Announcement

Collapse
No announcement yet.

Sequences at Genbank!

Collapse
This is a sticky topic.
X
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Re: Sequences at Genbank!

    Thanks for keeping up with the Genbank sequences. It's not as easy since they ended the way they were submitting the pandemic sequences.
    The salvage of human life ought to be placed above barter and exchange ~ Louis Harris, 1918

    Comment


    • Re: Sequences at Genbank!

      A/Moscow/IIV-33/2010/10/13(H1N1)

      has 78 mutations , 45.8 per year (more than the expected 35-40)
      44.7 mutations per year since the emergence of the Cancun-substrain.


      Code:
      
                                               00011111111122 00000011112 000000001111112 000111111 000000111 00000011 000000 000000 
                                               46900011346801 22366911891 035677890467791 666014446 234999123 13777811 224569 223334 
                                               26534649846596 47638989909 930613762272781 045570035 993368442 31224403 349201 664461 
                                               96704094165413 30607961650 967315337878665 508613876 832037389 16012071 832806 486874 
      -codon-position--------------------------   1 1  1            1             1       211 121   1         21 11    1    1  11 1  
      ---Index---------------------------------GCTGCAGAAAGTGG GGAAACCACAC CCAGGGTCGCGATGT GGTTGGCCC GATCCGGGA AGTGACCG GAGAGT CCTCAT 
         1 >A/******/index/2009/02/01          .............. ........... ............... ......... ......... ........ ...... ......
         2 >A/Moscow/IIV-33/2010/10/13(H1N1)   ATCATTAGGGACAA AAGGGTTGAGT TTGAAACAATAGCAC CAACAATTT ATCTTAAAG GACAGTAA AGAGAC TAGAGC 
         3 >A/Cancun-NY/Index/2009/04/15       .............A ........... ............... ..A...T.. A.....AA. .A..G... ..A.A. ....G.
                                                                                                                                     
      ---Index---------------------------------GCTGCAGAAAGTGG GGAAACCACAC CCAGGGTCGCGATGT GGTTGGCCC GATCCGGGA AGTGACCG GAGAGT CCTCAT 
      -codon-position--------------------------   1 1  1            1             1       211 121   1         21 11    1    1  11 1  
                                               00011111111122 00000011112 000000001111112 000111111 000000111 00000011 000000 000000 
                                               46900011346801 22366911891 035677890467791 666014446 234999123 13777811 224569 223334 
                                               26534649846596 47638989909 930613762272781 045570035 993368442 31224403 349201 664461 
                                               96704094165413 30607961650 967315337878665 508613876 832037389 16012071 832806 486874
      .
      .



      It has none of the typical Russian mutations from last season.
      It seems to be the same strain that is in England now, but while England
      published >30 HAs at GISAID, Russia published the full genome at genbank !

      Now, where did this substrain come from, where was it seen first,
      where did it emerge, why is it so successful ?


      earliest with that "UK"-strain that I found at genbank is
      A/Thailand/34-9912/2010/07/14

      also A/Karaj_Iran/5327/2010/12/06 , HA and NA available
      I'm interested in expert panflu damage estimates
      my current links: http://bit.ly/hFI7H ILI-charts: http://bit.ly/CcRgT

      Comment


      • Re: Sequences at Genbank!

        amazingly this new strain (the "UK"-strain) which dominates Britain and maybe Europe,Russia,West Asia,...
        has nothing to do with all the thousands of published viruses from last season !

        It probably emerged from a Cancun-virus, which early in April,May 2009
        went to Asia (?) and silently replicated since then in a niche undetectedly.
        Its time came when the other strains died in the Northern summer 2010.

        Find the country,region,city where it stayed in 2009 and early 2010 !

        However, even if it was only in one small village and we had known it
        and we had eradicated it - just another strain would probably have taken the place,
        now that the competing UK-strain did not increase the human population's immunity.

