internal genes from the bat virus diverged from those of known influenza A viruses before the estimated divergence of the known influenza A internal gene lineages.

    Attempts to propagate this virus in cell cultures and chicken embryos were unsuccessful, suggesting distinct requirements compared with known influenza viruses.

    Despite its divergence from known influenza A viruses, the bat virus is compatible for genetic exchange with human influenza viruses in human cells, suggesting the potential capability for reassortment and contributions to new pandemic or panzootic influenza A viruses.


    http://www.pnas.org/content/early/20...1-508fead5430e
    Last edited by sharon sanders; February 27, 2012, 03:51 PM. Reason: added bolding and paragraphing for emphasis

  • #2
    First report of discovery of H17 influenza

    Not sure where to post this.

    http://www.globaltvedmonton.com/heal...856/story.html


    New - but very old - influenza strain isolated from Guatemalan bats Monday, February 27, 2012 3:5 PM

    TORONTO - Scientists have found a new — though probably very old — subtype of influenza.

    And they've discovered it in unlikely hosts —Guatemalan bats.

    Scientists from the U.S. Centers for Disease Control and Universidad del Valle in Guatemala City found that a species of bats known as the little yellow-shouldered bat can harbour the new flu subtype.

    Up until now, it was thought there were 16 types of hemagglutinins — the protein on the surface of a flu virus that contributes the "H" to a virus's name.

    They have been called H1 through H16, but the new bat virus expands that repertoire to H17.

    Bats join a long list of mammals that are known to be susceptible to influenza, including raccoons, anteaters, seals, horses, dogs and, of course, humans.

    Comment


    • #3
      New - but very old - influenza strain isolated from Guatemalan bats

      Source: http://www.winnipegfreepress.com/bre...140607963.html

      Latest News

      The Canadian Press - ONLINE EDITION
      New - but very old - influenza strain isolated from Guatemalan bats
      By: Helen Branswell, The Canadian Press
      Posted: 02/27/2012 2:06 PM

      TORONTO - Scientists have found a new — though very old — subtype of influenza in an unlikely host: a species of bats from Guatemala.

      The finding both increases the repertoire of known subtypes of flu and the known range of mammals that can be infected by the wily viruses.

      It may also provide clues to the evolution of influenza, because some of the genes in the bat viruses appear to have diverged from those found in other flu subtypes hundreds of years ago.

      Scientists from the U.S. Centers for Disease Control and Universidad del Valle in Guatemala City found the new subtype in a species of bats known as the little yellow-shouldered bat in southern Guatemala.

      Up until now, it was thought there were 16 types of hemagglutinins, the protein on the surface of a flu virus that contributes the H to its name. They have been called H1 through H16. Most flu subtypes don't circulate among people and are seen mainly in aquatic birds, the reservoir of influenza viruses.

      But the hemagglutinin of the new bat virus is sufficiently different from the existing ones that it qualifies as a new subtype, H17, said Ruben Donis, the influenza virologist who was the senior author on the paper, published Monday in the Proceedings of the National Academy of Sciences.

      Donis said it's not clear at this point whether H17 can reassort with other flu viruses — those that infect people, for instance — to form a new hybrid that could spread among other mammals...

      Comment


      • #4
        Re: PNAS: A distinct lineage of influenza A virus from bats

        Data deposition: The sequences reported in this paper have been deposited in the GenBank database (accession nos. CY103873, CY103874, CY103875, CY103876, CY103877, CY103878, CY103879, CY103880, CY103881, CY103882, CY103883, CY103884, CY103885, CY103886, CY103887, CY103888, CY103889, CY103890, CY103891, CY103892, CY103893, CY103894, CY103895, and CY103896).

        Further information from the study here;
        http://www.pnas.org/lookup/suppl/doi...DCSupplemental
        Twitter: @RonanKelly13
        The views expressed are mine alone and do not represent the views of my employer or any other person or organization.

        Comment


        • #5
          Re: PNAS: A distinct lineage of influenza A virus from bats

          OK, I just found this.
          I had posted to the Cidrap thread:
          http://www.flutrackers.com/forum/sho...d.php?t=183289

          ---------------------------------------

          ahh, 3 years.
          Will the sequences be published ?

          ----------------------

          http://www.pnas.org/content/suppl/20...ental/sapp.pdf

          http://www.pnas.org/content/early/20...DCSupplemental

          can anybody identify the red ball in the videos ? e.g. video 6 (PB2)

          ---------------------------



          so, this maybe existed before America was discovered by Europeans.
          While all other influenza that is out now seems to have come from Eurasia.
          If there was flu in America before Columbus, then it became extinct in the meantime.
          (my opinion)


          ----------------------------
          no suitable google hits for donis,bats,influenza,"before columbus" - so do they speculate
          about the origin in that PNAS-paper ?

          ------------------------------------------

          hah, there it is http://www.ncbi.nlm.nih.gov/nuccore/CY103880
          I'm interested in expert panflu damage estimates
          my current links: http://bit.ly/hFI7H ILI-charts: http://bit.ly/CcRgT

