A/Shanghai/LWS1/2009/01/03(H1N1) (seasonal H1N1,Spainflu)
has been uploaded.
It is similar to A/Boston/52/2008/02/23(H1N1)
46 differences, most recent common ancestor in late 2007,early 2008
also related is A/England/26/2008/01/09(H1N1)


seasonal H1N1 (full) genomes since 2008:

Code:
                                              000000000000000000000000000000000000000000000000000000000000000000000000000001111111111111111111111111111111111111111111111111111111111111111111111111122222222222222222222 0000000000000000000000000000000000000000000000000000000000000000000001111111111111111111111111111111111111111111111111111111111111111111111111111112222222222222222222222222222 0000000000000000000000000000000000000000000000000000000000000000000000000000111111111111111111111111111111111111111111111111111111111111111111122222222222 000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000001111111111111111111111111111111111111111111111111111111111111111 0000000000000000000000000000000000000000000000000000000000000001111111111111111111111111111111111111 000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000111111111111111111111111111111111111111111111111111111 0000000000000000000000000000000000000000000000000000000001 00000000000000000000000000000000000000000000000000000000000000000 
                                              000011111111222222222222333333333444444445555555566666667777788889999999999990000000000111122222222333333333444455555555566666667777777788888888999999900000000111111112222 0011111122222222223333333344444455555555566666666677788888889999999990000001111111112222222223333333444445555566666667777777777777888888888899999990000000000111111111112222233 0000001111122222222223333344444444555555555556666677888888888888999999999999000000000000000111111222333333344455555556666667777888888999999999900000011112 000000001111111112222222222222333333333333333334444444444444455555555555556666666666666666666777777777777888888888999999999999990000000011111111122222223333333334444444455555555556666666667777 0011112222222223344444455555555666666666677777888889999999999990000000111111111112222222333333444445 000000011111111111112222222222222233333334444455555555556666666666677777777777777888888888999999999000000000000001111111111111122222222223333333333333344 0011111122233333344444455555556666677777888888888889999990 00000001111111222222222333333334444444455566666666677777777788888 
                                              567700036679011124556677023456679000135890145778901236890468807891233455677890013557899008811234466036778999233401123578900335772345678933356777123489902233589001224791122 4904677801234445571334678835679901566678901236667834612456790113445781236782455668881112347880137899567894688800456880124556788899011122456712356680345577788003345557894556800 4478880146900223457893456900356889003455578891578803000122344568011233468999000123345566779116679133023578833411347770578898899012357003344456712223566772 568888990236678890111222336677000111223444555892233456678889901122236677890112455666667778889122245677788001155578000112333468891122348802333477923445780023445571255667800133477890014457781335 4845690123679990601226701567789112236778933679225580234555668890013368001122777890234567244557046673 344678901122344667990123446667778801133593567812345567890223455688923347777777899013455688001255899112233445668881122223357788901133466880011122367789912 3723346800802234615567911244471234600134123456679990558880 11166890034788011236799234457893334445705933445577800334488912224 
                                              553606930683214784692678857032761034867702743149849044240801404020517025436573989472467123936270948999678459725770357968136064260840819214754036249540680368898146683415878 9792325754954783449179163561380924001229876241386205646162727037062051173213439280680468836250296767681986105839510475804068436959706958682351064615213914539014702685818128745 3495689280025265492087637739673149582101376953532546259136527887705517949047089644982606579175841015370721428449410366161766925402722033656810210190934392 991258792982513685069389021419589358243157457200925193574598916923890402290127919012890230139526870713736146926838029232019864531706010742157303113281842732480653248173806939225168912491719171 7354472876980394670251638735876143922170017031341712087346293651791542050247058465057026017020852752 436832791889324138032407470570153651601519795759260624097564358978380650234568939556916538173556814232434248393491467895801204170617924253757814032593943 7443923189372826485795607915779219469002551642793465124597 68939732550403439083327460585770271389358545095929607367878970697 
-codon-position-------------------------------1211111111111111 1111212211122111112111111111111111211111111121111111111111111111111112 111111111121112 22 1211111111211111111121111111111111111111111111121 11111211211112 111111111111112121111111211111111112 121111111 2111111111111111111111 1211111111111 12112111111121121111111211111111112111111111121111111121111 2111111111211 1111121 11112 1 1 1211211111111 11112111121111111111111112111111111121112111121 1211 111112 111 1212112 111 111111 11211111111112112111112111111111111 1111121111112121 1112 2  1111          1   1 121  1 22 1  1  2 2 1 1       1  12  1    1 22  2 2 2  1 2 122 1 12 2 12 2  2 2        1    2  11 1    1     1  1   1             2   1  1  2       1        1 1    1   2 2211221222222221 22222222222222222222222 221221222222222 22 2222222 2221 222 22222222221    22121 22 11121111 12 11 21111111 1121  1211221 11111111211 1111121121111  1 2111212 121 11122 2111 1111121111221121 211 1 1112 11111212 1111112111121 1111111 1111 12111111121111211121111 11121111111112112   21  2 22 1 122 1 1       2      112 1   1 1  11 2 21 21 1121112 121211 112111111 
---Index--------------------------------------GTAACTTGAAGACATTCATAGTGGGGCAGACACGTGAAATTCGTAAAGGAGACGAGAGGGGGTATATCATAACAAGTCTATAGCGACCCTAAACAACCGGAATTGCCTTTTTTTAATAGAAAGTATCAATGGTACCTACGTCATTCGAGTTCTCGCCTATGATAATATGTG ATTGCCGATTTATACGGCACCTAGAGGCAACAAGGGGCGAGAAACTAGACGCACGAAGAGCCGACTAACATATGAGGCATATTAATAATTGCCTGCTTCTTAGACCTGTATACCTTATCAGAGACCAAGTTTCCATTTTGAGCAAATCCATCGGAAGAGATCAGTTCAATGTCGA ACAAGACGCGCCACGTAGCTTAGCAAGTCATCCATTATATGATTCAGTCTATGTTGTAAAGTATGTATGAAAACTCGAGAATGATAGGGGAATGTTGCATTTGGTCCTCAAGCGCCTCCCGAACACCACTAAAAAAAACGGACGGTCAACAGGA TGCATATTATGTATACGATTACTCTTTTGGATAATCGGCTAATCTCTTTATGAACCGTCGTATTGGCGGGTTCCAAAACAGTGAAGGCCATCTCGAACAAAAACCGTTAGAAGACATACATGCTCCGATGTGGGCTCGAGATGAATCTATACGGGAGAATCCCGGATTTATGGAGCAAGAGGCGATTTCGTA CCGGGGAGGATAAGTGGGTCCTTGCAAAAACTGAAACCGTACAACGCTGAGATTGAGATCTGTTACCTAGAGCTGCGTGTGAAGAAGCGTAAACGTGAGA CAGAAAGAATGCTCAACCCACGCATTGCACTGGCTAACACCCAGATCGCACAACCTCCATACAGAAAAGGCATAAGGCATGAGATCTTTTAGCACTAGTCGGGCAGCAAAAAAGCACTTGGTAACGCTAAGCCTAAAGGGTGTATTCTCCTTG TAAATCGATTTTCTCGGATATTCACATTACCATTGTCACAAGTACCAATTAGGAGATA TCCCATCCCTAATTATAGCTGGACAGTGAGCTGAGCTCCTGGACGTACAGCTGGTCGATAGTGTG 
   1 >A/Solomon Islands/3/2006/08/21(H1N1)    --------------------------------------------------------------------------------------------------------------------------------------------------------------------------- ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- ---------------------------------------------------------------------------------------------------------------------------------------------------------- .........CA.G....G...T.......A.......A........C....A....AC.A.......A........G..T....G..T...AC............A.............G.....T.T......................T...A.....T...A..C......A................G ---------------------------------------------------------------------------------------------------- T.A...A........C........C.A.........G....T.......GT............A..G......GG..............C.A......C.A......G....G...................T......A...G.......-- C............G.......C..T.....T........G..C.G..........G.. -----------------------------------------------------------------     1264    729 ,     76     62       1:>A/Solomon Islands/3/2006/08/21(H1N1)    
   2 >A/Brisbane/59/2007/07/01(H1N1)          --------------------------------------------------------------------------------------------------------------------------------------------------------------------------- ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- ---------------------------------------------------------------------------------------------------------------------------------------------------------- ..................................................................................AT........C...........T.............................................T......................................A.. ---------------------------------------------------------------------------------------------------- T................................T................................................................C.....................................................A CG........................................................ -----------------------------------------------------------------     1200    677 ,     15     12       2:>A/Brisbane/59/2007/07/01(H1N1)          
   3 >A/Boston/26/2008(H1N1/02/03/            ............................................................................C..............................................C............................................... ...A...................................................................G.....T.............................A.........................................................C......... .........................G........C......................C..C...................G......A..................T..............................................- .....G..........................G...........................................................C...........T....................................................................................... ...............................C..G..............................T.............C.................... .................................T................................................................C...................................................... ...........................C.....C...................T.... ........T...........................C............................       36     30 ,     32     29       3:>A/Boston/26/2008(H1N1/02/03/            
