Announcement

Collapse
No announcement yet.

PLoS ONE. Phenotypic Differences in Virulence and Immune Response in Closely Related Clinical Isolates of Influenza A 2009 H1N1 Pandemic Viruses in Mice

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • gsgs
    replied
    Re: PLoS ONE. Phenotypic Differences in Virulence and Immune Response in Closely Related Clinical Isolates of Influenza A 2009 H1N1 Pandemic Viruses in Mice

    A/KY/136/09, which showed low virulence in mice.
    high (KY/180) virulent
    A/Kentucky/180/2010 egg-passaged isolate will be referred to as “KY/180E”).
    For example, in the HA1/HA2 of KY/180E we noted changes in
    D222G, S83P, S183P, and E374K. E374K was identified as a vaccine
    escape mutation [19]. The S183P and the Q293H mutations in HA1
    (found in KY/180E and KY/96E, respectively)

    Mice infected with KY/96M, KY/80M, KY/180E, KY/80E, and NY/18E showed
    the greatest weight loss in this short study (Table 2).

    were submitted through the Influenza Research Database and uploaded into
    the GenBank (accession numbers provided in Table S4

    DOCX - encoded
    this could be (microsoft ?) "word" , the string "word" appears several
    times in the document

    -------------------------------------------

    HA of A/Kentucky/180/2010 :

    >A/Kentucky/180/2010,2010/04/01,H1N1,9,1-1701,9,
    T298C,G302A,A495G,T598C,G607A,T658A,A716G,G1171A,C 1408T