          Comment


          • #6
            Re: PNAS: A distinct lineage of influenza A virus from bats

            Code:
            >A/little yellow-shouldered bAt/Guatemala/153/2009/05/(H17N10)
            AGCAGAAGCAGGTCAGAGATTGTCAATATGGAGAGAATCAAAGAATTACTAGAAATGGTCAAAAATTCCCGCATGAGGGAAATTTTAACAACCACCAGCGTTGACCATATGGCAGTAATCAAGAAATACACCAGTGGGAGGCAGGAGAAAAACCCTGCACTACGAATGAAATGGATGATGGCCATGAAATACCCAATAAGTGCCTCCTCACGAATCAGAGAAATGATACCAGAGAAAGACGAAGACGGAAACACACTCTGGACCAACACCAAAGACGCTGGGAGTAACCGCGTTCTTGTTTCCCCTAACGCAGTCACATGGTGGAACAGAGCTGGGCCAGTGTCCGACGTTGTGCACTATCCACGTGTTTACAAGATGTATTTTGACAGACTGGAGAGACTAACCCATGGGACATTTGGACCGGTAAAATTCTACAATCAGGTGAAAGTAAGGAAAAGAGTAGACATCAATCCGGGACACAAAGACCTCACCTCCAGAGAGGCACAAGAAGTCATTATGGAAGTGGTGTTCCCAAATGAAGTCGGAGCAAGGACGCTGTCCTCTGACGCTCAATTGACAATAACCAAGGAAAAAAAGGAAGAGCTGAAGAACTGCAAAATATCACCTATAATGGTTGCATACATGCTGGAAAGGGAACTAGTCAGAAGAACGAGATTTCTTCCAATAGCAGGGGCAACTTCAAGCACTTATGTTGAGGTCTTACATTTGACACAAGGAACCTGCTGGGAGCAACAGTACACTCCAGGAGGGGAAGCTGAGAATGATGATCTTGATCAGACATTAATAATTGCATCAAGAAACATAGTTAGAAGATCAATAGTAGCAATAGATCCTCTTGCCTCATTACTATCCATGTGTCACACAACGAGTATATCTTCAGAGCCCTTAGTTGAAATTCTTCGATCCAACCCAACTGATGAGCAAGCAGTGAACATTTGCAAAGCCGCTCTGGGAATTAGAATAAACAACAGTTTTAGTTTTGGGGGATACAATTTTAAGAGGGTTAAAGGAAGCTCCCAGAGAACAGAAAAAGCAGTGCTAACTGGAAATCTTCAAACTTTAACCATGACAATATTTGAGGGATATGAAGAGTTTAACGTTTCGGGTAAAAGGGCCTCTGCCGTTTTAAAGAAAGGAACCCAACGGCTCATCCAAGCTATAATAGGAGGGAGAACATTGGAGGACATTTTAAATTTAATGATTACACTAATGGTATTTTCTCAGGAAGAAAAAATGCTCAAAGCAGTAAGAGGTGATCTAAACTTCGTAAATAGAGCCAACCAAAGGCTAAACCCAATGTATCAACTCCTTAGGCATTTCCAAAAGGACTCAAGTACTCTATTAAGGAATTGGGGGACTGAAGAAATAGACCCTATAATGGGAATAGCTGGTATAATGCCTGATGGGACGATCAATAAAAACCAAACACTTATAGGAGTCAGGCTCAGCCAAGGGGGTGTGGATGAGTACTCTTTCAATGAAAGAATCAGAGTCAACATAGACAAATATCTAAGAGTAAGAAATGAAAAGGGAGAACTTCTCATCAGCCCTGAGGAAGTCAGTGAGGCCCAGGGCCAGGAAAAACTCCCAATTAACTACAACTCTTCCTTAATGTGGGAAGTAAACGGACCAGAGTCCATCCTCACTAACACCTACCATTGGATAATAAAAAACTGGGAGCTGCTGAAGACCCAATGGATGACCGATCCAACAGTCTTATACAACAGGATGGAATTTGAGCCATTTCAAACTTTAATCCCTAAAGGGAATCGGGCTACCTACAGTGGTTTTACCAGGACTCTTTTCCAACAAATGAGGGATGTCGAAGGAACATTTGATAGCATACAAGTAATAAAACTGCTCCCGTTCTCAGCCCATCCTCCCTCTTTGGGAAGGACCCAATTCAGCTCCTTTACACTGAACATAAGAGGAGCACCCTTAAGACTGCTAATAAGGGGAAACTCTCAGGTCTTTAACTACAACCAGATGGAAAATGTAATCATTGTCTTGGGGAAGAGTGTTGGGAGTCCCGAAAGGTCCATACTAACTGAAAGCAGCAGCATTGAATCTGCGGTATTGAGAGGATTCCTGATCTTAGGGAAAGCCAATAGCAAATATGGACCCGTGCTAACAATTGGGGAGCTGGACAAACTAGGGCGGGGAGAAAAAGCCAATGTCCTCATAGGACAAGGGGACACAGTGTTGGTCATGAAACGAAAAAGAGACTCTAGCATACTTACTGATAGCCAGACAGCCCTCAAAAGAATTCGTTTGGAGGAGTCGAAGTAACAATACTAAAAATGACCTTGTTTCTACT
            AGCAGAAGCAGGCAAACTATTTTAAAATGGACGTCAATCCGATGCTAATATTCCTGAAAGTCCCAGTGCAAAATGCCATAAGCACAACCTTTCCCTACACCGGGGACCCACCGTACAGCCATGGAACGGGGACTGGCTACACAATGGACACGGTAATCAGGACTCATGATTACTCATCCCGAGGAATATGGAAAACCAACTCTGAAACAGGAGCTCAGCAACTCAATCCAATAGATGGACCTCTTCCTGAGGACAACGAACCTAGCGGGTATGCGCAGACCGATTGCGTGCTTGAACTGATAGAAAGGCTTGACAGATCACATCCTGGTCTCTTTGAGACAGCATGCCAGGAAACCATTGATGCTATCCAACAAACGAGAGTTGACAAACTAACACAAGGGAGACAGACATATGACTGGACGCTAAACAGGAACCAACCGGCCGCCACTGCACTAGCCAACACCATCGAGGTCTTCAGAAAAAATGGCCACAAGTTAAATGAGTCAGGGCGGCTAATTGACTTTTTGAAAGATGTCCTACTTTCCTTTGAAAATAATTCTATGGAAGTGACCACACATTTCCAGAAGAAAAAACGAATAAGGGATAACCACACAAAGAAAATGATTACCCAAAGAACGATTGGGAAGAAAAGGGTAAAATTAACTAAGAAAAATTACCTAATAAGGGCACTGACCCTAAATACAATGACCAAGGACGCAGAGAGAGGTAAACTAAAAAGAAGGGCCATAGCAACCCCCGGGATGCAAATTAGAGGGTTTGTTTATTTCGTCGAGCTACTTGCGAGAAACATTTGTGAAAGACTTGAGCAATCAGGCTTACCAGTAGGGGGGAACGAAAAGAAAGCTAAACTTGCGAATGTTATAAAGAAAATGATGGCCAAATCCACGGATGAAGAACTATCATACACCATAACAGGAGACAATACTAAGTGGAATGAGAACCAAAATCCAAGAATCTTTCTAGCCATGGTTTTAAAAATCACGGCAGGACAACCGGAATGGTTCAGAGACTTATTAGCAGTTGCTCCCATCATGTTTTCCAACAAAGTTGCCCGACTAGGGAGAGGCTATATGTTCGAAAGCAAATCTATGCATTTAAGAACCCAAATTTCCGCAGAGAACCTGAGTGACATCAACTTACGTTATTTTAATGAAGACACAAAAAAGAAAATAGAGAAAATTAGGCACCTTATGGTGGAGGGAACAGCATCACTTAGCCCAGGGATGATGATGGGAATGTTCAATATGCTTAGTACAGTACTAGGGGTTAGTGTCTTGAATTTAGGCCAAAGGGAGATTTTGAAAAGAACATATTGGTGGGATGGCCTCCAGTCATCAGATGATTTTGCATTAATTATTAATGGTCACTTCAAAGAAGATATCCAGCAGGGAGTCAACCACTTCTACCGAACTTGCAAATTAGTAGGGATCAACATGTCACAGAAAAAATCATATATAAATAAAACTGGCACTTTTGAATTTACAAGCTTCTTCTACAGATATGGCTTCGTTGCCAACTTCTCCATGGAGTTGCCCTCCTTTGGTGTAGCGGGGAACAACGAATCAGCAGACATGAGCATAGGAACAACAGTAATCAAAACCAACATGATCAACAATGATCTGGGGCCCGCCACAGCACAAATGGCAATCCAGCTTTTTATAAAAGATTATAGATATACATACCGATGCCACAGGGGGGACACGAATCTAGAAACAAGAAGAACAAAAAGCATCAAACGACTCTGGACTGAGACAATCTCAAAAGCTGGGCTCCTAGTCGCTGATGGGGGCCCCAACCCCTACAATCTTAGAAACCTGCACATACCAGAAGTCTGTTTAAAATGGGACCTAATGGATCCTGATTATAGAGGAAGACTCTGCAACCCCAACAACCCCTTTGTTCACCATATGGAAGTGGAAAGCACTAATCTTGCAGTTGTCATGCCAGCCCACGGGCCAGCCAAATCCCTAGAATACGACGCAGTGGCAACCACACATTCATGGACTCCCAAAAGAAATCGGTCAATCCTAAACACAAATCAAAGAGGAATTCTAGAAGACGAGAAAATTTATCAAAAATGCTGCCAGATATTTGAAAAGTTTTTCCCTAGTTCAACTTATAGAAGACCTATCGGAATGGCCAGCATGCTAGATGCAATGCTGTCAAGAGCAAGAATAGATGCAAGAATAGACCTGGAGTCTGGAAGAATCAGCAGCCAAGATTTCTCCGAGATAACGAATACCTGCAAGGCGATCGAAGCATTGAAACGCCAATAAGGGTCATTAGTTGTTGAAACGAAAAAATGCCTTGTTTCTACT
            AGCAGAAGCAGGTACTTAAACAATGGAGAATTTCGTGAGAACTAACTTCAATCCCATGATACTAGAAAGGGCTGAAAAAACTATGAAAGAATATGGAGAAAACCCCCAGAATGAGGGAAACAAATTTGCAGCAATATCTACACACATGGAGGTATGTTTCATGTATTCAGACTTCCACTTCATTGACCTTGAAGGGAATACAATAGTAAAGGAAAGTGATGACGACAATGCAATGCTAAAGCACCGGTTTGAGATAATCGAAGGCCAAGAGAGAAACATCGCATGGACAATTGTCAATTCAATTTGCAACATGACAGAAAATAGCAAACCACGATTCCTACCTGATCTTTACGACTACAAAACCAACAAATTCATTGAAATCGGGGTAACAAGGAGAAAAGTTGAGGACTATTATTATGAAAAGGCCAGTAAACTGAAAGGTGAAAATGTATATATTCACATCTTCTCCTTTGATGGAGAAGAGATGGCCACAGATGATGAGTATATACTTGACGAAGAAAGCAGAGCTCGAATAAAAACTCGACTCTTTGTTCTTAGACAAGAACTAGCCACAGCTGGGCTCTGGGATTCCTTTCGCCAATCAGAGAAGGGAGAAGAAACACTGGAGGAGGAATTTTCATACCCCCCAACATTCCAGAGGCTTGCAAACCAGAGCCTACCTCCATCATTCAAGGACTATCACCAATTCAAAGCGTACGTGTCGAGTTTCAAAGCAAACGGCAACATAGAGGCTAAACTAGGGGCAATGTCAGAAGAGGTTAACGCACAAATAGAGAACTTTGACCCCAGGACAATAAGGGAGCTGGAGCTCCCCGAGGGAAAATCCTGCACTCAAAGAAGCAAATTCCTGCTAATGGACGCAATGAAACTGTCGGTTTTAAACCCGGCACATGAAGGGGAAGGAATCCCAATGAAAGACGCCAAAGCTTGTCTTGACACCTTCTGGGGATGGAAAAAAGCCACAGTTATCAAAAAGCATGAAAAGGGAGTCAACACTAACTATCTCATGATCTGGGAGCAGCTCTTAGAATCAATAAAAGAAGTAGAGGGAAAATTCCTCAACTTAAGGAAAACCAATCATCTCAAGTGGGGGCTGGGAGAAGGGCAAGCGCCCGAAAAGATGGACTTTGAAGATTGTAAAGAAGTCCCTGATCTCTTCCAATACAAAAGTGAACCCCCTGAAAAGCGAAAATTGGCCAGCTGGATCCAAAGTGAATTCAACAAAGCTTCTGAGCTCACAAACTCAAACTGGATTGAATTTGATGAGTTGGGAAATGACGTGGCACCCATCGAGCACATTGCCAGTAGAAGAAGAAATTTCTTCACCGCAGAGGTATCTCAATGCAGAGCCTCAGAATATATAATGAAAGCGGTGTACATAAATACAGCCCTTCTTAACTCCTCATGCACGGCAATGGAGGAATATCAGGTGATCCCAATAATCACCAAATGTAGAGACACATCAGGTCAGAGAAGGACCAATTTATATGGGTTCATCATCAAAGGTCGATCTCACCTTAGGAATGATACTGATGTTGTAAACTTCATTTCTTTGGAGTTTTCACTGACCGATCCCCGAAATGAGATTCATAAGTGGGAGAAATACTGCGTACTAGAGATTGGAGACATGGAGATTCGGACATCAATAAGTACAATAATGAAACCGGTCTACCTCTATATTAGGACCAATGGAACTTCAAAAATCAAAATGAAATGGGGAATGGAAATGAGAAGATGCTTACTCCAATCTCTACAACAAGTGGAAAGCATGATTGAAGCAGAATCAGCAGTCAAAGAGAAGGATATGACTGAACCCTTCTTTAGAAATCGGGAAAATGACTGGCCAATAGGAGAAAGCCCTCAAGGAATAGAGAAAGGAACGATAGGAAAAGTATGCAGGGTTTTACTCGCTAAATCTGTTTTCAACAGCATTTATGCCTCAGCTCAGCTTGAAGGATTTTCAGCAGAATCGAGAAAATTACTGTTACTCATTCAAGCATTTAGAGATAATTTAGATCCTGGAACTTTTGACTTGAAAGGGCTGTACGAAGCCATTGAGGAATGCATCATTAATGATCCTTGGGTCCTTTTAAATGCTTCATGGTTCAACTCCTTCCTTAAAGCAGTACAATTGAGCATGTGAAGAACTCTATCAGCTTTGATTCAATGTAAGAAAAAAGTACCTTGTTTCTACT