   4 >A/Boston/27/2008(H1N1/02/04/            ............................................................................C..............................................C............................................... ...A..........................................................T........G.....T.............................A.........................................................C......... .........................G........C......................C..C...................G.....AA..................T..............................................- .....G..........................G..................................A........................C...........T....................................................................................... ...............................C..G..............................T.............C.................... .................................T................................................................C...................................................... ...........................C.....C...................T.... ........T...........................C............................       40     33 ,     36     32       4:>A/Boston/27/2008(H1N1/02/04/            
   5 >A/Boston/35/2008(H1N1/02/12/            ............................................................................C..............................................Y............................................... ...A..........................................................T........G.....T.............................A.........................................................C......... .........................G........C......................C..C...................G......A..................T..............................................- .....G..........................G...........................................................C...........T....................................................................................... -..............................C..G..............................T.............C.................... .................................T................................................................C...................................................... ...........................C.....C...................T.... ........T...........................C............................       43     32 ,     33     30       5:>A/Boston/35/2008(H1N1/02/12/            
   6 >A/DoC/WRAMC-1154047/2008(H1N1/02/01/    ............................................................................C..............................................C............................................... ...A...................................................................G.....T..............................................................................A.................. .........................G........C.........................C...................G......A..................T..............................................G .....G..........................G...........................................................C...........T...............................................................C....................... ...............................C..G..............................T...A.........C.................... ...........................T.....T................................................................C...................................................... .................................C........................ ........T...........................C............................       38     29 ,     37     29       6:>A/DoC/WRAMC-1154047/2008(H1N1/02/01/    
   7 >A/Boston/49/2008(H1N1/02/20/            ...............C.............................................................................A...............A............AC................C.............................. .........................................................A....................................................C................................................................ .......A...T......................C...G.........................................G.........................T..............................................- ................................................................A............G..............C...........T..........................................................A............................ -...................T.............G.............................................................A.A. ........................................T..........G..............................................C......................................A............... .......................................................... .............................A....A.C............................       58     32 ,     49     30       7:>A/Boston/49/2008(H1N1/02/20/            
   8 >A/Washington/AF06/2007(H1N1/01/10/      ..........................................A.............................................T..................................C............................C.................. .........A...C............................................................G.................................................................................................... .A..AG............................C.............................................G.....A...................T..............................................- .................................................G..........................................C...............T........T.................................................................A........ ....................T.............G................................................................. -.............................................T...................................................C......................C........A........A............. .......................................................... ....................................C.....G......................       51     30 ,     44     28       8:>A/Washington/AF06/2007(H1N1/01/10/      
   9 >A/Managua/5214.01/2008(H1N1/07/25/      ..G.............T.........................A.............................................T..................................C..........................C......C............. ......T..A...C.....T......................................................G....................................G..........................................G.................... .A...G............A..........G....C.............................................G.....A...................T.............................................A- .................................................G...G......................................C.....G.........T........T....................G.........T......G...........................A........ ..................................G...........T..........G........T................................T .......................................................................G..........................C......................C........A...................... .......................................................... ..................T.................C.....G......................       56     46 ,     49     45       9:>A/Managua/5214.01/2008(H1N1/07/25/      
  10 >A/Managua/1225.02/2008(H1N1/06/08/      ..G.............T.........................A.............................................T..................................C..........................C......C............. ......T..A...C.....T......................................................G....................................G............................................................... .A...G............A..........G....C.............................................G.....A...................T.............................................A- .................................................G...G............................R.........C.....G.........T........T....................G............................................A........ -.................................G......................G........T................................T .......................................................................G..........................C......................C........A...................... .........................R................................ ..................T.................C.....G......................       52     45 ,     43     43      10:>A/Managua/1225.02/2008(H1N1/06/08/      
  11 >A/Managua/156.01/2008(H1N1/06/11/       ..G.............T.........................A.............................................T..................................C..........................C......C............. ......T..A...C.....T......................................................G....................................G............................................................... .A...G............A..........G....C.............................................G.....A.........A.........T.............................................A- .................................................G...G......................................C.....G.........T........T....................G............................................A........ ..................................G......................G........T.........T......................T -......................................................................G..........................C......................C........A...................... .......................................................... ..................T.................C.....G......................       51     45 ,     44     43      11:>A/Managua/156.01/2008(H1N1/06/11/       