    --------------------------------------------------











    ----------------------------------------------------------

    74 ****** sequences from kentucky at genbank,
    from 14 genomes

    Code:
                                                            0000000000011111111122 00000011111111122222 00000000011111111111111122 00000000000000000000000000000000001111111111111111111 00000000000000001111111111 00000000000000000000111111111111 00000000 000000000 
                                                            0135555668800111347701 02467722356669901222 00167888911133344556689911 00012223333444455556666667778889990000112333444555555 22233345577889991111122234 22222344666677778899111111112223 00234668 133444477 
                                                            9272478335823235395886 94800201004894878001 49740449915958912390133634 03467990049169903890044551551590371157471237004034469 55900702438290171457744576 03468146335622451958002347890242 88349099 536015603 
                                                            8327798392808242210223 08338072808821564671 06158794639769428148209066 40775892809201556885779786190217082761612420383042609 12836224253826688326958744 75678698099001236444472140746186 48882062 367619099 
    -codon-position-----------------------------------------2  21             1     2    1   12  2  12  1    1    1   22 11 1 11 1 1 22212221 112 12 12121 121    1  1    1 1 221  1 1   2 1    22   1 1 2           1   12   2  11         1 2       11    1   11  111 
    ---Index------------------------------------------------AGGTCCTGTCCAGCCGGTGATG CCAGATCTCATGAACCCAAA GTGCCCGGCTGGCGTACTCAGAACAA ATAGCTCGAGAACAAGGTTGGTTGTAGGTTGAGCGGTGGGTCTCGCCTTAGAC GTGCACTGCTGGCCTTCGATAGGTCC CTCCAGAACAGATGACTCCTACTGGGTGTTTC GAGAGGCG CAAGCGGAG 
       1 >A/******/index/2009/02/01                         ...................... .................... .......................... ..................................................... .......................... ................................ ........ .........        0      0 ,      0      0       1:>A/******/index/2009/02/01                         
       2 >A/Kentucky/05/2009,2009/04/30,H1N1                ---------------------- -------------------- -------------------------- ........G............................................ .......A........T........T .........T...................... ........ ...A.....       74     74 ,      6      6       2:>A/Kentucky/05/2009,2009/04/30,H1N1                
       3 >A/Kentucky/06/2009,2009/05/04,H1N1                ---------------------- -------------------- -------------------------- .............................................TT...... -------------------------- .....A........G...T............. ......TA ---------      110    110 ,      7      7       3:>A/Kentucky/06/2009,2009/05/04,H1N1                
       4 >A/Kentucky/07/2009,2009/05/04,H1N1                ........C............A -------------------- .......................... ....T...................A....................T....... ..A..............A....A... .....A........G................. ....AA.. T.G......       34     34 ,     14     14       4:>A/Kentucky/07/2009,2009/05/04,H1N1                
       5 >A/swine/Kentucky/A01134742/2011,2011/02/27,H1N1   ---------------------- -------------------- -------------------------- ..G............AA..C....A..T...G...AC..AC...AT....... -------------------------- .....A.G....CAG....C.A.AAA...... A.A.AA.. ---------      130    130 ,     27     27       5:>A/swine/Kentucky/A01134742/2011,2011/02/27,H1N1   
       6 >A/Kentucky/110/2009,2009/11/04,H1N1               ...C...A.............A ....GCT.......A.A... -------------------------- ...A........A...........A....................T.C..... ..A.G.........C..A....AC.. .....A........G...............C. ....AA.- ..G...AGA       55     55 ,     28     28       6:>A/Kentucky/110/2009,2009/11/04,H1N1               
       7 >A/Kentucky/104/2009,2009/11/04,H1N1               ................A....A .........G.A........ ..A...............TGA..... .........A.......C......A....C.........A.....T....... ..A..............AG...A... ....GA........G................. ....AA.- ..G......       25     25 ,     24     24       7:>A/Kentucky/104/2009,2009/11/04,H1N1               
       8 >A/Kentucky/96/2009,2009/10/26,H1N1                G...A.....T......C.... T.GA...........T.... .C.A....T.A............... G......................A........TT....A......T....A.. ..A..............A.C...... .C...A.....G..GT.T........A.C..T .......- .........       32     32 ,     31     31       8:>A/Kentucky/96/2009,2009/10/26,H1N1                
       9 >A/Kentucky/180/2010,2010/04/01,H1N1               .A...T...T..ATTA..A..A ..........C......GGG A....TA....A....A....T...C .....C.A.....GG...C.A...AG.............A...T.T....... ..A..TC..C.......A....A.T. .....A....A...G.C..........A.... .G..AA.- ..G.T....       49     49 ,     48     48       9:>A/Kentucky/180/2010,2010/04/01,H1N1               
      10 >A/Kentucky/180_b/2010,2010/04/01,H1N1             ---------------------- -------------------- -------------------------- .....C.A......G...C.A...AG.............A.....T....... -------------------------- -------------------------------- -------- ---------      152    152 ,      9      9      10:>A/Kentucky/180_b/2010,2010/04/01,H1N1             
      11 >A/Kentucky/136/2009,2009/12/11,H1N1               ..A........T.........A .G...........G...... ............Y.C.........G. ......T.................A.A..............TG..T....... ..A.....A....T.Y.A....A... A....AG.T.....G.......C......C.. ....AA.- .GG..A...       33     33 ,     32     32      11:>A/Kentucky/136/2009,2009/12/11,H1N1               
      12 >A/Kentucky/99/2009,2009/10/29,H1N1                ---------------------- .......CT...G....... .........C...A.G......GS.. .C........G..........C..A....................T....... KYA.......AAT....A...AA... ..T..A........G.....G........... ...TAA.- ..G......       53     53 ,     30     30      12:>A/Kentucky/99/2009,2009/10/29,H1N1                
      13 >A/Kentucky/190/2010,2010/04/15,H1N1               ---------------------- -------------------- -------------------------- .....C.A.....GG.......C.A...C.A.....CA.A.....T..CG.CT -------------------------- -------------------------------- -------- ---------      159    159 ,     16     16      13:>A/Kentucky/190/2010,2010/04/15,H1N1               
      14 >A/Kentucky/80/2009,2009/09/30,H1N1                ......C............GCA .................... ....T..A.........C........ ...........G............A.........A.....C....T....... ..AT.............A..G.A... ...T.A........G................. ....AA.- ..G..A...       25     25 ,     24     24      14:>A/Kentucky/80/2009,2009/09/30,H1N1                
                                                                                                                                                                                                                                                                        