            AGCAGAAGCAGGGTCACTATTACTCTGTGCTACTATGGAGCTGATTGTCCTACTAATCCTTCTCAATCCTTATACTTTTGTATTAGGGGACAGAATATGCATAGGCTATCAAGCAAACCAAAATAACCAAACGGTTAACACTTTGCTCGAACAGAATGTTCCAGTTACCGGAGCACAGGAAATACTAGAAACCAATCACAATGGAAAGTTATGCAGCCTAAATGGGGTCCCACCATTGGACCTACAATCATGCACTCTGGCCGGGTGGTTACTGGGGAATCCGAACTGTGACAGCCTATTGGAAGCAGAAGAATGGTCGTATATAAAAATAAATGAAAGTGCCCCTGACGATCTTTGCTTCCCTGGGAACTTCGAAAACTTACAGGACTTACTACTAGAAATGTCAGGAGTTCAAAATTTCACCAAGGTGAAACTATTCAACCCCCAAAGTATGACTGGGGTAACTACCAATAATGTCGACCAGACTTGCCCTTTTGAAGGGAAACCATCTTTCTACAGAAACCTCAACTGGATACAAGGGAATAGCGGTTTGCCTTTCAATATAGAAATCAAGAATCCAACTAGCAATCCATTGCTCCTTCTCTGGGGGATCCACAACACCAAGGATGCAGCACAACAAAGAAATCTCTATGGAAATGATTACTCTTATACTATTTTTAACTTTGGAGAGAAAAGTGAAGAATTTCGACCTGAAATCGGGCAAAGAGATGAAGTCAAAGCCCATCAAGACAGAATCGATTACTACTGGGGAAGCCTACCAGCGCAGAGCACTCTAAGGATAGAATCCACCGGAAATCTAATCGCACCAGAATATGGCTTTTATTACAAGCGAAAAGAGGGGAAAGGGGGGCTAATGAAAAGTAAGCTGCCAATTAGTGACTGCTCAACCAAATGTCAAACACCCCTGGGAGCTCTCAACAGTACCCTGCCCTTTCAAAACGTTCACCAACAAACAATTGGTAATTGTCCCAAATATGTGAAGGCTACCTCCTTGATGCTTGCCACAGGGCTAAGAAACAATCCCCAAATGGAGGGAAGAGGTCTCTTTGGAGCCATTGCCGGGTTTATTGAAGGAGGGTGGCAAGGGATGATTGATGGTTGGTATGGATACCACCACGAGAATCAAGAAGGAAGCGGCTACGCCGCTGACAAAGAAGCCACTCAAAAGGCTGTCGATGCCATAACGAACAAAGTGAACAGTATTATTGACAAAATGACAGCCAATTCGAATCCAACATCAAAGAGTTCAACAGGTTGGAACTCAGGATACAACACCTAAGTGATAGAGTTGATGATGCGTTACTTGACATTTGGTCCTATAATACTGAATTACTTGTCCTCTTAGAAAATGAAAGAACCCTTGATTTCCATGATGCTAATGTAAAGAACCTCTTTGAAAAAGTGAAGGCCCAATTGAAGGACAATGCAATAGATGAAGGAAATGGTTGCTTTCTACTTTTACACAAGTGTAACAACTCTTGCATGGACGACATAAAGAATGGGACATACAAATACATGGACTATAGGGAAGAGTCACACATCGAGAAACAGAAAATCGATGGGGTAAAACTAACTGATTACTCTAGATACTATATCATGACTCTGTATTCTACCATTGCATCATCCGTCGTGCTTGGCTCGTTGATAATAGCCGCTTTTCTTTGGGGGTGCCAAAAAGGCTCAATCCAATGTAAAATATGTATATAGAACGGTGGAATTAACCTTGTCATTCAGAAAAGCAAAAAAGACCCTTGTTTCTACT
            AGCAGAAGCAGGGTTAATAATCACATTGTGACATTTAAAGATGACAACTCAAGGCCTTAAACGCACCTTCGAGCAAATGGAGACTGACTCCAAACAGAGCACCACTGAAATCAGATCCGCAGTCGGAAGAATGGTGAAAGCAATTGGGAAATTCTACATCCAAATGTGTGCAGAAATGAAATTAGATGACAAGGAGGGAGCCCTGATCCAGAACAGCATAACAATTGAAAGGATGGCACTCTCAGCATTCGACGAGAGAAGAAATAAATACTTAGAAGAGCACCCCACTGTGGGGAAAGACCCCAAGAAGACAGGTGGGCCCATCTACAGGAGAAAAGATGGAAAATGGGAGAGAGAGATGGCCCTCATGGAAAAGGAAAACATCCGAGCAATATGGAAAATGGCTAATGAAGGAGAGGAGAATCTATCTGGTCTAAGCCATATTATGATCTGGCACTCAAACTTAAATGACACAACCTATCAGCGAACAAGAGCCCTTGTCAGAACAGGAATGGACCCAAGGATGTGCTCGTTGATGCAGGGCTCAACTCTTCCAAGAAGAGCTGGAGCAGCTGGGACTGCAGTCAAAGGAGTGGGGACCCTCATAATGGAGTTGATCCGGATGATCAAAAGAGGAATGAATGACAGAAATTTCTGGAAGGGTGAACAAGGGAGAAGAACTCGAACAGCTTATGAAAGGCTCTGTGGAAACCTGAAAGGAAAGTTTCAAACAGCCCCACAGAAAGCAATGGTTGATCAAGTCAAAGAAGGAAAAAACCCAGGAAATGCAGAAATAGAGGACTTACTATTTCTTGCAAGATCTGCCCTGATCCTCCGAGGAGCAGTAGCTCATAAGTCAGCTCTCCCAGCCTGTGTATATGGTCTTGGGGTCGCCAGAGGGTTTGACTTTGAAAAAGAGGGATACTCTCTAGTAGGCAGAGACCCCTACTTGCTCCTGCAGAACTCCCAGATTTTCTCCATCCTGAGAAAGGGGGAGAACGCTGCACACAAAAGTCAGCTAGTGTGGATGGCCTGCCATGCTGCAGCCTTTGAGGACATAAGGATCAGCAGCTTTATCAAGGGAAGCAAAATAATCCCTCGGGGCAAGCTAGAAACAAGAGGATTACAAATTGCTGGCTCTGAAAGTCTAGATGAAATCCTGGTAATCAGCTTGGACCTCAAAAGTCATTATTGGGCAATCAAAACTAGGAGTGGGGGTAATCCCCAACAATCAAGAAGCACAGCTGGTCAAATAGCGGTGCAACCTACCTTTTCCGTCCAAAGAAATATCCCCTTTGAGAAAAAGACGATCATGGCGGCCTTCTCAACAACCGAAGAAGGGAGAATCACAGACATGAGGACTGAAATAATCAGACTTATGGAAAACTCAGACCCAAAGGAGAAAGTCTTCATAGGGCGAGGCGTCTTCGAGATGGGAGACGAGAAGGCAACTAACCCGATAGTGCCTCCACTAGATGGGAATGACGAGGGTTCTTATTTCTTTGGAGACAAGGCAGACGAGTTCGACATTTGAGCAAAAAATACCCTTGTTTCTACT
            AGCAGAAGCAGGAGTTTTTAATAATGTCTATCAACGGAACGACATGTCTACTCACACTCAGTCTAATACTCAATGTTATAATGATAGGGCTCCAAATCCTGATGCCCTTTATTCTTTTATGGACCAACAGCCCCCCGCCAGAAATCTCCAACAGCACTAGCTGCTGCAACGGAACCTTTCTGAATGAAACAAACAACAATATAACCAATATATCACAAATAACCAATAATTTCCTCAAAGAAGAGAAATTCTACTGGAGGGCAAAATCCCAAATGTGCGAAGTCAAAGGTTGGGTTCCTACACATAGAGGGTTCCCTTGGGGTCCTGAGCTCCCCGGAGACTTAATTCTCAGTAGGAGGGCATACGTTAGCTGTGACTTGACATCCTGTTTCAAATTCTTTATTGCTTACGGCCTCAGTGCAAATCAGCACTTATTGAACACAAGTATGGAGTGGGAAGAAAGCCTGTACAAAACTCCAATTGGAAGTGCAAGCACCTTAAGCACTTCAGAAATGATTCTCCCCGGGAGAAGTTCATCAGCATGCTTCGACGGGCTAAAATGGACCGTCCTGGTAGCTAATGGCAGAGACCGGAACAGCTTCATAATGATCAAATATGGAGAGGAAGTAACAGACACTTTCTCGGCCAGCAGAGGAGGTCCCCTGCGACTCCCCAACTCAGAATGCATCTGTATAGAAGGAAGTTGTTTTGTAATAGTAAGTGACGGACCCAATGTGAATCAGAGCGTCCACCGGATCTATGAACTCCAAAATGGAACAGTCCAGAGATGGAAGCAGCTAAATACAACTGGCATAAACTTTGAATACAGCACGTGCTATACAATCAACAACCTGATAAAGTGCACTGGGACAAATCTCTGGAATGATGCCAAAAGACCTTTGCTCCGATTCACTAAGGAACTCAACTATCAGATTGTAGAGCCCTGCAATGGGGCTCCCACAGATTTCCCCAGAGGCGGGCTTACCACCCCAAGTTGCAAGATGGCTCAAGAAAAAGGAGAAGGAGGGATTCAGGGTTTCATACTTGACGAGAAACCAGCCTGGACCTCAAAAACAAAGGCTGAGTCATCTCAGAATGGTTTTGTATTAGAACAAATTCCTAACGGGATAGAAAGTGAAGGAACAGTTTCATTAAGCTATGAACTTTTTTCTAACAAGAGAACCGGAAGGAGTGGATTCTTTCAACCCAAAGGAGACCTCATTTCTGGATGCCAACGAATCTGTTTCTGGCTGGAAATAGAAGATCAAACAGTAGGCCTAGGAATGATTCAAGAACTCAGCACTTTCTGTGGGATAAACTCACCTGTTCAGAATATAAATTGGGATTCATGACCAATGGACAGCGAATGAAAAAACTCCTTGTTTCTACT
            AGCAGAAGCAGGCATTATCCAAAATGAGCATCTTAACAGAGGTTGAAACGTACGTTCTATCAATCATCCCATCAGGGCCTCTAAAAGCTGACATAGCCCAAAAGCTCGAGGATGTCTTCTCAGGCCGAAACAGCGACCTGGACACCTTATTAGAATGGCTAAAGGCCAGACCCATACTGTCCCCATTAACAAAGGGAATTGTCGGCTTTGTTTTCACACTCACAGTGCCATGTGAGAAGGGCGCCCCTAGACGGAAATTCATACAAACGGCCCTCAATGGAAATGGAGAGGCGGCCAATATGGACAAGGCAGTTAAAATCTACAAAAAGTTGAAAAAGGAGATAACTTTCCATGGGGCCAAGGAAGTGGCACTAAGCTACCCAACTGGGGCATTAGCATGCTGCATGGGGCTCATCTACAATAGAATGGGATCTGTGACAACCGAAGTGGCATTTGGCTTAGTCTGTGCTACTTGTGAGCACATTGCCGATTCTCAATATAGATCTCATCGGCAGATGATAAGCTCGACAAATCCCCTGATCAGACATGAAAACAGAATGGCAACGGCAGCAAGCACTGCAAAGGCCATGGAACAATGGCTAGCAGTAGCGAACAAGCTGCTGAAGCAATGGAAATTGCTTCACAGGCCAGGCAAATGATTCAAGCAATGAGGGCTATCGGGACCCACCCAACAACTTCCAGTGGGCTTAAAGACGATCTCCTTGATAATCTACAGGCCTACCAGAAGAGAATGGGAATCCAAATGCAGAGGTTTAAATGAAGACTTGATCCTGGCGGCCAACATAATTGGAATCCTTCATCTGGCACTCTGGATTATAGACAGATGGCTATACAGCTATAGTCTAGCATTATATCAGCAGATACGGAGCCACTGGGTAATTAGAACTGTCGATTCCACAAGGGAACTAAGAGAAGAATTTAAAGAAGAACACACGGCAATTGAAAATCCGGACCCTATCATAGTAATCATGGAAAAGTGAAATGAAAAAATGCCTTGTTTCTACT
            AGCAGAAGCAGGGTATCTAAAGACATAATGGAACCAAACCCGACAACTATCGCATTTCAGGTAGACTGTTATCTATGGCACCTGAAAAAGACGCTTAGCATGATGGGAGAGGTTGACGCCCCGTTCGAGGACCGACTCCGAAGAGAACAGAAAGCACTGAAAGGAAGGAGCATGACTCTGGGGATAGACATTCAATCAGCAACCCAAGAAGGGTACTACAAGATCAAGTCTATCACAGAAGAAAGCATGCCCTCCTATGGAATACTACCAAATGCAGGACAAAACGAACCCAAATATATAACAGAGATGACTCAAGAGGAAACAATCAGAAACTGGGTGATGATCCAACCTAAGCAAAAGGTTATCTCCGGGAGGATCTTGATCAGCATGGACCAAGCAGTAACCAATAAAGTCTTAACAATAAAGGCAAATTTCACTGTCTGCTTTGGAAAACTAGAAAGGCTTGTATTAGCTAGAGCTTTCACAGAAGAAGGGACAGTAGTGGGTGAAATCAACCCTCTGTCTTTTGTTACAGGACATACTGGAGAGGATGTCAAAACTGCATATGAACTCTTCAGAAGTGGATTTGAATGGAATGATAACACAATTGACGAATCTCAGATTCTACAGAGACTCGCTAGGGGAGTCATTAATGAGAACCGGAGACTACCGCAAGATGGCTCAACAGAATAACAATTGGAGACTCCAATTAGGGGAGAAATTAACAATTATTAGAAATCTAATTCAAACGTGCCGGGAGGTGCTAATGACCTCATCTAACAGTTTTGTAGAGATAACCTTCCTCGCTGCACTTGACCTCTTATTGGAGGTCGAAAGAGAAATGAGAACCTTGGCTTTTCAGCTGATATGATTAAAAAATACCCTTGTTTCTACT
            I'm interested in expert panflu damage estimates
            my current links: http://bit.ly/hFI7H ILI-charts: http://bit.ly/CcRgT