  12 >A/Managua/3570.01/2008(H1N1/06/27/      ..G.............T.........................A.............................................T..................................C..........................C......C............. ......T..A...C.....T......................................................G....................................G............................................................... .A...G............A..........G....C.............................................G.....A...................T.............................................A- .................................................G...G......................................C.....G.........T........T....................G............................................A........ ..................................G......................G........T................................T .......................................................................G..........................C......................C........A...................... .......................................................... ..................T.................C.....G......................       51     42 ,     45     41      12:>A/Managua/3570.01/2008(H1N1/06/27/      
  13 >A/Japan/AF07/2008(H1N1/01/25/           ..........................................A..................................T..........T..................................C............................................... .........G...CT...............T..........................................................................................................................A..................... .....G............................C.............................................G.....................A...T..............................................- C.............G..............T..............................................................C................................................................................................... ..................................G................................................................. ................T.......................................T.............T...........................C......................C............................... .......................................................... ....................................C............................       44     26 ,     39     25      13:>A/Japan/AF07/2008(H1N1/01/25/           
  14 >A/Managua/5007.01/2008(H1N1/08/07/      ...........................G..................................C........G....C..G.........................T.................C................................T........C..... ....T....G...CT........A.........A...............................C.............C...............T.C......................A.......A.....GC.......G...................A........... ..........A..........................................C.................G..................................T......A..................................G....- ...........................C....................................................T.....A..G..........................................................................................AA.......... T.........................G..............A.........................................A..............A. ........G.....G..............AG............................................A.........T.C......T....T............G.....................G.................. ................A........................................G .........................AC..........T...........................       67     59 ,     60     58      14:>A/Managua/5007.01/2008(H1N1/08/07/      
  15 >A/Managua/4924.01/2008(H1N1/10/06/      ...........................G..................................C........G....C..G.........................T.................C................................T.............. ....T....G...CT........A.........A...............................C.............C...............T.C......................A.......A.....G........G...................A........... ..........A..........................................C.................G..................................T......A..................................G....- ...........................C....................................................T.....A..G..........................................................................................AA.......... T.........................G..............A.........................................A..............A. ........G.....G..............AG............................................A.........T.C......T....T............G.....................G.................. ................A........................................G .........................AC..........T...........................       63     57 ,     57     56      15:>A/Managua/4924.01/2008(H1N1/10/06/      
  16 >A/Managua/496.01/2008(H1N1/08/28/       ...........................G..................................C........G....C..G.........................T.................C................................T.............. ....T....G...CT........A.........A...............................C.............C...............T.C......................A.......A.....G........G............................... ..........A..........................................C.................G..................................T......A..................................G....- ...........................C....................................................T.....A..G..........................................................................................AA.......... T.........................G..............A.........................................A..............A. ........G.....G...............G............................................A.........T.C......T....T............G.....................G.................. ................A........................................G .........................AC..........T...........................       67     55 ,     60     54      16:>A/Managua/496.01/2008(H1N1/08/28/       
  17 >A/Managua/1985.01/2008(H1N1/10/20/      ..................................................A...........C........G....C..G.........................T.................C................................T.............. ....T..G.G...CT........A.........A...............................C.............C...............T.C......................A.......A.....G........G............................... ..........A..........................................C.................G..................................T......A..................................G....- ...........................C....................................................T.....A..G..........................................................................................AA.......... -.........................G..............A.........................................A..............A. ........G.....G...A...........G............................................A.........T.C......T.................G.....................G.................. ................A........................................G .........................AC..........T...........................       65     56 ,     55     54      17:>A/Managua/1985.01/2008(H1N1/10/20/      
  18 >A/Boston/52/2008(H1N1/02/23/            .............T..........................................................................TC........A......T.......................................................G......... .........G...CT........A.......................................................C.................C................C.............A.....G........G............................... .......................................................................G.................................................................................- ...........................C..........................................................A........................................................................................................G T........................................A.......................................................... -.............................G......................................................T.C........................G........................................ .......................................................... .......................A.........................................       43     29 ,     35     27      18:>A/Boston/52/2008(H1N1/02/23/            
  19 >A/Shanghai/LWS1/2009(H1N1/01/03/        .............T....................................A.....................................TC........A......T.......................................................G......... .........G...CT........A.......................................................C.................C..............................A.....G........G............................... .......................................................................G......................C..........................................................- ...........................C....................................................C.....A.................T....................................................................................... -...............A........................A...A...................................................... ........................C.....A......................................................T.C........................G........................................ .......................................................... .....................A...........................................       69     33 ,     57     31      19:>A/Shanghai/LWS1/2009(H1N1/01/03/        