    ---Index------------------------------------------------AGGTCCTGTCCAGCCGGTGATG CCAGATCTCATGAACCCAAA GTGCCCGGCTGGCGTACTCAGAACAA ATAGCTCGAGAACAAGGTTGGTTGTAGGTTGAGCGGTGGGTCTCGCCTTAGAC GTGCACTGCTGGCCTTCGATAGGTCC CTCCAGAACAGATGACTCCTACTGGGTGTTTC GAGAGGCG CAAGCGGAG 
    -codon-position-----------------------------------------2  21             1     2    1   12  2  12  1    1    1   22 11 1 11 1 1 22212221 112 12 12121 121    1  1    1 1 221  1 1   2 1    22   1 1 2           1   12   2  11         1 2       11    1   11  111 
                                                            0000000000011111111122 00000011111111122222 00000000011111111111111122 00000000000000000000000000000000001111111111111111111 00000000000000001111111111 00000000000000000000111111111111 00000000 000000000 
                                                            0135555668800111347701 02467722356669901222 00167888911133344556689911 00012223333444455556666667778889990000112333444555555 22233345577889991111122234 22222344666677778899111111112223 00234668 133444477 
                                                            9272478335823235395886 94800201004894878001 49740449915958912390133634 03467990049169903890044551551590371157471237004034469 55900702438290171457744576 03468146335622451958002347890242 88349099 536015603 
                                                            8327798392808242210223 08338072808821564671 06158794639769428148209066 40775892809201556885779786190217082761612420383042609 12836224253826688326958744 75678698099001236444472140746186 48882062 367619099
    ------------------------------------------------------

    Code:
                                          00000 0000 00000000 00000000000000000000000000000 0000 000000000 00 0000 
                                          01135 0567 03445667 00001111111111222222223333445 1113 011222333 00 1111 
                                          37848 8663 18673141 01590001335667000112350139561 0787 705244689 38 1235 
                                          36304 3326 47518076 26620134384499023670913081786 0513 960018926 00 2364 
                                          ----- ---- -------- ----------------------------- ---- --------- -- ---- 
                                          KILKV ARTK VVINEENK KNGSSSDDISPNVSSSAVFSDVIQVESSE VRAT SVKRVNNGI SV IIVG 
    >A/******/index/2009/02/01            ..... .... ........ ............................. .... ......... .. .... 
    >A/Kentucky/05/2009,2009/04/30        ----- ---- -------- ......G...................... .K.I ......... .. ..I. 
    >A/Kentucky/06/2009,2009/05/04        ----- ---- -------- ............................. ---- .I...D... .. ---- 
    >A/Kentucky/07/2009,2009/05/04        ..... ---- ........ ...L...............T......... I... .I...D... .. .V.. 
    >A/swine/KY/A01134742/2011,2011/02/27 ----- ---- -------- .S..........IN.T...T..V..K.N. ---- .I..IDKR. .I ---- 
    >A/Kentucky/110/2009,2009/11/04       .T... ..N. -------- ..E.......T........T......... I... .I...D... .. .V.R 
    >A/Kentucky/104/2009,2009/11/04       ..... .K.. ....K... .......N...........T.....K... I... .I...D... .. .V.. 
    >A/Kentucky/96/2009,2009/10/26        R.M.. .... .I...... E......................H....K I... PI...D..K .. .... 
    >A/Kentucky/180/2010,2010/04/01       ....I ...G I....D.Q ....PN.....S..P.T..TG....KL.. I... .I.K.D... G. .V.. 
    >A/Kentucky/180_b/2010,2010/04/01     ----- ---- -------- ....PN........P.T..TG....K... ---- --------- -- ---- 
    >A/Kentucky/136/2009,2009/12/11       ...N. G... ..T..... ....F..............T.I....... I.D. .IR..D... .. MV.. 
    >A/Kentucky/99/2009,2009/10/29        ----- .... ...S..D. ........M........A.T......... I... .I...D... .. .V.. 
    >A/Kentucky/190/2010,2010/04/15       ----- ---- -------- ....PN.....S......LT.....K... ---- --------- -- ---- 
    >A/Kentucky/80/2009,2009/09/30        ..... .... ........ .........G.........T....I.... I... .I...D... .. .V..