            Comment


            • #7
              Re: PNAS: A distinct lineage of influenza A virus from bats

              first impression from my index list
              (more extensive later)


              closest to in the 8 segments :

              difference in promille,segment:name
              --------------------------------------
              337,1:A/Avian/Index/Oceania/1980
              285,2:A/Dk/LA/17G/1987//(H3N8)
              322,3:A/Tk/Ontario(6118/1968//(
              392,4:A/Brevig Mission/1/1918//(H1N1)
              291,5:A/Avian/index/South America
              552,6:A/northern pintail/CA/44291-259/2007/03/18(H10N3)
              320,7:A/Avian/index/Europe,Germany/1980
              360,8:A/index/7 birds similar to BM18/1975

              difference in promille in the 8 segments to
              BM18,early human,early swine:

              Code:
              BM/18:344,297,331,392,299,559,330,382
              human:344,297,328,397,299,568,334,382
              swine:353,297,332,395,299,553,335,394

              look at codon-position 2 mutations ...


              341:A/gull/MN/945/1980/08/25(H13N6)
              285:A/Dk/LA/17G/1987(H3N8)
              321:A/Tk/WI/1/1966/(H9N2)
              401:A/Ck/PA/Sg-00426/2004(H2N2)
              301:A/semipalmated sandpiper/DE/2109/2000(H11N6)
              ---
              344:A/mallard/NL/1/1999(H4N6) 277:A/Dk/Guangdong/07/2000(H5N1) (partial 768/978)


              flugenome.org types
              types1.exe (length-12-matches)
              best and 2nd-best


              BM/18
              1C , 643,1C , 504,1A
              2B , 865,2B , 741,2A
              3A ,1465,3A , 6,1E
              41B, 337,41B, 215,41A
              5A , 340,5A , 4,4DA
              61C, 468,61C, 286,61B
              7E , 574,7E , 434,7B
              81D, 450,81D, 261,81A

              bat
              1J , 47,1J , 44,1F
              2D , 41,2D , 26,2B
              3B , 59,3B , 38,3A
              42I, 25,42I, 19,42D
              5G , 51,5G , 26,5A
              65D, 6,65D, 4,2G
              7D , 20,7D , 15,7B
              81F, 24,81F, 23,81E

              B
              2H , 34,2H , 28,2F
              1A , 6,1A , 0,2H
              3C , 11,3C , 8,3A
              43B, 9,43B, 4,41A
              2D , 5,2D , 4,2C
              68B, 13,68B, 9,61A
              42I, 5,42I, 4,1D
              45B, 4,45B, 3,2A

              C
              2G , 6,2G , 2,1A
              2E , 22,2E , 9,2A
              46A, 6,46A, 5,1A
              1K , 6,1K , 2,1F
              47B, 6,47B, 4,44D
              ---,
              66B, 7,66B, 6,1H
              5B , 6,5B , 5,3E
              I'm interested in expert panflu damage estimates
              my current links: http://bit.ly/hFI7H ILI-charts: http://bit.ly/CcRgT