  20 >A/England/26/2008(H1N1/01/09/           .............T..........................................................................TC........A......T.......................................................G......... .........G...CT........A..................................G....................C.................C....................................G...........C............................ .......................................................................G.................................................................................- ...................C.......C.................................................................................................................................................................... -........................................A.......................................................... .....................................................................................T.C........................G........................................ .......................................................... .................................................................       40     24 ,     28     22      20:>A/England/26/2008(H1N1/01/09/           
  21 >A/Managua/4032.01/2008(H1N1/06/09/      .......A..A....................G...A.........................................................T....A..............................................................G....G.... ...............................................................................................................................G............................................... .........................................................................T..............A.........................T......................................- ...........................C......................................T...................................................................T..A............C........C.................T....T......... -........................................A..........................................G............... ............................................................G..........................C.........................A..........T....................C....... ........CC................................................ ...........G...C..............................................A..       42     34 ,     32     32      21:>A/Managua/4032.01/2008(H1N1/06/09/      
  22 >A/Managua/4070.01/2008(H1N1/06/11/      .......A..A....................G...A.........................................................T....A..............................................................G....G.... ...............................................................................................................................G............................................... .........................................................................T..............A.........................T......................................- ...........................C......................................T...................................................................T..A............C........C.................T....T......... .........................................A..........................................G............... ............................................................G..........................C.........................A..........T....................C....... ........CC................................................ ...........G...C..............................................A..       37     33 ,     32     32      22:>A/Managua/4070.01/2008(H1N1/06/11/      
  23 >A/Kentucky/UR07-0061/2008(H1N1/02/20/   ...............................G..................................................................A............................................................A........... ..............................................................................................................C................................................................ .........................................................................T.A............A.........................T......................................- ..............G............C......................................T...................................................................................C........C................................ -........................................A.......................................................... ............................................................G..........................C.........A....................................................... ........CC................................................ .........C....................................................A..       36     23 ,     28     21      23:>A/Kentucky/UR07-0061/2008(H1N1/02/20/   
  24 >A/DoC/WRAMC-1154048/2008(H1N1/02/01/    ........................A.........................................................................A.........................G.............................................. .............................G............................................................................................A.................................................... .........................................................................T..............A.........................T......................................G ...........................C..........................................................................................................................C......................................... .........................................A.......................................................... ............................................................G..........................C............A.................................................... ........CC................................................ ..............................................................A..       29     18 ,     28     18      24:>A/DoC/WRAMC-1154048/2008(H1N1/02/01/    
  25 >A/Taiwan/70167/2008(H1N1/01/21/         ........................................................................................................................................................................... ...................................A.......................A.....................G............................................................................................. ...G......................A......G.......................................................................................................................- ....................G...............A..................A..........................R.....................................................T....................................................... -................................................................................................... ...........................................A............................................................................................................. ..........C............................................... ..............................T..................................       32     16 ,     22     14      25:>A/Taiwan/70167/2008(H1N1/01/21/         
  26 >A/Taiwan/70132/2008(H1N1/01/16/         ........................................................................................................................................................................... ...................................A.......................A.....................G............................................................................................. ..........................A......G.......................................................................................................................- ....................G..............................................................T....................................................T....................................................... -................................................................................................... ...........................................A............................................................................................................. ..........C...............C............................... .T............................T..................................       30     15 ,     20     13      26:>A/Taiwan/70132/2008(H1N1/01/16/         
  27 >A/Managua/3307.01/2008(H1N1/01/07/      ...............................................A...................................A..............................................T........................................ ............................................................................................................................................................................... ..........................................................................C............A.................................................................- .................................................................R........................C......................................A.A..................................C........A................ -...............................................................................A.........C..T...... -........................................T.A................................................................G............................................ ..........C............................................... ....G............................................................       40     22 ,     27     19      27:>A/Managua/3307.01/2008(H1N1/01/07/      