    Leave a comment:


  • PLoS ONE. Phenotypic Differences in Virulence and Immune Response in Closely Related Clinical Isolates of Influenza A 2009 H1N1 Pandemic Viruses in Mice

    [Source: PLoS ONE, full text: (LINK). Abstract, edited.]
    Research Article

    Phenotypic Differences in Virulence and Immune Response in Closely Related Clinical Isolates of Influenza A 2009 H1N1 Pandemic Viruses in Mice


    Jeremy V. Camp, Yong-Kyu Chu, Dong-Hoon Chung, Ryan C. McAllister, Robert S. Adcock, Rachael L. Gerlach, Timothy L. Wiemken, Paula Peyrani, Julio A. Ramirez, James T. Summersgill, Colleen B. Jonsson

    Affiliations: [Full list on source page.]



    Abstract

    To capture the possible genotypic and phenotypic differences of the 2009 influenza A virus H1N1 pandemic (H1N1pdm) strains circulating in adult hospitalized patients, we isolated and sequenced nine H1N1pdm viruses from patients hospitalized during 2009?2010 with severe influenza pneumonia in Kentucky. Each viral isolate was characterized in mice along with two additional H1N1 pandemic strains and one seasonal strain to assess replication and virulence. All isolates showed similar levels of replication in nasal turbinates and lung, but varied in their ability to cause morbidity. Further differences were identified in cytokine and chemokine responses. IL-6 and KC were expressed early in mice infected with strains associated with higher virulence. Strains that showed lower pathogenicity in mice had greater IFNγ, MIG, and IL-10 responses. A principal component analysis (PCA) of the cytokine and chemokine profiles revealed 4 immune response phenotypes that correlated with the severity of disease. A/KY/180/10, which showed the greatest virulence with a rapid onset of disease progression, was compared in additional studies with A/KY/136/09, which showed low virulence in mice. Analyses comparing a low (KY/136) versus a high (KY/180) virulent isolate showed a significant difference in the kinetics of infection within the lower respiratory tract and immune responses. Notably by 4 DPI, virus titers within the lung, bronchoalveolar lavage fluid (BALf), and cells within the BAL (BALc) revealed that the KY/136 replicated in BALc, while KY/180 replication persisted in lungs and BALc. In summary, our studies suggest four phenotypic groups based on immune responses that result in different virulence outcomes in H1N1pdm isolates with a high degree of genetic similarity. In vitro studies with two of these isolates suggested that the more virulent isolate, KY/180, replicates productively in macrophages and this may be a key determinant in tipping the response toward a more severe disease progression.



    Citation: Camp JV, Chu Y-K, Chung D-H, McAllister RC, Adcock RS, et al. (2013) Phenotypic Differences in Virulence and Immune Response in Closely Related Clinical Isolates of Influenza A 2009 H1N1 Pandemic Viruses in Mice. PLoS ONE 8(2): e56602. doi:10.1371/journal.pone.0056602

    Editor: Earl G. Brown, University of Ottawa, Canada

    Received: October 24, 2012; Accepted: January 14, 2013; Published: February 18, 2013

    Copyright: ? 2013 Camp et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

    Funding: Support was provided in part by the Commonwealth of Kentucky as a Clinical and Translational Science Pilot Project Program at the University of Louisville to CBJ. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

    Competing interests: The authors have declared that no competing interests exist.
    -
    -------
Working...
X