              Comment


              • #8
                Re: PNAS: A distinct lineage of influenza A virus from bats

                Originally posted by gsgs View Post
                Code:
                >A/little yellow-shouldered bAt/Guatemala/153/2009/05/(H17N10)
                AGCAGAAGCAGGTCAGAGATTGTCAATATGGAGAGAATCAAAGAATTACTAGAAATGGTCAAAAATTCCCGCATGAGGGAAATTTTAACAACCACCAGCGTTGACCATATGGCAGTAATCAAGAAATACACCAGTGGGAGGCAGGAGAAAAACCCTGCACTACGAATGAAATGGATGATGGCCATGAAATACCCAATAAGTGCCTCCTCACGAATCAGAGAAATGATACCAGAGAAAGACGAAGACGGAAACACACTCTGGACCAACACCAAAGACGCTGGGAGTAACCGCGTTCTTGTTTCCCCTAACGCAGTCACATGGTGGAACAGAGCTGGGCCAGTGTCCGACGTTGTGCACTATCCACGTGTTTACAAGATGTATTTTGACAGACTGGAGAGACTAACCCATGGGACATTTGGACCGGTAAAATTCTACAATCAGGTGAAAGTAAGGAAAAGAGTAGACATCAATCCGGGACACAAAGACCTCACCTCCAGAGAGGCACAAGAAGTCATTATGGAAGTGGTGTTCCCAAATGAAGTCGGAGCAAGGACGCTGTCCTCTGACGCTCAATTGACAATAACCAAGGAAAAAAAGGAAGAGCTGAAGAACTGCAAAATATCACCTATAATGGTTGCATACATGCTGGAAAGGGAACTAGTCAGAAGAACGAGATTTCTTCCAATAGCAGGGGCAACTTCAAGCACTTATGTTGAGGTCTTACATTTGACACAAGGAACCTGCTGGGAGCAACAGTACACTCCAGGAGGGGAAGCTGAGAATGATGATCTTGATCAGACATTAATAATTGCATCAAGAAACATAGTTAGAAGATCAATAGTAGCAATAGATCCTCTTGCCTCATTACTATCCATGTGTCACACAACGAGTATATCTTCAGAGCCCTTAGTTGAAATTCTTCGATCCAACCCAACTGATGAGCAAGCAGTGAACATTTGCAAAGCCGCTCTGGGAATTAGAATAAACAACAGTTTTAGTTTTGGGGGATACAATTTTAAGAGGGTTAAAGGAAGCTCCCAGAGAACAGAAAAAGCAGTGCTAACTGGAAATCTTCAAACTTTAACCATGACAATATTTGAGGGATATGAAGAGTTTAACGTTTCGGGTAAAAGGGCCTCTGCCGTTTTAAAGAAAGGAACCCAACGGCTCATCCAAGCTATAATAGGAGGGAGAACATTGGAGGACATTTTAAATTTAATGATTACACTAATGGTATTTTCTCAGGAAGAAAAAATGCTCAAAGCAGTAAGAGGTGATCTAAACTTCGTAAATAGAGCCAACCAAAGGCTAAACCCAATGTATCAACTCCTTAGGCATTTCCAAAAGGACTCAAGTACTCTATTAAGGAATTGGGGGACTGAAGAAATAGACCCTATAATGGGAATAGCTGGTATAATGCCTGATGGGACGATCAATAAAAACCAAACACTTATAGGAGTCAGGCTCAGCCAAGGGGGTGTGGATGAGTACTCTTTCAATGAAAGAATCAGAGTCAACATAGACAAATATCTAAGAGTAAGAAATGAAAAGGGAGAACTTCTCATCAGCCCTGAGGAAGTCAGTGAGGCCCAGGGCCAGGAAAAACTCCCAATTAACTACAACTCTTCCTTAATGTGGGAAGTAAACGGACCAGAGTCCATCCTCACTAACACCTACCATTGGATAATAAAAAACTGGGAGCTGCTGAAGACCCAATGGATGACCGATCCAACAGTCTTATACAACAGGATGGAATTTGAGCCATTTCAAACTTTAATCCCTAAAGGGAATCGGGCTACCTACAGTGGTTTTACCAGGACTCTTTTCCAACAAATGAGGGATGTCGAAGGAACATTTGATAGCATACAAGTAATAAAACTGCTCCCGTTCTCAGCCCATCCTCCCTCTTTGGGAAGGACCCAATTCAGCTCCTTTACACTGAACATAAGAGGAGCACCCTTAAGACTGCTAATAAGGGGAAACTCTCAGGTCTTTAACTACAACCAGATGGAAAATGTAATCATTGTCTTGGGGAAGAGTGTTGGGAGTCCCGAAAGGTCCATACTAACTGAAAGCAGCAGCATTGAATCTGCGGTATTGAGAGGATTCCTGATCTTAGGGAAAGCCAATAGCAAATATGGACCCGTGCTAACAATTGGGGAGCTGGACAAACTAGGGCGGGGAGAAAAAGCCAATGTCCTCATAGGACAAGGGGACACAGTGTTGGTCATGAAACGAAAAAGAGACTCTAGCATACTTACTGATAGCCAGACAGCCCTCAAAAGAATTCGTTTGGAGGAGTCGAAGTAACAATACTAAAAATGACCTTGTTTCTACT
                AGCAGAAGCAGGCAAACTATTTTAAAATGGACGTCAATCCGATGCTAATATTCCTGAAAGTCCCAGTGCAAAATGCCATAAGCACAACCTTTCCCTACACCGGGGACCCACCGTACAGCCATGGAACGGGGACTGGCTACACAATGGACACGGTAATCAGGACTCATGATTACTCATCCCGAGGAATATGGAAAACCAACTCTGAAACAGGAGCTCAGCAACTCAATCCAATAGATGGACCTCTTCCTGAGGACAACGAACCTAGCGGGTATGCGCAGACCGATTGCGTGCTTGAACTGATAGAAAGGCTTGACAGATCACATCCTGGTCTCTTTGAGACAGCATGCCAGGAAACCATTGATGCTATCCAACAAACGAGAGTTGACAAACTAACACAAGGGAGACAGACATATGACTGGACGCTAAACAGGAACCAACCGGCCGCCACTGCACTAGCCAACACCATCGAGGTCTTCAGAAAAAATGGCCACAAGTTAAATGAGTCAGGGCGGCTAATTGACTTTTTGAAAGATGTCCTACTTTCCTTTGAAAATAATTCTATGGAAGTGACCACACATTTCCAGAAGAAAAAACGAATAAGGGATAACCACACAAAGAAAATGATTACCCAAAGAACGATTGGGAAGAAAAGGGTAAAATTAACTAAGAAAAATTACCTAATAAGGGCACTGACCCTAAATACAATGACCAAGGACGCAGAGAGAGGTAAACTAAAAAGAAGGGCCATAGCAACCCCCGGGATGCAAATTAGAGGGTTTGTTTATTTCGTCGAGCTACTTGCGAGAAACATTTGTGAAAGACTTGAGCAATCAGGCTTACCAGTAGGGGGGAACGAAAAGAAAGCTAAACTTGCGAATGTTATAAAGAAAATGATGGCCAAATCCACGGATGAAGAACTATCATACACCATAACAGGAGACAATACTAAGTGGAATGAGAACCAAAATCCAAGAATCTTTCTAGCCATGGTTTTAAAAATCACGGCAGGACAACCGGAATGGTTCAGAGACTTATTAGCAGTTGCTCCCATCATGTTTTCCAACAAAGTTGCCCGACTAGGGAGAGGCTATATGTTCGAAAGCAAATCTATGCATTTAAGAACCCAAATTTCCGCAGAGAACCTGAGTGACATCAACTTACGTTATTTTAATGAAGACACAAAAAAGAAAATAGAGAAAATTAGGCACCTTATGGTGGAGGGAACAGCATCACTTAGCCCAGGGATGATGATGGGAATGTTCAATATGCTTAGTACAGTACTAGGGGTTAGTGTCTTGAATTTAGGCCAAAGGGAGATTTTGAAAAGAACATATTGGTGGGATGGCCTCCAGTCATCAGATGATTTTGCATTAATTATTAATGGTCACTTCAAAGAAGATATCCAGCAGGGAGTCAACCACTTCTACCGAACTTGCAAATTAGTAGGGATCAACATGTCACAGAAAAAATCATATATAAATAAAACTGGCACTTTTGAATTTACAAGCTTCTTCTACAGATATGGCTTCGTTGCCAACTTCTCCATGGAGTTGCCCTCCTTTGGTGTAGCGGGGAACAACGAATCAGCAGACATGAGCATAGGAACAACAGTAATCAAAACCAACATGATCAACAATGATCTGGGGCCCGCCACAGCACAAATGGCAATCCAGCTTTTTATAAAAGATTATAGATATACATACCGATGCCACAGGGGGGACACGAATCTAGAAACAAGAAGAACAAAAAGCATCAAACGACTCTGGACTGAGACAATCTCAAAAGCTGGGCTCCTAGTCGCTGATGGGGGCCCCAACCCCTACAATCTTAGAAACCTGCACATACCAGAAGTCTGTTTAAAATGGGACCTAATGGATCCTGATTATAGAGGAAGACTCTGCAACCCCAACAACCCCTTTGTTCACCATATGGAAGTGGAAAGCACTAATCTTGCAGTTGTCATGCCAGCCCACGGGCCAGCCAAATCCCTAGAATACGACGCAGTGGCAACCACACATTCATGGACTCCCAAAAGAAATCGGTCAATCCTAAACACAAATCAAAGAGGAATTCTAGAAGACGAGAAAATTTATCAAAAATGCTGCCAGATATTTGAAAAGTTTTTCCCTAGTTCAACTTATAGAAGACCTATCGGAATGGCCAGCATGCTAGATGCAATGCTGTCAAGAGCAAGAATAGATGCAAGAATAGACCTGGAGTCTGGAAGAATCAGCAGCCAAGATTTCTCCGAGATAACGAATACCTGCAAGGCGATCGAAGCATTGAAACGCCAATAAGGGTCATTAGTTGTTGAAACGAAAAAATGCCTTGTTTCTACT
                AGCAGAAGCAGGTACTTAAACAATGGAGAATTTCGTGAGAACTAACTTCAATCCCATGATACTAGAAAGGGCTGAAAAAACTATGAAAGAATATGGAGAAAACCCCCAGAATGAGGGAAACAAATTTGCAGCAATATCTACACACATGGAGGTATGTTTCATGTATTCAGACTTCCACTTCATTGACCTTGAAGGGAATACAATAGTAAAGGAAAGTGATGACGACAATGCAATGCTAAAGCACCGGTTTGAGATAATCGAAGGCCAAGAGAGAAACATCGCATGGACAATTGTCAATTCAATTTGCAACATGACAGAAAATAGCAAACCACGATTCCTACCTGATCTTTACGACTACAAAACCAACAAATTCATTGAAATCGGGGTAACAAGGAGAAAAGTTGAGGACTATTATTATGAAAAGGCCAGTAAACTGAAAGGTGAAAATGTATATATTCACATCTTCTCCTTTGATGGAGAAGAGATGGCCACAGATGATGAGTATATACTTGACGAAGAAAGCAGAGCTCGAATAAAAACTCGACTCTTTGTTCTTAGACAAGAACTAGCCACAGCTGGGCTCTGGGATTCCTTTCGCCAATCAGAGAAGGGAGAAGAAACACTGGAGGAGGAATTTTCATACCCCCCAACATTCCAGAGGCTTGCAAACCAGAGCCTACCTCCATCATTCAAGGACTATCACCAATTCAAAGCGTACGTGTCGAGTTTCAAAGCAAACGGCAACATAGAGGCTAAACTAGGGGCAATGTCAGAAGAGGTTAACGCACAAATAGAGAACTTTGACCCCAGGACAATAAGGGAGCTGGAGCTCCCCGAGGGAAAATCCTGCACTCAAAGAAGCAAATTCCTGCTAATGGACGCAATGAAACTGTCGGTTTTAAACCCGGCACATGAAGGGGAAGGAATCCCAATGAAAGACGCCAAAGCTTGTCTTGACACCTTCTGGGGATGGAAAAAAGCCACAGTTATCAAAAAGCATGAAAAGGGAGTCAACACTAACTATCTCATGATCTGGGAGCAGCTCTTAGAATCAATAAAAGAAGTAGAGGGAAAATTCCTCAACTTAAGGAAAACCAATCATCTCAAGTGGGGGCTGGGAGAAGGGCAAGCGCCCGAAAAGATGGACTTTGAAGATTGTAAAGAAGTCCCTGATCTCTTCCAATACAAAAGTGAACCCCCTGAAAAGCGAAAATTGGCCAGCTGGATCCAAAGTGAATTCAACAAAGCTTCTGAGCTCACAAACTCAAACTGGATTGAATTTGATGAGTTGGGAAATGACGTGGCACCCATCGAGCACATTGCCAGTAGAAGAAGAAATTTCTTCACCGCAGAGGTATCTCAATGCAGAGCCTCAGAATATATAATGAAAGCGGTGTACATAAATACAGCCCTTCTTAACTCCTCATGCACGGCAATGGAGGAATATCAGGTGATCCCAATAATCACCAAATGTAGAGACACATCAGGTCAGAGAAGGACCAATTTATATGGGTTCATCATCAAAGGTCGATCTCACCTTAGGAATGATACTGATGTTGTAAACTTCATTTCTTTGGAGTTTTCACTGACCGATCCCCGAAATGAGATTCATAAGTGGGAGAAATACTGCGTACTAGAGATTGGAGACATGGAGATTCGGACATCAATAAGTACAATAATGAAACCGGTCTACCTCTATATTAGGACCAATGGAACTTCAAAAATCAAAATGAAATGGGGAATGGAAATGAGAAGATGCTTACTCCAATCTCTACAACAAGTGGAAAGCATGATTGAAGCAGAATCAGCAGTCAAAGAGAAGGATATGACTGAACCCTTCTTTAGAAATCGGGAAAATGACTGGCCAATAGGAGAAAGCCCTCAAGGAATAGAGAAAGGAACGATAGGAAAAGTATGCAGGGTTTTACTCGCTAAATCTGTTTTCAACAGCATTTATGCCTCAGCTCAGCTTGAAGGATTTTCAGCAGAATCGAGAAAATTACTGTTACTCATTCAAGCATTTAGAGATAATTTAGATCCTGGAACTTTTGACTTGAAAGGGCTGTACGAAGCCATTGAGGAATGCATCATTAATGATCCTTGGGTCCTTTTAAATGCTTCATGGTTCAACTCCTTCCTTAAAGCAGTACAATTGAGCATGTGAAGAACTCTATCAGCTTTGATTCAATGTAAGAAAAAAGTACCTTGTTTCTACT
                AGCAGAAGCAGGGTCACTATTACTCTGTGCTACTATGGAGCTGATTGTCCTACTAATCCTTCTCAATCCTTATACTTTTGTATTAGGGGACAGAATATGCATAGGCTATCAAGCAAACCAAAATAACCAAACGGTTAACACTTTGCTCGAACAGAATGTTCCAGTTACCGGAGCACAGGAAATACTAGAAACCAATCACAATGGAAAGTTATGCAGCCTAAATGGGGTCCCACCATTGGACCTACAATCATGCACTCTGGCCGGGTGGTTACTGGGGAATCCGAACTGTGACAGCCTATTGGAAGCAGAAGAATGGTCGTATATAAAAATAAATGAAAGTGCCCCTGACGATCTTTGCTTCCCTGGGAACTTCGAAAACTTACAGGACTTACTACTAGAAATGTCAGGAGTTCAAAATTTCACCAAGGTGAAACTATTCAACCCCCAAAGTATGACTGGGGTAACTACCAATAATGTCGACCAGACTTGCCCTTTTGAAGGGAAACCATCTTTCTACAGAAACCTCAACTGGATACAAGGGAATAGCGGTTTGCCTTTCAATATAGAAATCAAGAATCCAACTAGCAATCCATTGCTCCTTCTCTGGGGGATCCACAACACCAAGGATGCAGCACAACAAAGAAATCTCTATGGAAATGATTACTCTTATACTATTTTTAACTTTGGAGAGAAAAGTGAAGAATTTCGACCTGAAATCGGGCAAAGAGATGAAGTCAAAGCCCATCAAGACAGAATCGATTACTACTGGGGAAGCCTACCAGCGCAGAGCACTCTAAGGATAGAATCCACCGGAAATCTAATCGCACCAGAATATGGCTTTTATTACAAGCGAAAAGAGGGGAAAGGGGGGCTAATGAAAAGTAAGCTGCCAATTAGTGACTGCTCAACCAAATGTCAAACACCCCTGGGAGCTCTCAACAGTACCCTGCCCTTTCAAAACGTTCACCAACAAACAATTGGTAATTGTCCCAAATATGTGAAGGCTACCTCCTTGATGCTTGCCACAGGGCTAAGAAACAATCCCCAAATGGAGGGAAGAGGTCTCTTTGGAGCCATTGCCGGGTTTATTGAAGGAGGGTGGCAAGGGATGATTGATGGTTGGTATGGATACCACCACGAGAATCAAGAAGGAAGCGGCTACGCCGCTGACAAAGAAGCCACTCAAAAGGCTGTCGATGCCATAACGAACAAAGTGAACAGTATTATTGACAAAATGACAGCCAATTCGAATCCAACATCAAAGAGTTCAACAGGTTGGAACTCAGGATACAACACCTAAGTGATAGAGTTGATGATGCGTTACTTGACATTTGGTCCTATAATACTGAATTACTTGTCCTCTTAGAAAATGAAAGAACCCTTGATTTCCATGATGCTAATGTAAAGAACCTCTTTGAAAAAGTGAAGGCCCAATTGAAGGACAATGCAATAGATGAAGGAAATGGTTGCTTTCTACTTTTACACAAGTGTAACAACTCTTGCATGGACGACATAAAGAATGGGACATACAAATACATGGACTATAGGGAAGAGTCACACATCGAGAAACAGAAAATCGATGGGGTAAAACTAACTGATTACTCTAGATACTATATCATGACTCTGTATTCTACCATTGCATCATCCGTCGTGCTTGGCTCGTTGATAATAGCCGCTTTTCTTTGGGGGTGCCAAAAAGGCTCAATCCAATGTAAAATATGTATATAGAACGGTGGAATTAACCTTGTCATTCAGAAAAGCAAAAAAGACCCTTGTTTCTACT
                AGCAGAAGCAGGGTTAATAATCACATTGTGACATTTAAAGATGACAACTCAAGGCCTTAAACGCACCTTCGAGCAAATGGAGACTGACTCCAAACAGAGCACCACTGAAATCAGATCCGCAGTCGGAAGAATGGTGAAAGCAATTGGGAAATTCTACATCCAAATGTGTGCAGAAATGAAATTAGATGACAAGGAGGGAGCCCTGATCCAGAACAGCATAACAATTGAAAGGATGGCACTCTCAGCATTCGACGAGAGAAGAAATAAATACTTAGAAGAGCACCCCACTGTGGGGAAAGACCCCAAGAAGACAGGTGGGCCCATCTACAGGAGAAAAGATGGAAAATGGGAGAGAGAGATGGCCCTCATGGAAAAGGAAAACATCCGAGCAATATGGAAAATGGCTAATGAAGGAGAGGAGAATCTATCTGGTCTAAGCCATATTATGATCTGGCACTCAAACTTAAATGACACAACCTATCAGCGAACAAGAGCCCTTGTCAGAACAGGAATGGACCCAAGGATGTGCTCGTTGATGCAGGGCTCAACTCTTCCAAGAAGAGCTGGAGCAGCTGGGACTGCAGTCAAAGGAGTGGGGACCCTCATAATGGAGTTGATCCGGATGATCAAAAGAGGAATGAATGACAGAAATTTCTGGAAGGGTGAACAAGGGAGAAGAACTCGAACAGCTTATGAAAGGCTCTGTGGAAACCTGAAAGGAAAGTTTCAAACAGCCCCACAGAAAGCAATGGTTGATCAAGTCAAAGAAGGAAAAAACCCAGGAAATGCAGAAATAGAGGACTTACTATTTCTTGCAAGATCTGCCCTGATCCTCCGAGGAGCAGTAGCTCATAAGTCAGCTCTCCCAGCCTGTGTATATGGTCTTGGGGTCGCCAGAGGGTTTGACTTTGAAAAAGAGGGATACTCTCTAGTAGGCAGAGACCCCTACTTGCTCCTGCAGAACTCCCAGATTTTCTCCATCCTGAGAAAGGGGGAGAACGCTGCACACAAAAGTCAGCTAGTGTGGATGGCCTGCCATGCTGCAGCCTTTGAGGACATAAGGATCAGCAGCTTTATCAAGGGAAGCAAAATAATCCCTCGGGGCAAGCTAGAAACAAGAGGATTACAAATTGCTGGCTCTGAAAGTCTAGATGAAATCCTGGTAATCAGCTTGGACCTCAAAAGTCATTATTGGGCAATCAAAACTAGGAGTGGGGGTAATCCCCAACAATCAAGAAGCACAGCTGGTCAAATAGCGGTGCAACCTACCTTTTCCGTCCAAAGAAATATCCCCTTTGAGAAAAAGACGATCATGGCGGCCTTCTCAACAACCGAAGAAGGGAGAATCACAGACATGAGGACTGAAATAATCAGACTTATGGAAAACTCAGACCCAAAGGAGAAAGTCTTCATAGGGCGAGGCGTCTTCGAGATGGGAGACGAGAAGGCAACTAACCCGATAGTGCCTCCACTAGATGGGAATGACGAGGGTTCTTATTTCTTTGGAGACAAGGCAGACGAGTTCGACATTTGAGCAAAAAATACCCTTGTTTCTACT
                AGCAGAAGCAGGAGTTTTTAATAATGTCTATCAACGGAACGACATGTCTACTCACACTCAGTCTAATACTCAATGTTATAATGATAGGGCTCCAAATCCTGATGCCCTTTATTCTTTTATGGACCAACAGCCCCCCGCCAGAAATCTCCAACAGCACTAGCTGCTGCAACGGAACCTTTCTGAATGAAACAAACAACAATATAACCAATATATCACAAATAACCAATAATTTCCTCAAAGAAGAGAAATTCTACTGGAGGGCAAAATCCCAAATGTGCGAAGTCAAAGGTTGGGTTCCTACACATAGAGGGTTCCCTTGGGGTCCTGAGCTCCCCGGAGACTTAATTCTCAGTAGGAGGGCATACGTTAGCTGTGACTTGACATCCTGTTTCAAATTCTTTATTGCTTACGGCCTCAGTGCAAATCAGCACTTATTGAACACAAGTATGGAGTGGGAAGAAAGCCTGTACAAAACTCCAATTGGAAGTGCAAGCACCTTAAGCACTTCAGAAATGATTCTCCCCGGGAGAAGTTCATCAGCATGCTTCGACGGGCTAAAATGGACCGTCCTGGTAGCTAATGGCAGAGACCGGAACAGCTTCATAATGATCAAATATGGAGAGGAAGTAACAGACACTTTCTCGGCCAGCAGAGGAGGTCCCCTGCGACTCCCCAACTCAGAATGCATCTGTATAGAAGGAAGTTGTTTTGTAATAGTAAGTGACGGACCCAATGTGAATCAGAGCGTCCACCGGATCTATGAACTCCAAAATGGAACAGTCCAGAGATGGAAGCAGCTAAATACAACTGGCATAAACTTTGAATACAGCACGTGCTATACAATCAACAACCTGATAAAGTGCACTGGGACAAATCTCTGGAATGATGCCAAAAGACCTTTGCTCCGATTCACTAAGGAACTCAACTATCAGATTGTAGAGCCCTGCAATGGGGCTCCCACAGATTTCCCCAGAGGCGGGCTTACCACCCCAAGTTGCAAGATGGCTCAAGAAAAAGGAGAAGGAGGGATTCAGGGTTTCATACTTGACGAGAAACCAGCCTGGACCTCAAAAACAAAGGCTGAGTCATCTCAGAATGGTTTTGTATTAGAACAAATTCCTAACGGGATAGAAAGTGAAGGAACAGTTTCATTAAGCTATGAACTTTTTTCTAACAAGAGAACCGGAAGGAGTGGATTCTTTCAACCCAAAGGAGACCTCATTTCTGGATGCCAACGAATCTGTTTCTGGCTGGAAATAGAAGATCAAACAGTAGGCCTAGGAATGATTCAAGAACTCAGCACTTTCTGTGGGATAAACTCACCTGTTCAGAATATAAATTGGGATTCATGACCAATGGACAGCGAATGAAAAAACTCCTTGTTTCTACT
                AGCAGAAGCAGGCATTATCCAAAATGAGCATCTTAACAGAGGTTGAAACGTACGTTCTATCAATCATCCCATCAGGGCCTCTAAAAGCTGACATAGCCCAAAAGCTCGAGGATGTCTTCTCAGGCCGAAACAGCGACCTGGACACCTTATTAGAATGGCTAAAGGCCAGACCCATACTGTCCCCATTAACAAAGGGAATTGTCGGCTTTGTTTTCACACTCACAGTGCCATGTGAGAAGGGCGCCCCTAGACGGAAATTCATACAAACGGCCCTCAATGGAAATGGAGAGGCGGCCAATATGGACAAGGCAGTTAAAATCTACAAAAAGTTGAAAAAGGAGATAACTTTCCATGGGGCCAAGGAAGTGGCACTAAGCTACCCAACTGGGGCATTAGCATGCTGCATGGGGCTCATCTACAATAGAATGGGATCTGTGACAACCGAAGTGGCATTTGGCTTAGTCTGTGCTACTTGTGAGCACATTGCCGATTCTCAATATAGATCTCATCGGCAGATGATAAGCTCGACAAATCCCCTGATCAGACATGAAAACAGAATGGCAACGGCAGCAAGCACTGCAAAGGCCATGGAACAATGGCTAGCAGTAGCGAACAAGCTGCTGAAGCAATGGAAATTGCTTCACAGGCCAGGCAAATGATTCAAGCAATGAGGGCTATCGGGACCCACCCAACAACTTCCAGTGGGCTTAAAGACGATCTCCTTGATAATCTACAGGCCTACCAGAAGAGAATGGGAATCCAAATGCAGAGGTTTAAATGAAGACTTGATCCTGGCGGCCAACATAATTGGAATCCTTCATCTGGCACTCTGGATTATAGACAGATGGCTATACAGCTATAGTCTAGCATTATATCAGCAGATACGGAGCCACTGGGTAATTAGAACTGTCGATTCCACAAGGGAACTAAGAGAAGAATTTAAAGAAGAACACACGGCAATTGAAAATCCGGACCCTATCATAGTAATCATGGAAAAGTGAAATGAAAAAATGCCTTGTTTCTACT
                AGCAGAAGCAGGGTATCTAAAGACATAATGGAACCAAACCCGACAACTATCGCATTTCAGGTAGACTGTTATCTATGGCACCTGAAAAAGACGCTTAGCATGATGGGAGAGGTTGACGCCCCGTTCGAGGACCGACTCCGAAGAGAACAGAAAGCACTGAAAGGAAGGAGCATGACTCTGGGGATAGACATTCAATCAGCAACCCAAGAAGGGTACTACAAGATCAAGTCTATCACAGAAGAAAGCATGCCCTCCTATGGAATACTACCAAATGCAGGACAAAACGAACCCAAATATATAACAGAGATGACTCAAGAGGAAACAATCAGAAACTGGGTGATGATCCAACCTAAGCAAAAGGTTATCTCCGGGAGGATCTTGATCAGCATGGACCAAGCAGTAACCAATAAAGTCTTAACAATAAAGGCAAATTTCACTGTCTGCTTTGGAAAACTAGAAAGGCTTGTATTAGCTAGAGCTTTCACAGAAGAAGGGACAGTAGTGGGTGAAATCAACCCTCTGTCTTTTGTTACAGGACATACTGGAGAGGATGTCAAAACTGCATATGAACTCTTCAGAAGTGGATTTGAATGGAATGATAACACAATTGACGAATCTCAGATTCTACAGAGACTCGCTAGGGGAGTCATTAATGAGAACCGGAGACTACCGCAAGATGGCTCAACAGAATAACAATTGGAGACTCCAATTAGGGGAGAAATTAACAATTATTAGAAATCTAATTCAAACGTGCCGGGAGGTGCTAATGACCTCATCTAACAGTTTTGTAGAGATAACCTTCCTCGCTGCACTTGACCTCTTATTGGAGGTCGAAAGAGAAATGAGAACCTTGGCTTTTCAGCTGATATGATTAAAAAATACCCTTGTTTCTACT
                H17N10?