  28 >A/Managua/954.02/2008(H1N1/07/01/       .................................A.............A.................................................T................................T........................................ .........................................................................A...........C....................................................................G.................... ...........T........C.....................................................C............A.................................................................- ..................C................................................................................................................A..................................C......................... .............................................A..................................A.........C..T...... ........................................TT...........................................T......................G..................................G.C....... ..........C............................................... ....G.............T..............................................       56     28 ,     50     27      28:>A/Managua/954.02/2008(H1N1/07/01/       
  29 >A/Florida/UR07-0022/2008(H1N1/02/14/    ...............................................A..A........................................................................................................................ ............................................................................................................................................................................... .......................................................................................A.................................................................- ...................................................................................................................................A..................................C......................... ..............................................................................A.A............T.C.... .........................................T..................................................................G............................................ ..........C............................................... ....G............................................................       29     14 ,     23     13      29:>A/Florida/UR07-0022/2008(H1N1/02/14/    
  30 >A/New Jersey/AF09/2008(H1N1/02/14/      ......................................G.................................................................................................................................... .................................A.....................................................................................................C....................................... .........................................................................................................................................................- .................................................................................................................................A.............................................................. -..................................................................................A................ ......................................................................................................................................................... ..........C............................................... .................................................................       24      8 ,     14      6      30:>A/New Jersey/AF09/2008(H1N1/02/14/      
  31 >A/Managua/1038.01/2008(H1N1/06/08/      A.....................................G............................................................................................T....................................... ...A........C....................A................A............................................................................................................................ .............................................................................................................................................G...........- ....C............................................................................................................................A.............................................................. -T.................................................................................................. ......................................................................................................................................................... ..........C............................................... ...............................................................C.       41     15 ,     34     13      31:>A/Managua/1038.01/2008(H1N1/06/08/      
  32 >A/Managua/2055.01/2008(H1N1/06/10/      .........................A...................................A................C.......................................T................................................C..A ......................................A................................................................G.T...............T.........C...............T........................... .........A......................................................A....G........T.................A............................................G........G..- ..........A....T.............AG...........C..............................................................A.........................................................................G............ -.......A..................................................T........C............................... ..........................................................................................................................G.............................. .....T.........A................................C......... ................................................C.........C.A....       51     38 ,     43     36      32:>A/Managua/2055.01/2008(H1N1/06/10/      
  33 >A/Managua/4017.02/2008(H1N1/06/20/      .........................A...................................A................C.......................................T................................................C..A ......................................A................................................................G.T...............T.........C............G..T........................... ......T..A......................................................A....G........T.................A............................................G.......TG... ..........A....T.............AG...........C.....................A........................................A.........................................................................G............ -.......A..................................................T........C............................... ..........................................................................................................................G.............................. .....T.........A.............A..................C......... ................................................C.........C.A....       49     42 ,     43     41      33:>A/Managua/4017.02/2008(H1N1/06/20/      
  34 >A/Managua/3027.01/2008(H1N1/06/24/      .........................A...................................A................C.......................................T..............................C.................C..A ......................................A................................................................G.T...............T.........C............G..T........................... .........A......................................................A....G........T.................A............................................G.......TG... ..........A....T.............AG......A....C.....................A........................................A.........................................................................G............ ........A..................................................T........C............................... ..........................................................................................................................G.............................. .....T.........A.............A..................C......... ................................................C.........C.A....       53     42 ,     47     42      34:>A/Managua/3027.01/2008(H1N1/06/24/      
  35 >A/Managua/4086.02/2008(H1N1/06/25/      .........................A...................................A................C.......................................T................................................C..A ......................................A................................................................G.T...............T.........C...............T........................... .........A......................................................A....G........T.................A............................................G........G... ..........A....T.............AG.G.........C..............................................................A.........................................................................G............ ........A..................................................T........C............................... ..........................................................................................................................G.............................. .....T.........A..........C.....................C......... ................................................C.........C.A....       51     38 ,     45     38      35:>A/Managua/4086.02/2008(H1N1/06/25/      