                So it isn't just a new HA, but a new NA as well...

                Comment


                • #9
                  Re: PNAS: A distinct lineage of influenza A virus from bats

                  all segments are new

                  is it even flu-A ?
                  I should compare with flu-B,flu-C - although these have different segments

                  ---------------------------

                  ok, it's flu-A
                  except segment 6
                  I'm interested in expert panflu damage estimates
                  my current links: http://bit.ly/hFI7H ILI-charts: http://bit.ly/CcRgT

                  Comment


                  • #10
                    Re: PNAS: A distinct lineage of influenza A virus from bats

                    I dare an estimate that the segments went from birds to bats in the years

                    segment 1 : ~1500
                    segment 2 : ~1700
                    segment 3 : ~1600
                    segment 5 : ~1650
                    I'm interested in expert panflu damage estimates
                    my current links: http://bit.ly/hFI7H ILI-charts: http://bit.ly/CcRgT

                    Comment


                    • #11
                      Re: PNAS: A distinct lineage of influenza A virus from bats

                      now I'm wondering ...
                      did that other distant influenza-strain
                      with mammalean characteristics also come from bats ?
                      Reassortants were found in mallards in Mississippi

                      http://www.setbb.com/fluwiki2/viewto...forum=fluwiki2


                      AT-scores: (ratio of nucleotides that are A or T) total and in the 8 segments
                      Code:
                      5614  5592,5760,5708,5778,5357,5716,5213,5453,  -  >A/Index/early human/~1935(H1N1)
                      5574  5561,5659,5620,5802,5310,5751,5152,5465,  -  >A/Brevig Mission/1/1918(H1N1)
                      5611  5592,5703,5685,5837,5317,5829,5152,5465,  -  >A/Index/early swine/~1935(H1N1)
                      
                      5505  5531,5659,5674,----,5220,----,5150,----,  -  >A/duck/Memphis/546/1974(H11N9)
                      5720  ----,----,----,5767,----,5652,----,----,  -  >A/Anas crecca/Spain/1384/2007(H1N1)
                      5506  5472,5642,5723,----,5214,----,5170,5584,  -  >A/Index/7 birds similar to BM18/~1975
                      5556  5417,5756,5535,5830,5285,5770,5110,5543,  -  >A/pintail/Alaska/20/2005(H12N5)
                      5569  5574,5753,5620,5696,5258,5594,5121,5719,  -  >A/mallard/Interior Alaska/2/2007(H4N6)
                      5560  5510,5732,5655,5655,5234,5659,5183,5649,  -  >A/pintail/Alaska/279/2005(H3N8)
                      5570  5547,5742,5656,5649,5226,5665,5216,5649,  -  >A/mallard/Alaska/715/2005(H3N8)
                      5737  5729,5798,5797,5821,5519,5986,5309,5745,  -  >A/duck/LA/17G/1987(H3N8)
                      6087  6073,6167,6270,6199,5850,6176,5483,6187,  -  >A/equine/Lexington/1-1/1966(H7N7)
                      6016  ----,----,----,----,5814,6152,----,6150,  -  >A/equine/Prague/1-3/1956(H7N7)
                      5978  6091,5533,----,6216,5814,6713,5530,6191,  -  >A/equine/Prague/1-1/1956(H7N7)
                      5897  ----,----,----,----,5725,6142,5550,6191,  -  >A/equine/Prague/1-2/1956(H7N7)
                      5733  5594,5606,5735,6203,5267,6184,5570,5777,  -  >A/equine/Kentucky/1a/1975(H7N7)
                      5548  5526,5540,5652,5797,5272,5624,5131,5710,  -  >A/equine/Uruguay/1/1963(H3N8)
                      5733  5681,5728,5893,5959,5444,5890,5248,5849,  -  >A/swine/Chibi/01/2005/12/15(H3N8)
                      
                      5621  5723,5743,5741,5543,5384,5687,5236,5627,  -  >1968//,182,CHN,A/Beijing/1/68
                      5615  5666,5751,5741,5584,5357,5673,5226,5675,  -  >1972//,1643,RUS,A/Udorn/307/72
                      5641  5710,5769,5788,5617,5357,5695,5241,5663,  -  >1979//,4199,THA,A/Bangkok/01/79
                      5643  5706,5756,5783,5673,5344,5702,5224,5675,  -  >1983//,5660,HKG,A/HK/14/83
                      5654  5701,5783,5783,5667,5384,5677,5259,5722,  -  >1989//,7852,CHN,A/Beijing/353/89
                      5665  5736,5773,5778,5720,5364,5702,5248,5746,  -  >1997/11/29,10924,USA,A/NY/503/97
                      5674  5728,5760,5736,5784,5437,5687,5243,5817,  -  >2007/02/06,14278,AUS,A/Brisbane/10/07
                      
                      5548  5526,5540,5652,5797,5272,5624,5131,5710,  -  >A/equine/Uruguay/1/1963(H3N8)
                      5680  5711,5719,5873,5802,5361,5613,5419,5734,  -  >A/little yellow-shouldered bat/Guatemala/153/2009/05/(H17N10)
                      5733  5681,5728,5893,5959,5444,5890,5248,5849,  -  >A/swine/Chibi/01/2005/12/15(H3N8)
                      5737  5729,5798,5797,5821,5519,5986,5309,5745,  -  >A/duck/LA/17G/1987(H3N8)
                      5990  6071,6179,6166,5774,5765,5746,6138,5964,  -  >B/Mississippi/UR06-0031/2007
                      6087  6073,6167,6270,6199,5850,6176,5483,6187,  -  >A/equine/Lexington/1-1/1966(H7N7)
                      
                      5574  5561,5659,5620,5802,5310,5751,5152,5465,  -  >A/Brevig Mission/1/1918(H1N1)
                      5587  5578,5681,5639,5778,5310,5808,5142,5477,  -  >A/swine/Jamesburg/1942(H1N1)
                      5663  5684,5839,5741,5753,5370,5817,5158,5596,  -  >A/Denver/57(H1N1)
                      5691  5614,5848,5792,5978,5357,5851,5244,5489,  -  >A/New Jersey/1976(H1N1)
                      5669  5671,5826,5750,5843,5283,5810,5274,5584,  -  >A/Index/1977(H1N1)
                      5742  5820,5897,5834,5812,5384,5866,5366,5596,  -  >A/Kansas/UR06-0068/2007(H1N1)
                      5632  5526,5800,5578,5920,5377,5794,5285,5608,  -  >A/******/index/2009-02-01
                      
                      
                      5680  5711,5719,5873,5802,5361,5613,5419,5734,  -  >A/bat/Guatemala/153/2009/05/(H17N10)
                      5737  5729,5798,5797,5821,5519,5986,5309,5745,  -  >A/duck/LA/17G/1987(H3N8)
                      I'm interested in expert panflu damage estimates
                      my current links: http://bit.ly/hFI7H ILI-charts: http://bit.ly/CcRgT

                      Comment


                      • #12
                        Re: PNAS: A distinct lineage of influenza A virus from bats

                        here they talk 14 min about the batflu-paper:
                        http://traffic.libsyn.com/twiv/TWiV173.mp3
                        (right click to download, >80MB)
                        at 1:07-1:21

                        but mainly about bats in general, no genetics

                        nobody wants to know whether there was flu in America before Columbus ?!

                        early pandemics,passenger pigeons, great epizootic from 1872
                        did those viruses come from Europe, was it European influenza
                        that killed ~80% of native Americans in the 16th century
                        does flu go back from mammals to birds
                        how long do flu-strains survive in mammals before
                        the next strain replaces them
                        what "event" created all current flu-A's inner segments in the
                        19th,18th century and no other strains survived
                        can some similar future event kill all existing flu, except
                        maybe one strain

                        is the bat-flu close to Ozeania- or South America flu in some
                        segments

                        the whole discovery is mainly interesting for genetics+history,
                        not so much for epidemiology/epizootics (IMO)

                        ---------------------------
                        infection may be the result of oral–faecal transmission,” says Donis.
                        The real questions are ‘where else could we find influenza?’ and 'have we looked carefully everywhere?'”
                        he says.
                        I'm interested in expert panflu damage estimates
                        my current links: http://bit.ly/hFI7H ILI-charts: http://bit.ly/CcRgT

                        Comment


                        • #13
                          Re: PNAS: A distinct lineage of influenza A virus from bats

                          all sequences from the new mammalean strain ("17g")


                          Code:
                          >43.17g     ,>43B        ,>43C          ,   965, 218, 218 ,     ,>CY032720,A/northern pintail/California/HKWF792/2007,2007/11/28,190352448,Avian,H3N8,4,USA,Hatch Year,F,
                          >5.17g_06   ,>5.17g      ,>5.7bi        ,  1234, 813, 258 ,     ,>CY032721,A/northern pintail/California/HKWF792/2007,2007/11/28,190352450,Avian,H3N8,5,USA,Hatch Year,F,
                          >5.17g_06   ,>5.17g      ,>5.7bi        ,  1234, 813, 258 ,     ,>CY032721,A/northern pintail/California/HKWF792/2007,2007/11/28,190352450,Avian,H3N8,5,USA,Hatch Year,F,
                          >68.17g     ,>68A        ,>68C          ,   804, 161, 138 ,     ,>CY032722,A/northern pintail/California/HKWF792/2007,2007/11/28,190352452,Avian,H3N8,6,USA,Hatch Year,F,
                          >81.17g_06  ,>81.17g     ,>8.7bi        ,   768, 573, 283 ,     ,>CY032724,A/northern pintail/California/HKWF792/2007,2007/11/28,190352457,Avian,H3N8,8,USA,Hatch Year,F,
                          >81.17g_06  ,>81.17g     ,>8.7bi        ,   768, 573, 283 ,     ,>CY032724,A/northern pintail/California/HKWF792/2007,2007/11/28,190352457,Avian,H3N8,8,USA,Hatch Year,F,
                          
                          >44.17g_06  ,>44A        ,>44C          ,  1693, 308,  68 ,     ,>CY053821,A/pekin duck/California/P30/2006,2006/03/06,282266286,Avian,H4N2,4,USA,,,
                          >7.17g_06   ,>7.17g      ,>7eNA         ,   979, 648, 373 ,     ,>CY053822,A/pekin duck/California/P30/2006,2006/03/06,282266288,Avian,H4N2,7,USA,,,
                          >7.17g_06   ,>7.17g      ,>7eNA         ,   979, 648, 373 ,     ,>CY053822,A/pekin duck/California/P30/2006,2006/03/06,282266288,Avian,H4N2,7,USA,,,
                          >62.17g_06  ,>62G        ,>62D          ,  1406, 417, 381 ,     ,>CY053823,A/pekin duck/California/P30/2006,2006/03/06,282266291,Avian,H4N2,6,USA,,,
                          >5.17g_06   ,>5.17g      ,>5es          ,  1493, 869, 243 ,     ,>CY053824,A/pekin duck/California/P30/2006,2006/03/06,282266293,Avian,H4N2,5,USA,,,
                          >5.17g_06   ,>5.17g      ,>5es          ,  1493, 869, 243 ,     ,>CY053824,A/pekin duck/California/P30/2006,2006/03/06,282266293,Avian,H4N2,5,USA,,,
                          >81.17g_06  ,>81.17g     ,>8.7bi        ,   833, 590, 249 ,     ,>CY053825,A/pekin duck/California/P30/2006,2006/03/06,282266295,Avian,H4N2,8,USA,,,
                          >81.17g_06  ,>81.17g     ,>8.7bi        ,   833, 590, 249 ,     ,>CY053825,A/pekin duck/California/P30/2006,2006/03/06,282266295,Avian,H4N2,8,USA,,,
                          >3.17g_06   ,>3.17g      ,>3.7bi        ,  2152,1148, 674 ,     ,>CY053826,A/pekin duck/California/P30/2006,2006/03/06,282266298,Avian,H4N2,3,USA,,,
                          >3.17g_06   ,>3.17g      ,>3.7bi        ,  2152,1148, 674 ,     ,>CY053826,A/pekin duck/California/P30/2006,2006/03/06,282266298,Avian,H4N2,3,USA,,,
                          >2.17g_06   ,>2.17g      ,>2B           ,  2268,1237, 538 ,     ,>CY053827,A/pekin duck/California/P30/2006,2006/03/06,282266300,Avian,H4N2,2,USA,,,
                          >2.17g_06   ,>2.17g      ,>2B           ,  2268,1237, 538 ,     ,>CY053827,A/pekin duck/California/P30/2006,2006/03/06,282266300,Avian,H4N2,2,USA,,,
                          >1.17g_06   ,>1.17g      ,>1eNA         ,  2275,1400, 443 ,     ,>CY053828,A/pekin duck/California/P30/2006,2006/03/06,282266303,Avian,H4N2,1,USA,,,
                          >1.17g_06   ,>1.17g      ,>1eNA         ,  2275,1400, 443 ,     ,>CY053828,A/pekin duck/California/P30/2006,2006/03/06,282266303,Avian,H4N2,1,USA,,,
                          
                          >43.17g     ,>43C        ,>43B          ,   973, 200, 189 ,     ,>CY076013,A/cinnamon teal/California/44287-325/2007,2007/01/27,310753545,Avian,H3N8,4,USA,,,
                          >7.17g_06   ,>7.17g      ,>7.7bi        ,   935, 627, 382 ,     ,>CY076014,A/cinnamon teal/California/44287-325/2007,2007/01/27,310753547,Avian,H3N8,7,USA,,,
                          >7.17g_06   ,>7.17g      ,>7.7bi        ,   935, 627, 382 ,     ,>CY076014,A/cinnamon teal/California/44287-325/2007,2007/01/27,310753547,Avian,H3N8,7,USA,,,
                          >68.17g     ,>68A        ,>68C          ,   826, 139, 107 ,     ,>CY076015,A/cinnamon teal/California/44287-325/2007,2007/01/27,310753550,Avian,H3N8,6,USA,,,
                          >5.17g_06   ,>5.17g      ,>5EU          ,  1295, 852, 257 ,     ,>CY076016,A/cinnamon teal/California/44287-325/2007,2007/01/27,310753552,Avian,H3N8,5,USA,,,
                          >5.17g_06   ,>5.17g      ,>5EU          ,  1295, 852, 257 ,     ,>CY076016,A/cinnamon teal/California/44287-325/2007,2007/01/27,310753552,Avian,H3N8,5,USA,,,
                          >81.17g_06  ,>81.17g     ,>8.7bi        ,   727, 595, 280 ,     ,>CY076017,A/cinnamon teal/California/44287-325/2007,2007/01/27,310753554,Avian,H3N8,8,USA,,,
                          >81.17g_06  ,>81.17g     ,>8.7bi        ,   727, 595, 280 ,     ,>CY076017,A/cinnamon teal/California/44287-325/2007,2007/01/27,310753554,Avian,H3N8,8,USA,,,
                          >3.17g_06   ,>3.17g      ,>3.7bi        ,  1973,1108, 668 ,     ,>CY076018,A/cinnamon teal/California/44287-325/2007,2007/01/27,310753557,Avian,H3N8,3,USA,,,
                          >3.17g_06   ,>3.17g      ,>3.7bi        ,  1973,1108, 668 ,     ,>CY076018,A/cinnamon teal/California/44287-325/2007,2007/01/27,310753557,Avian,H3N8,3,USA,,,
                          >2.17g_06   ,>2.17g      ,>2B           ,  1743,1117, 549 ,     ,>CY076019,A/cinnamon teal/California/44287-325/2007,2007/01/27,310753559,Avian,H3N8,2,USA,,,
                          >2.17g_06   ,>2.17g      ,>2B           ,  1743,1117, 549 ,     ,>CY076019,A/cinnamon teal/California/44287-325/2007,2007/01/27,310753559,Avian,H3N8,2,USA,,,
                          >1.17g_06   ,>1.17g      ,>1eNA         ,  1689,1290, 446 ,     ,>CY076020,A/cinnamon teal/California/44287-325/2007,2007/01/27,310753560,Avian,H3N8,1,USA,,,
                          >1.17g_06   ,>1.17g      ,>1eNA         ,  1689,1290, 446 ,     ,>CY076020,A/cinnamon teal/California/44287-325/2007,2007/01/27,310753560,Avian,H3N8,1,USA,,,
                          
                          >5.17g_06   ,>5.17g      ,>5.I92_03     ,  1213, 779, 254 ,     ,>CY076096,A/American coot/California/20181-006/2007,2007/03/02,310698826,Avian,H10N3,5,USA,,,
                          >5.17g_06   ,>5.17g      ,>5.I92_03     ,  1213, 779, 254 ,     ,>CY076096,A/American coot/California/20181-006/2007,2007/03/02,310698826,Avian,H10N3,5,USA,,,
                          >81.17g_06  ,>81.17g     ,>8.7bi        ,   762, 606, 268 ,     ,>CY076097,A/American coot/California/20181-006/2007,2007/03/02,310698828,Avian,H10N3,8,USA,,,
                          >81.17g_06  ,>81.17g     ,>8.7bi        ,   762, 606, 268 ,     ,>CY076097,A/American coot/California/20181-006/2007,2007/03/02,310698828,Avian,H10N3,8,USA,,,
                          >43.17g     ,>43B        ,>43C          ,   925, 189, 189 ,     ,>CY076165,A/American coot/Oregon/20589-007/2007,2007/12/17,310698990,Avian,H3N8,4,USA,,,
                          >68.17g     ,>68A        ,>68C          ,   824, 134, 101 ,     ,>CY076167,A/American coot/Oregon/20589-007/2007,2007/12/17,310698995,Avian,H3N8,6,USA,,,
                          >5.17g_06   ,>5.17g      ,>5.I92_03     ,  1249, 812, 250 ,     ,>CY076168,A/American coot/Oregon/20589-007/2007,2007/12/17,310698997,Avian,H3N8,5,USA,,,
                          >5.17g_06   ,>5.17g      ,>5.I92_03     ,  1249, 812, 250 ,     ,>CY076168,A/American coot/Oregon/20589-007/2007,2007/12/17,310698997,Avian,H3N8,5,USA,,,
                          >81.17g_06  ,>81.17g     ,>8.7bi        ,   768, 585, 267 ,     ,>CY076169,A/American coot/Oregon/20589-007/2007,2007/12/17,310698999,Avian,H3N8,8,USA,,,
                          >81.17g_06  ,>81.17g     ,>8.7bi        ,   768, 585, 267 ,     ,>CY076169,A/American coot/Oregon/20589-007/2007,2007/12/17,310698999,Avian,H3N8,8,USA,,,
                          
                          >44.17g_06  ,>44A        ,>44C          ,   403, 161,  56 ,     ,>CY076824,A/mallard/California/JN808/2006,2006/12/06,311529135,Avian,H4N2,4,USA,,,
                          >7.17g_06   ,>7.17g      ,>7.7bi        ,   923, 618, 388 ,     ,>CY076825,A/mallard/California/JN808/2006,2006/12/06,311529140,Avian,H4N2,7,USA,,,
                          >7.17g_06   ,>7.17g      ,>7.7bi        ,   923, 618, 388 ,     ,>CY076825,A/mallard/California/JN808/2006,2006/12/06,311529140,Avian,H4N2,7,USA,,,
                          >62.17g_06  ,>62G        ,>62D          ,  1033, 397, 363 ,     ,>CY076826,A/mallard/California/JN808/2006,2006/12/06,311529151,Avian,H4N2,6,USA,,,
                          >5.17g_06   ,>5C         ,>5D           ,   151, 106,  91 ,     ,>CY076827,A/mallard/California/JN808/2006,2006/12/06,311529164,Avian,H4N2,5,USA,,,
                          >81.17g_06  ,>81.17g     ,>8.7bi        ,   739, 607, 280 ,     ,>CY076828,A/mallard/California/JN808/2006,2006/12/06,311529177,Avian,H4N2,8,USA,,,
                          >81.17g_06  ,>81.17g     ,>8.7bi        ,   739, 607, 280 ,     ,>CY076828,A/mallard/California/JN808/2006,2006/12/06,311529177,Avian,H4N2,8,USA,,,
                          >3.17g_06   ,>3.17g      ,>3.7bi        ,   887, 549, 330 ,     ,>CY076829,A/mallard/California/JN808/2006,2006/12/06,311529191,Avian,H4N2,3,USA,,,
                          >3.17g_06   ,>3.17g      ,>3.7bi        ,   887, 549, 330 ,     ,>CY076829,A/mallard/California/JN808/2006,2006/12/06,311529191,Avian,H4N2,3,USA,,,
                          >2.17g_06   ,>2.17g      ,>2B           ,   875, 647, 317 ,     ,>CY076830,A/mallard/California/JN808/2006,2006/12/06,311529203,Avian,H4N2,2,USA,,,
                          >2.17g_06   ,>2.17g      ,>2B           ,   875, 647, 317 ,     ,>CY076830,A/mallard/California/JN808/2006,2006/12/06,311529203,Avian,H4N2,2,USA,,,
                          >1.17g_06   ,>1.17g      ,>1C           ,   301, 257, 154 ,     ,>CY076831,A/mallard/California/JN808/2006,2006/12/06,311529216,Avian,H4N2,1,USA,,,
                          >1.17g_06   ,>1.17g      ,>1C           ,   301, 257, 154 ,     ,>CY076831,A/mallard/California/JN808/2006,2006/12/06,311529216,Avian,H4N2,1,USA,,,
                          
                          >5.17g_06   ,>5.17g      ,>5EU          ,  1163, 816, 239 ,     ,>CY079407,A/American coot/Mississippi/09OS615/2009,2009/01/24,315440615,Avian,H10N3,5,USA,,,
                          >5.17g_06   ,>5.17g      ,>5EU          ,  1163, 816, 239 ,     ,>CY079407,A/American coot/Mississippi/09OS615/2009,2009/01/24,315440615,Avian,H10N3,5,USA,,,
                          >81.17g_06  ,>81.17g     ,>8.7bi        ,   722, 564, 256 ,     ,>CY079408,A/American coot/Mississippi/09OS615/2009,2009/01/24,315440617,Avian,H10N3,8,USA,,,
                          >81.17g_06  ,>81.17g     ,>8.7bi        ,   722, 564, 256 ,     ,>CY079408,A/American coot/Mississippi/09OS615/2009,2009/01/24,315440617,Avian,H10N3,8,USA,,,
                          
                          >68.17g     ,>68A        ,>68C          ,   769, 113,  78 ,     ,>CY097129,A/mallard/Ohio/2039/2009,2009/08/03,343971333,Avian,mixed̃N8,6,USA,,,
                          >5.17g_06   ,>5.17g      ,>5EU          ,  1201, 817, 239 ,     ,>CY097162,A/American coot/Illinois/3405/2009,2009/10/31,343971411,Avian,H10N3,5,USA,,,
                          >5.17g_06   ,>5.17g      ,>5EU          ,  1201, 817, 239 ,     ,>CY097162,A/American coot/Illinois/3405/2009,2009/10/31,343971411,Avian,H10N3,5,USA,,,
                          >81.17g_06  ,>81.17g     ,>8.7bi        ,   689, 541, 280 ,     ,>CY097163,A/American coot/Illinois/3405/2009,2009/10/31,343971413,Avian,H10N3,8,USA,,,
                          >81.17g_06  ,>81.17g     ,>8.7bi        ,   689, 541, 280 ,     ,>CY097163,A/American coot/Illinois/3405/2009,2009/10/31,343971413,Avian,H10N3,8,USA,,,
                          