  36 >A/Managua/3180.01/2008(H1N1/06/09/      ........G................A...................................A................C.......................................T................................................C..A ......................................A................................................................G.T...............T.........C...............T......G.................... .........A............T.........................................A....G........T.................A............................................G........G..- ..........A....T.............AG...........C........................................W.....................A........T................................................................G............ ........A..................................................T........C............................... .............................................................T..........C.................................................G.............................. .....T.........A............G...................C......... ......................................T.........C.........C.A....       50     46 ,     45     45      36:>A/Managua/3180.01/2008(H1N1/06/09/      
  37 >A/Managua/4341.01/2008(H1N1/06/09/      ........G................A...................................A................C.......................................T................................................C..A ......................................A................................................................G.T...............T.........C...............T......G.................... .........A............T.........................................A....G........T.................A............................................G........G..- ..........A....T.............AG...........C..............................................................A........T................................................................G............ ........A..................................................T........C............................... .............................................................T..........C.................................................G.............................. .....T.........A............G...................C......... ......................................T.........C.........C.A....       51     45 ,     45     44      37:>A/Managua/4341.01/2008(H1N1/06/09/      
  38 >A/Managua/3418.01/2008(H1N1/10/11/      ........................................C..C....................................................T............................C..G.......C.................................. ................................CA......................G..............................................................G.G................C..................T................. ...........................C..........G................A..G.......C............G.............................T.A...T...T.................................- ........G....................A........T.......................C............G.........TA......................A.......................................................G.......................... ...............A.......A.............T....................C......................................... .................T......C................T.....T...................................................................................T..........C.......C.. .....T..................................................G. ...T.............................................................       54     47 ,     46     46      38:>A/Managua/3418.01/2008(H1N1/10/11/      
  39 >A/Managua/2860.01/2008(H1N1/10/11/      ........................................C..C....................................................T............................C..G.......C.................................. ................................CA......................G..............................................................G.G................C..................T................. ...........................C..........G................A..G.......C............G.............................T.A...T...T.................................- ........G....................A........T.......................C............G.........TA......................A.......................................................G.......................... ...............A.......A.............T....................C......................................... -................T......C................T.....T...................................................................................T..........C.......C.. .....T..................................................G. ...T.............................................................       54     48 ,     47     46      39:>A/Managua/2860.01/2008(H1N1/10/11/      
  40 >A/Managua/5751.01/2008(H1N1/11/11/      ........................................C.......................................................T...........C................C..G.......C.................................. ................................CA......................G..............................................................G.G................C.................................... ...........................C..........G................A..G.......C............G.............................T.A...T...T.................................- ........G....................A........T.......................C............G.........TA......................A.......................................................G.......................... ...............A.......A.............T.C............................................................ -................T......C......................T...................................................................................T..........C...T...C.. .....T..................................................G. ...T.............................................................       60     47 ,     51     45      40:>A/Managua/5751.01/2008(H1N1/11/11/      
  41 >A/Managua/4444.01/2008(H1N1/11/18/      ........................................C.......................................................T...........C................C..G.......C.................................. ................................CA......................G..............................................................G.G................C.................................... ...........................C..........G..............C.A..G.......C............G........A....................T.A...T...T.................................- ........G....................A........T.......................C............G.........TA......................A.............................................G.........G.......................... ...............A.......A.............T.C..............................................T............. .................T......C......................T...................................................................................T..........C...T...C.. .....T..................................................G. ...T.............................................................       55     50 ,     50     49      41:>A/Managua/4444.01/2008(H1N1/11/18/      
  42 >A/Managua/4412.01/2008(H1N1/11/06/      ........................................C.......................................................T............................C..G.......C.................................. ................................CA......................G..............................................................G.G................C.................................... ...........................C..........G..............C.A..G.......C............G.............................T.A...T...T.................................- ........G....................A........T.......................C............G.........TA......................A.......................................................G.......................... ...............A.......A.............T.............................................................. .................T......C......................T...................................................................................T..........C.......C.. .....T..................................................G. ...T.............................................................       58     44 ,     52     43      42:>A/Managua/4412.01/2008(H1N1/11/06/      
  43 >A/Managua/4315.04/2008(H1N1/10/25/      ........................................C.......................................................T............................C..G.......C.................................. ................................CA.........G............G..............................................................G.G................C.................................... ...........................C..........G................A..G.......C............G.............................T.A...T...T.................................- .......CG....................A........T.......................C............G.........TA......................A..T....................................................G.......................... ...............A.......A.............T.............................................................. .................T......C......................T...................................................................................T..........C.......C.. .....T..................................................G. ...T.............................................................       54     46 ,     48     45      43:>A/Managua/4315.04/2008(H1N1/10/25/      
  44 >A/Managua/309.01/2008(H1N1/10/30/       ........................................C....................................T..................T............................C..G.......C.................................. ................................CA.........G............G..............................................................G.G................C.................................... ...........................C..........G................A..G.......C............G.............................T.A...T...T.................................- .......CG....................A........T...................A...C............G.........TA......................A..T....................................................G.......................... ...............A.......A.............T.............................................................. .................T......C......................T...................................................................................T..........C.......C.. .....T..................................................G. ...T.............................................................       53     48 ,     47     47      44:>A/Managua/309.01/2008(H1N1/10/30/       
  45 >A/Managua/3759.02/2008(H1N1/08/16/      ........................A.......................................................................T...............................G.......................................... ......T.........................C......................................................................................G.G......A.........C.................................... .......A........................................T......................................................................T.................................- ........G........G............................................C......................TA......................A.................................................................................. -....................................TA...........................................................T. ...................................................................................................................................T..................... ..........C........................................A....G. ...T.............................................................       60     28 ,     48     26      45:>A/Managua/3759.02/2008(H1N1/08/16/      
  46 >A/Managua/2512.01/2008(H1N1/02/15/      ................................................................................................T...............................G.......................................... .........................................................................................................................G..................................................... .......................................................................................................................T.................................- ..................................C...........................C........................A.....................A.................................................................................. ..............C......................T........................................................A..... ............................................................................A......................................................T..................... ...................................................A....G. ...T.........................A...................................       37     18 ,     33     17      46:>A/Managua/2512.01/2008(H1N1/02/15/      
  47 >A/Boston/34/2008(H1N1/02/09/            ................................................................................................T...............................G.......................................... .........................................................................................................................G.....G............................................... .......................................................................................................................T.................................- ..............................................................C..............................................A...........................................................G...................... -....................................T.............................................................. ...................................................................................................................................T..................... ...................................................A....G. ...T.............A...............................................       40     16 ,     30     14      47:>A/Boston/34/2008(H1N1/02/09/            
  48 >A/Managua/3153.01/2008(H1N1/08/07/      ...........................................................A....................................T...............................G.......................................... .............................G...A................................................................T..................................A......................................... .................................................................................................................A.....T.................................- ..............................................................C............................................................................................................................C.... ........................T.....T......T.............................................................. ...........................T.........................................................T.............................................T..................... ...................................................A....G. ...T.............A...............................................       53     22 ,     47     21      48:>A/Managua/3153.01/2008(H1N1/08/07/      
  49 >A/Kansas/UR06-0068/2007(H1N1)           .C................A.ACAAA...........T.......G......G........A........................G..T..G......AAT...A.A........G....C.AC.CT..C.A......T.CT..AT.....TCTA.....T.C........ ..........C.G..A...T.......A.....A..A.......T..................CT.....................................................A.......C...................C...................T......AG G.GG.....A...........G....A....T..A.G..CA..........C...............GA...........TCAG........A....TG.CC.A..T.T....A....T...........G.G......A..T..........- ..T......C..G...AG.......C...A.......A..GC...TC............A...C.A..........G..T.G..G.......C...G...G..........G...C...G..T..T......AA...........C....T...A..C..T...A..CC....GA.......T..C...... -.......A...GAC...............T...G.........T........A................G...A...A..........A.......... T.A..G.........C..........A..............T.AT.....T............A..GG.....GG....C.........C..........AA.T...GGG..GAT........G....G..TT......A............. .G...........G..........T................................. ................G...............A...C...............A............      256    178 ,    244    176      49:>A/Kansas/UR06-0068/2007(H1N1)           
  50 >A/New Caledonia/20/1999(H1N1)           .C..A.........A...A...A.A...........T.......G.........G.T........G......T............G..T..G........T...A..C.......G....CGAC..G..CAACG.T..T.C...ATAGA...CT......T.C......C. .....T....C.G..AA.GTT.......CG......A.A................G.A.....CT........A..........G.....A.....C....................GA.......C..........C..G.T..G..TG.T...G..........TC.C.C.AG G.GG....TA.....................T..C.G..CA...............A..G.......AA...T....G..GCAG........G....TG.CC.A..T.T.........T.......T...G.G......A..T..........- C.T......CA.G...AG.......C...A.......A...C...TC....A.......A.....A.......T..G..T.GA.G.......C...G...G.....G...TG...C...G..T..T...............G...C....T...A..C..T...A..CC..A.GA.........TC.....G -....A.A.G.GGA................T..GG.........T...AG..CA.G......CC..T...G.......A.........AA..G....... T.A............C..........A..............T..T.....T...........CA..GG.....GG....C.........C.....CG.C.A..T...G.G..G.T........G....G...T......A.......A..... .GC...A.....TG.......C..T.C...T........G..C............G.G .......A....C.....T..A..G...G.......C..C......C...T.A......G....A      261    240 ,    249    238      50:>A/New Caledonia/20/1999(H1N1)           
  51 >A/Beijing/262/1995(H1N1)                .CG.AC........AC..A.A.A.A........A..T.......G.G.A.....G.TAA.......C.....T..A.........G.AT...........T.C.A..C..C..G.G...GCGACG.G..CAACG.T....C.C.ATCGA...CT......T.C.....AC. C.A..T....C.G..AA.GT......A.CG......A.AG...G.......T...G.......CT........A........A.G.....AT....C.......T....G..T..CCGA....G..C.........CC..G.T..G..T..T.A.G..........TCGC.C.AG G.GGA...TA..G..C........G.....CT..C.G..CA.C...A...C.....A..GT......AA.G.T....G..GCAG.C......GA...TGCC..A.TT.T.C.......T.......T...G.G.C....A..T..........- CAT......CA.G...AG.......C...A.C...T.A..GCC..TC.A..A......AAAG...A..A.C.TTG.G.TT.G..G...A...C...GA.GG.....GC..TG.G.C...G..T.TT......A......AGG...CT...T.A.A.AC..T.A.A..CC..AAGA.........TA.....G -....A.A..CGGA...A....C....G..T.AGG........GTA.CAGATCA.G....CACC..T...G.......A..G.A....AA.GG..C.... T.A..G.........C....T.....A............TTT..T...T.T.T.T..T.A..CA..GG..T..GG....C.G..C....C..T..CG.C.A..T...G.GG.G.T...C.A..G....GG..TC...A.AG......A....A .GC.C..G....TG......GC..T.....T.......TG..C........A...G.. .....GTA....CC...AT.AA..G.A.G....C..C..C...A..C...T.AA.....G...CA      406    360 ,    394    358      51:>A/Beijing/262/1995(H1N1)                