                          >43.17g     ,>43C        ,>43B          ,   965, 199, 193 ,     ,>CY097678,A/American green-winged teal/Mississippi/285/2010,2010/01/14,343978467,Avian,H3N8,4,USA,,,
                          >68.17g     ,>68A        ,>68C          ,   769, 153, 103 ,     ,>CY097680,A/American green-winged teal/Mississippi/285/2010,2010/01/14,343978472,Avian,H3N8,6,USA,,,
                          >5.17g_06   ,>5.17g      ,>5es          ,  1106, 785, 250 ,     ,>CY097681,A/American green-winged teal/Mississippi/285/2010,2010/01/14,343978474,Avian,H3N8,5,USA,,,
                          >5.17g_06   ,>5.17g      ,>5es          ,  1106, 785, 250 ,     ,>CY097681,A/American green-winged teal/Mississippi/285/2010,2010/01/14,343978474,Avian,H3N8,5,USA,,,
                          >81.17g_06  ,>81.17g     ,>8.7bi        ,   738, 592, 272 ,     ,>CY097682,A/American green-winged teal/Mississippi/285/2010,2010/01/14,343978476,Avian,H3N8,8,USA,,,
                          >81.17g_06  ,>81.17g     ,>8.7bi        ,   738, 592, 272 ,     ,>CY097682,A/American green-winged teal/Mississippi/285/2010,2010/01/14,343978476,Avian,H3N8,8,USA,,,
                          >43.17g     ,>43C        ,>43B          ,   962, 196, 186 ,     ,>CY097702,A/mallard/Mississippi/354/2010,2010/01/16,343978524,Avian,H3N8,4,USA,,,
                          >68.17g     ,>68A        ,>68C          ,   805, 147,  97 ,     ,>CY097704,A/mallard/Mississippi/354/2010,2010/01/16,343978529,Avian,H3N8,6,USA,,,
                          >5.17g_06   ,>5.17g      ,>5es          ,  1097, 813, 254 ,     ,>CY097705,A/mallard/Mississippi/354/2010,2010/01/16,343978531,Avian,H3N8,5,USA,,,
                          >5.17g_06   ,>5.17g      ,>5es          ,  1097, 813, 254 ,     ,>CY097705,A/mallard/Mississippi/354/2010,2010/01/16,343978531,Avian,H3N8,5,USA,,,
                          >81.17g_06  ,>81.17g     ,>8.7bi        ,   750, 595, 272 ,     ,>CY097706,A/mallard/Mississippi/354/2010,2010/01/16,343978533,Avian,H3N8,8,USA,,,
                          >81.17g_06  ,>81.17g     ,>8.7bi        ,   750, 595, 272 ,     ,>CY097706,A/mallard/Mississippi/354/2010,2010/01/16,343978533,Avian,H3N8,8,USA,,,
                          >43.17g     ,>43C        ,>43B          ,   962, 208, 188 ,     ,>CY097710,A/mallard/Mississippi/360/2010,2010/01/16,343978543,Avian,H3N8,4,USA,,,
                          >68.17g     ,>68A        ,>68C          ,   811, 138, 103 ,     ,>CY097712,A/mallard/Mississippi/360/2010,2010/01/16,343978548,Avian,H3N8,6,USA,,,
                          >5.17g_06   ,>5.17g      ,>5es          ,  1127, 822, 248 ,     ,>CY097713,A/mallard/Mississippi/360/2010,2010/01/16,343978550,Avian,H3N8,5,USA,,,
                          >5.17g_06   ,>5.17g      ,>5es          ,  1127, 822, 248 ,     ,>CY097713,A/mallard/Mississippi/360/2010,2010/01/16,343978550,Avian,H3N8,5,USA,,,
                          >81.17g_06  ,>81.17g     ,>81E          ,   714, 588, 262 ,     ,>CY097714,A/mallard/Mississippi/360/2010,2010/01/16,343978552,Avian,H3N8,8,USA,,,
                          >81.17g_06  ,>81.17g     ,>81E          ,   714, 588, 262 ,     ,>CY097714,A/mallard/Mississippi/360/2010,2010/01/16,343978552,Avian,H3N8,8,USA,,,
                          >43.17g     ,>43C        ,>43B          ,   973, 208, 189 ,     ,>CY097718,A/mallard/Mississippi/386/2010,2010/01/17,343978562,Avian,H3N8,4,USA,,,
                          >68.17g     ,>68A        ,>68C          ,   811, 138, 103 ,     ,>CY097720,A/mallard/Mississippi/386/2010,2010/01/17,343978567,Avian,H3N8,6,USA,,,
                          >5.17g_06   ,>5.17g      ,>5es          ,  1127, 822, 248 ,     ,>CY097721,A/mallard/Mississippi/386/2010,2010/01/17,343978569,Avian,H3N8,5,USA,,,
                          >5.17g_06   ,>5.17g      ,>5es          ,  1127, 822, 248 ,     ,>CY097721,A/mallard/Mississippi/386/2010,2010/01/17,343978569,Avian,H3N8,5,USA,,,
                          >81.17g_06  ,>81.17g     ,>81bi51       ,   702, 576, 261 ,     ,>CY097722,A/mallard/Mississippi/386/2010,2010/01/17,343978571,Avian,H3N8,8,USA,,,
                          >81.17g_06  ,>81.17g     ,>81bi51       ,   702, 576, 261 ,     ,>CY097722,A/mallard/Mississippi/386/2010,2010/01/17,343978571,Avian,H3N8,8,USA,,,
                          >43.17g     ,>43C        ,>43B          ,   973, 208, 189 ,     ,>CY097726,A/mallard/Mississippi/390/2010,2010/01/17,343978581,Avian,H3N8,4,USA,,,
                          >68.17g     ,>68A        ,>68C          ,   805, 147,  97 ,     ,>CY097728,A/mallard/Mississippi/390/2010,2010/01/17,343978586,Avian,H3N8,6,USA,,,
                          >5.17g_06   ,>5.17g      ,>5es          ,  1100, 819, 254 ,     ,>CY097729,A/mallard/Mississippi/390/2010,2010/01/17,343978588,Avian,H3N8,5,USA,,,
                          >5.17g_06   ,>5.17g      ,>5es          ,  1100, 819, 254 ,     ,>CY097729,A/mallard/Mississippi/390/2010,2010/01/17,343978588,Avian,H3N8,5,USA,,,
                          >81.17g_06  ,>81.17g     ,>8.7bi        ,   750, 595, 272 ,     ,>CY097730,A/mallard/Mississippi/390/2010,2010/01/17,343978590,Avian,H3N8,8,USA,,,
                          >81.17g_06  ,>81.17g     ,>8.7bi        ,   750, 595, 272 ,     ,>CY097730,A/mallard/Mississippi/390/2010,2010/01/17,343978590,Avian,H3N8,8,USA,,,
                          >62.17g_06  ,>62G        ,>62D          ,  1130, 389, 353 ,     ,>CY097754,A/mallard/Mississippi/407/2010,2010/01/16,343978647,Avian,mixed̃N2,6,USA,,,
                          
                          >43.17g     ,>43C        ,>43D          ,  1692, 237, 229 ,     ,>EU871828,A/duck/LA/17G/1987,1987//,194156642,Avian,H3N8,4,USA,,,
                          >7.17g      ,>7.17g_06   ,>7.7bi        ,   971, 640, 373 ,     ,>EU871829,A/duck/LA/17G/1987,1987//,194156644,Avian,H3N8,7,USA,,,
                          >7.17g      ,>7.17g_06   ,>7.7bi        ,   971, 640, 373 ,     ,>EU871829,A/duck/LA/17G/1987,1987//,194156644,Avian,H3N8,7,USA,,,
                          >68.17g     ,>68A        ,>68C          ,  1405, 132, 113 ,     ,>EU871830,A/duck/LA/17G/1987,1987//,194156647,Avian,H3N8,6,USA,,,
                          >5.17g      ,>5.17g_06   ,>53*          ,  1486, 862, 319 ,     ,>EU871831,A/duck/LA/17G/1987,1987//,194156649,Avian,H3N8,5,USA,,,
                          >5.17g      ,>5.17g_06   ,>53*          ,  1486, 862, 319 ,     ,>EU871831,A/duck/LA/17G/1987,1987//,194156649,Avian,H3N8,5,USA,,,
                          >81.17g     ,>81.17g_06  ,>8.7bi        ,   828, 585, 281 ,     ,>EU871832,A/duck/LA/17G/1987,1987//,194156651,Avian,H3N8,8,USA,,,
                          >81.17g     ,>81.17g_06  ,>8.7bi        ,   828, 585, 281 ,     ,>EU871832,A/duck/LA/17G/1987,1987//,194156651,Avian,H3N8,8,USA,,,
                          >3.17g      ,>3.17g_06   ,>3.7bi        ,  2151,1145, 760 ,     ,>EU871833,A/duck/LA/17G/1987,1987//,194156654,Avian,H3N8,3,USA,,,
                          >3.17g      ,>3.17g_06   ,>3.7bi        ,  2151,1145, 760 ,     ,>EU871833,A/duck/LA/17G/1987,1987//,194156654,Avian,H3N8,3,USA,,,
                          >2.17g      ,>2.17g_06   ,>2B           ,  2264,1232, 662 ,     ,>EU871834,A/duck/LA/17G/1987,1987//,374713112,Avian,H3N8,2,USA,,,
                          >2.17g      ,>2.17g_06   ,>2B           ,  2264,1232, 662 ,     ,>EU871834,A/duck/LA/17G/1987,1987//,374713112,Avian,H3N8,2,USA,,,
                          >1.17g      ,>1.17g_06   ,>1C           ,  2269,1394, 548 ,     ,>EU871835,A/duck/LA/17G/1987,1987//,194156659,Avian,H3N8,1,USA,,,
                          >1.17g      ,>1.17g_06   ,>1C           ,  2269,1394, 548 ,     ,>EU871835,A/duck/LA/17G/1987,1987//,194156659,Avian,H3N8,1,USA,,,
                          
                          >5.17g_06   ,>5.17g      ,>5.I92_03     ,  1162, 764, 212 ,     ,>FJ520131,A/northern pintail/California/44291-259/2007,2007/03/18,217385637,Avian,H10N3,5,USA,,,
                          >5.17g_06   ,>5.17g      ,>5.I92_03     ,  1162, 764, 212 ,     ,>FJ520131,A/northern pintail/California/44291-259/2007,2007/03/18,217385637,Avian,H10N3,5,USA,,,
                          
                          >81.17g_06  ,>81.17g     ,>8.7bi        ,   587, 473, 196 ,     ,>FJ520218,A/northern pintail/California/44291-259/2007,2007/03/18,217385378,Avian,H10N3,8,USA,,,
                          >81.17g_06  ,>81.17g     ,>8.7bi        ,   587, 473, 196 ,     ,>FJ520218,A/northern pintail/California/44291-259/2007,2007/03/18,217385378,Avian,H10N3,8,USA,,,
                          
                          >62.17g_06  ,>62I        ,>62.92_09     ,    20,  15,  15 ,     ,>GU247937,A/chicken/Korea/580/2006,2006/04/27,339717791,Avian,H9N2,6,South Korea,,,
                          
                          >43.17g     ,>43C        ,>43B          ,   891, 174, 163 ,     ,>JN864063,A/Anas strepera/Arizona/A00271503/2009,2009/01/18,354683492,Avian,H3N8,4,USA,,,
                          I'm interested in expert panflu damage estimates
                          my current links: http://bit.ly/hFI7H ILI-charts: http://bit.ly/CcRgT

                          Comment


                          • #14
                            Re: PNAS: A distinct lineage of influenza A virus from bats

                            JAMA: Influenza A in Bats

                            JAMA. 2012;307(13):1357. doi: 10.1001/jama.2012.371

                            A variant form of influenza A virus has been identified in 3 little yellow-shouldered bats (Sturnira lilium) in Guatemala, a finding that expands the list of mammalian hosts for the virus (Tong S et al. Proc Natl Acad Sci U S A. doi:10.1073/pnas.1116200109 [published online February 27, 2012]).

                            A group led by researchers at the Centers for Disease Control and Prevention, in Atlanta, found that each of the genomic segments of the bat viruses could be aligned to known influenza A virus genomic segments with few or no gaps, except for the neuraminidase gene.

                            Also, the internal genes from the virus diverged before the split of the known influenza A internal gene lineages. Despite this ancient divergence, the bat virus was compatible for genetic exchange with human influenza …


                            http://jama.ama-assn.org/content/307....2.short?rss=1

                            Comment


                            • #15
                              Re: PNAS: A distinct lineage of influenza A virus from bats

                              that "great split" happened ~1850 , depending on the segment, AFAIR.

                              The South American bird-lineage probably earlier, I don#t know ATM.

                              And the 1956 equine H7N7 even earlier


                              someone should maintain a time-line of TMRCAs,
                              a table, where is it ...
                              I'm interested in expert panflu damage estimates
                              my current links: http://bit.ly/hFI7H ILI-charts: http://bit.ly/CcRgT

                              Comment

                              Working...
                              X