  52 >A/Taiwan/01/1986(H1N1)                  .CGGACC..G.GT.AC.GAGACAAAAT.AG.GTAC.TC.C.T..G.G.AG...AGATAAAA..GC.CT..G..G.AC..GCGAT...AA.G.G.GC.TA.TGCAA..C.CCCCG.GG..GCGAC..AG.CAA.GTT.G.A..CCATCGA..TCT.T...CT.CGGC..AC. TCA..T....CGG..AA.GTTG...AATCG.G..A.AAAGA...A.GA.T.T.TAG....T..CT..GTG..CA.TAAC.G.AGGC..CCATACA.C.....A.T....G..T..CCGA...AGT.C..C..TT.CCC.AGA...G...GCTAA.G..ACC.....TCGCACAAG G.GG..T.TA..G.ACGAAC...TG.....CTT.CCG..CATCCTGA..CCCA.C.A..G...G..GAA.G.T...AGA.GCAGCCA...TGGACC.TGCC.A.ATT.T.C.TA..CTT.A.G..AT.T.G.G.C..GTAA.TAA.T....A.- CATG..G..GA..C..AG.C....GC..AA.C.T.TAA.C.CCTCTC.A.CA.......AAG.G.A..A.CCTTG.G.TT.G..G...A...C.AGGA.G...T..GC..TG.G.CC.TGC.TCTT..C...AA.....A.AA.GC...CT.A.A.ACG.TTA.A.CCC.CAAGA.G.A.....TAG.T..G -.A..A.A..CGGA..AAC...C..G.G.TT.AGGG......GGTA.CAGATCA.GA...CACC..T..AG....TAGA..GGA...TAA.GG..C.G.. TGATG.A...ATC..T..TCTAA...C.C...A.C.GGCTTTGATCA.TGT.T.TCTTGA..TAGGGGATT..GG.CT.CAGAGC.C.CCGATG.CTT..AAATGA.G.GGGG.TCTCCAA..GTATAGG..TC.GGAAAGA.....G.T.CA .GCGC.AG....TGA..C.GGCT.TG....TGA.AC.GTGCT.C.TTC.CG....G.G C.A..GTA.C..CCG.G..CAA..G.A.GA.C.CATC..CAA.AACCA..TCAA.TAC.GAAA.A      712    639 ,    701    637      52:>A/Taiwan/01/1986(H1N1)                  
  53 >A/Index/1977(H1N1)                      .CGGACC..G.GT.AC.GAGA.AA..T.AGT.TAC.TC.C.T..GGG.AG..TAGATAAAA..GC.CTGCG.TGTAC..GCGATTGAAG.G.G.GC.TA.TGCAA..C.CCCCGGG.C.GCGACG.GG.CAA.GTT.G....CCATCGA..TCT.T..GCT.CGGC..AC. CCA..T.GC.CGG..AATGTTGG.CAATCGTG.AA.AAAGAGGGAGGAGTATGTAG.AG.TT.CT.CGTGC.CA.TAAC.G.AGGCCGCCATACA.C..CCGA.A.CACG..TTCCCGA.A.AGGTC..CC.TT.CCC.AGAT..G.T.GCTAA..A.ACCTG.C.TCGCACAAG G.GG..T.TA..GTTCGAACAG.TG...T.CTG.CCGC.CATCCTGACTCCCA.C.A..G.CCG.CGAA.G.TA.TA.A.GCA.CCA..ATGGACC.TGCC.A.ATTCT.C.TA..CTT.ACGTGATCTCGC.CCGCTTAA..AACTG...A.- C.TGCTG..GAC.C..AG.C..CAGCGAAA.C.T.TAA.C.CCTCTCCA.CAG.AA...AAG.G.A..AACCTTG.G.TTAG....A.AGGACAAGGA.G.CGT..GC..TG.G.CC.TGCATCTTA.CAC.A..C.A.A.AAGGC.CTCTTAAA.ACG.TTA.A..CC.CAA.AAG.A.....TAG.T.CG -.AAAAG...CGGA..AACT.GC..G.GGCT..GGGT...C.GGT.TC.G.TCAAGA...CACCGATC.AGAAC.TAGA..GGA.GATAA.GG..C.G.. TGATG.AG.C.TCT.CT.TCTAAG.CA.C..AA.CCGGCTT.G.TCA.TGTGTTTC.TGA..CAGG.GATTG.GG.CGGCAGAGC.C.CCGATG.CGTC.AAATGAAG.GGGG.TCTCC.A..GTATAGG..TC.GGAAAGAC.A..GTT.CA .GCGC.A....CTGA..CGGGCTGTG.C..TGA.ACTGTGCT.CTTTC.CG.A.AG.. C.A..ATA.CG.CCG.G..CAAG.G.AAG..C.CATC..CAA.AACCA.ATCAACTAC.G.ATCA      792    767 ,    781    765      53:>A/Index/1977(H1N1)                      
  54 >A/Denver/57(H1N1)                       ACGGACA.GG..T.AC.GAGACAA..T.AGT.TAC.TC...T..GGGAA..GTAGATAAAA..GCGCTGCG.TGTAC..GCGATT.AGG.GGG.GCTTAATGCAA.AC.ACCCGGGGCAGCGACG.GG..AA..TT...AATCCATTGAC..CTAT..GCT.CGGC...C. CCA..T.GC.C.G..A.TGTTAG.CAAT.GTG.AA.AAAGAGGGAGGAGTAAGTA..AG.TT.CTCCGTGC.CA.TAAC.G.AGGCCGCCATACA.C.TCCGA.A.CACG.GTTCCCGA.A.AGGTC..CC.TT..CC.AGAT..G.T..CT.A..A.ACCTG.C.TCTCA.AAG G.GG..T.TA..GTT.GAACAG.TG..CT.CTG.CCGC.CATCCT..CTCCCA.C.A..G.CCG.CGAA.G.TA.TA.A..CA.CCA..ACGGACC.TGCC.A.ATTCT.C.TA..CTT.ACGTGA.CTCGC.CCGCTTAAG.AACTG...A.- C.TGCTG..AACG...AGC.GTCAG.GCAA.C.CC.AA.C.CCT.GCCA.CAG.A.ACA.AG.G.A.AAACCTTG.GGTTAG..G..A.GGACAAGGA...CGG..AC.ATG...CC..GCATCTTATCAC.A..C.AGAGAAGGCTCTCTTAAAGA.G.TTAAA..A.GCAA.AAG.A.....TAGCTACG -TAAAAG..GCGGA..AACTTGC.TGGGGCT..GGGT.A.C.GGT.TC.G.TCAAGA...CACCGATC.AGAACATAGA..GGA.GATAA.G..ACA... .GATG.AG.CATCT.CT.TCTAAG.CA.C..AA.CCGGCTT.G.TCA.TGTGTTTC.TGA..CAGG.GATT..GG.CGGCAGAGC.C.CAGATG.CGTC.AA.TGAAG.GGGG.TTTCCA....TA.GGG.TTC.G.AAAGAC.A..GTT.CA .GCGC.A...CCTGA..CGGG.TGTG.C..TGA.ACTGTGCT.CTTTT.CG.A.AG.G CTA..ATA.CG.CCG.G..CAAGAG.AA...CACATC..CAA.AACCA.ATCAACTAC...ATCA     1072    780 ,   1060    778      54:>A/Denver/57(H1N1)                       
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  
---Index--------------------------------------GTAACTTGAAGACATTCATAGTGGGGCAGACACGTGAAATTCGTAAAGGAGACGAGAGGGGGTATATCATAACAAGTCTATAGCGACCCTAAACAACCGGAATTGCCTTTTTTTAATAGAAAGTATCAATGGTACCTACGTCATTCGAGTTCTCGCCTATGATAATATGTG ATTGCCGATTTATACGGCACCTAGAGGCAACAAGGGGCGAGAAACTAGACGCACGAAGAGCCGACTAACATATGAGGCATATTAATAATTGCCTGCTTCTTAGACCTGTATACCTTATCAGAGACCAAGTTTCCATTTTGAGCAAATCCATCGGAAGAGATCAGTTCAATGTCGA ACAAGACGCGCCACGTAGCTTAGCAAGTCATCCATTATATGATTCAGTCTATGTTGTAAAGTATGTATGAAAACTCGAGAATGATAGGGGAATGTTGCATTTGGTCCTCAAGCGCCTCCCGAACACCACTAAAAAAAACGGACGGTCAACAGGA TGCATATTATGTATACGATTACTCTTTTGGATAATCGGCTAATCTCTTTATGAACCGTCGTATTGGCGGGTTCCAAAACAGTGAAGGCCATCTCGAACAAAAACCGTTAGAAGACATACATGCTCCGATGTGGGCTCGAGATGAATCTATACGGGAGAATCCCGGATTTATGGAGCAAGAGGCGATTTCGTA CCGGGGAGGATAAGTGGGTCCTTGCAAAAACTGAAACCGTACAACGCTGAGATTGAGATCTGTTACCTAGAGCTGCGTGTGAAGAAGCGTAAACGTGAGA CAGAAAGAATGCTCAACCCACGCATTGCACTGGCTAACACCCAGATCGCACAACCTCCATACAGAAAAGGCATAAGGCATGAGATCTTTTAGCACTAGTCGGGCAGCAAAAAAGCACTTGGTAACGCTAAGCCTAAAGGGTGTATTCTCCTTG TAAATCGATTTTCTCGGATATTCACATTACCATTGTCACAAGTACCAATTAGGAGATA TCCCATCCCTAATTATAGCTGGACAGTGAGCTGAGCTCCTGGACGTACAGCTGGTCGATAGTGTG 
-codon-position-------------------------------1211111111111111 1111212211122111112111111111111111211111111121111111111111111111111112 111111111121112 22 1211111111211111111121111111111111111111111111121 11111211211112 111111111111112121111111211111111112 121111111 2111111111111111111111 1211111111111 12112111111121121111111211111111112111111111121111111121111 2111111111211 1111121 11112 1 1 1211211111111 11112111121111111111111112111111111121112111121 1211 111112 111 1212112 111 111111 11211111111112112111112111111111111 1111121111112121 1112 2  1111          1   1 121  1 22 1  1  2 2 1 1       1  12  1    1 22  2 2 2  1 2 122 1 12 2 12 2  2 2        1    2  11 1    1     1  1   1             2   1  1  2       1        1 1    1   2 2211221222222221 22222222222222222222222 221221222222222 22 2222222 2221 222 22222222221    22121 22 11121111 12 11 21111111 1121  1211221 11111111211 1111121121111  1 2111212 121 11122 2111 1111121111221121 211 1 1112 11111212 1111112111121 1111111 1111 12111111121111211121111 11121111111112112   21  2 22 1 122 1 1       2      112 1   1 1  11 2 21 21 1121112 121211 112111111 
                                              000000000000000000000000000000000000000000000000000000000000000000000000000001111111111111111111111111111111111111111111111111111111111111111111111111122222222222222222222 0000000000000000000000000000000000000000000000000000000000000000000001111111111111111111111111111111111111111111111111111111111111111111111111111112222222222222222222222222222 0000000000000000000000000000000000000000000000000000000000000000000000000000111111111111111111111111111111111111111111111111111111111111111111122222222222 000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000001111111111111111111111111111111111111111111111111111111111111111 0000000000000000000000000000000000000000000000000000000000000001111111111111111111111111111111111111 000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000111111111111111111111111111111111111111111111111111111 0000000000000000000000000000000000000000000000000000000001 00000000000000000000000000000000000000000000000000000000000000000 
                                              000011111111222222222222333333333444444445555555566666667777788889999999999990000000000111122222222333333333444455555555566666667777777788888888999999900000000111111112222 0011111122222222223333333344444455555555566666666677788888889999999990000001111111112222222223333333444445555566666667777777777777888888888899999990000000000111111111112222233 0000001111122222222223333344444444555555555556666677888888888888999999999999000000000000000111111222333333344455555556666667777888888999999999900000011112 000000001111111112222222222222333333333333333334444444444444455555555555556666666666666666666777777777777888888888999999999999990000000011111111122222223333333334444444455555555556666666667777 0011112222222223344444455555555666666666677777888889999999999990000000111111111112222222333333444445 000000011111111111112222222222222233333334444455555555556666666666677777777777777888888888999999999000000000000001111111111111122222222223333333333333344 0011111122233333344444455555556666677777888888888889999990 00000001111111222222222333333334444444455566666666677777777788888 
                                              567700036679011124556677023456679000135890145778901236890468807891233455677890013557899008811234466036778999233401123578900335772345678933356777123489902233589001224791122 4904677801234445571334678835679901566678901236667834612456790113445781236782455668881112347880137899567894688800456880124556788899011122456712356680345577788003345557894556800 4478880146900223457893456900356889003455578891578803000122344568011233468999000123345566779116679133023578833411347770578898899012357003344456712223566772 568888990236678890111222336677000111223444555892233456678889901122236677890112455666667778889122245677788001155578000112333468891122348802333477923445780023445571255667800133477890014457781335 4845690123679990601226701567789112236778933679225580234555668890013368001122777890234567244557046673 344678901122344667990123446667778801133593567812345567890223455688923347777777899013455688001255899112233445668881122223357788901133466880011122367789912 3723346800802234615567911244471234600134123456679990558880 11166890034788011236799234457893334445705933445577800334488912224 
                                              553606930683214784692678857032761034867702743149849044240801404020517025436573989472467123936270948999678459725770357968136064260840819214754036249540680368898146683415878 9792325754954783449179163561380924001229876241386205646162727037062051173213439280680468836250296767681986105839510475804068436959706958682351064615213914539014702685818128745 3495689280025265492087637739673149582101376953532546259136527887705517949047089644982606579175841015370721428449410366161766925402722033656810210190934392 991258792982513685069389021419589358243157457200925193574598916923890402290127919012890230139526870713736146926838029232019864531706010742157303113281842732480653248173806939225168912491719171 7354472876980394670251638735876143922170017031341712087346293651791542050247058465057026017020852752 436832791889324138032407470570153651601519795759260624097564358978380650234568939556916538173556814232434248393491467895801204170617924253757814032593943 7443923189372826485795607915779219469002551642793465124597 68939732550403439083327460585770271389358545095929607367878970697