        But when we find and understand these flu-bottlenecks, we may be able to
        _choose_ the strain which will be dominant next season and plant it.
        So to slowly reduce the virulence of influenza ...
        I'm interested in expert panflu damage estimates
        my current links: http://bit.ly/hFI7H ILI-charts: http://bit.ly/CcRgT

        Comment


        • Re: Sequences at Genbank!

          new HAs from genbank since April 2010:

          Code:
                                                          000000000000000111111111111  
                                                          111134445666699001123444446  
                                                          457862579045933257707003365  
                                                          452404188508003061264384746  
          -codon-position--------------------------------- 211 1111211     12  21      
          ---Index----------------------------------------CACAGAGATGGTAGTTTGAGTGCACCC  
             1 >A/******/index/2009/02/01                 ...........................  
            11 >A/Thailand/34-9936,2010/07/14             -----G.....A.--------------  
             5 >A/Thailand/34-9943,2010/07/14             -----......A.--------------  
             6 >A/Habana/10291,2010/04/                   ...........A..........T...-  
             7 >A/Thailand/34-9913,2010/07/14             --------...A.--------------  
             2 >A/Bahia/231,2010/04/01                    ...........A..........T....  
            22 >A/Texas/AF2647,2010/04/11                 T.........TA......G--------  
            23 >A/Bandar Abbas/5096,2010/10/02            ......A.C..A......G...T..T.  
            24 >A/Thailand/ST_0112_1,2010/10/             -----.A.C..A.--------------  
            25 >A/Thailand/ST_0113,2010/10/               -----.A.C..A.--------------  
            26 >A/Thailand/ST_0111,2010/10/               -----.A.C..A---------------  
            27 >A/Thailand/ST_0153,2010/10/               -----.A.C..A.--------------  
            28 >A/Thailand/SN_0112_2,2010/10/             -----.A.C..A.--------------  
            29 >A/Shahriar/5336,2010/12/06                ......A.C..A..CC...AG.T..T.  
            30 >A/Karaj/5660,2010/12/13                   ......A.C..A..CC...AG.T..T.  
            31 >A/Kenya/029,2010/06/16                    ...........A.......--------  
                                                                                       
            35 >A/Habana/10295,2010/04/                   ...........A..........T...-  
             3 >A/Thailand/CU-B2357,2010/04/20            ...........A.....A....T....  
             4 >A/Singapore/SS012,2010/05/                --------...A.....A....T....  
             8 >A/Singapore/SS004,2010/04/                ..T.AG.....A.....A....T....  
             9 >A/Singapore/SS003,2010/04/                ..T.AG.....A.....A....T....  
            10 >A/Singapore/GP2362,2010/05/18             ..T.AG.....A.....A....T....  
            12 >A/Parana/927,2010/04/19                   ...........AGA...A....TG...  
            13 >A/Parana/881,2010/05/17                   .G.G.......AGA...A....TG...  
            14 >A/Parana/937,2010/05/11                   .G.G.......AGA...A....TG..-  
                                                                                       
            32 >A/Korea/AF2430,2010/04/22                 ..........AA.......--------  
            33 >A/Thailand/34-9937,2010/07/14             -----....C.A.--------------  
                                                                                       
            34 >A/Thailand/SN_0116,2010/10/               -----....CAA.--------------  
            16 >A/Thailand/34-9912,2010/07/14             -----....CAA.--------------  
            15 >A/Moscow/IIV-33,2010/10/13                .........CAA....CA...AT.T.T  
            17 >A/Tehran/5675,2010/12/18                  T........CAA....CA...AT.T.T  
            18 >A/Karaj/5327,2010/12/06                   T......G.CAA....CA...AT.T.T  
            21 >A/Ulaanbaatar/190/2011(H1N1),2011/01/11   T......G.CAA....CA...AT.T.T  
            19 >A/Karaj/5718,2010/12/14                   T......G.CAA....CA...AT.T..  
            20 >A/Karaj/5685,2010/12/21                   T......G.CAA....CA...AT.T..  
                                                                                       
          ---Index----------------------------------------CACAGAGATGGTAGTTTGAGTGCACCC  
          -codon-position--------------------------------- 211 1111211     12  21      
                                                          000000000000000111111111111  
                                                          111134445666699001123444446  
                                                          457862579045933257707003365  
                                                          452404188508003061264384746
          .
          .
          .

          3 of the Sendai sequences rom 2009 had 640 and 1403

          Code:
             2 >A/Cancun-NY/Index/2009/04/15     ...........................A............................T.........
          
          
           143 >A/Sendai/TU533/2009(H1N1)        ......C.......A...........AA...........A...............AT.........
           144 >A/Sendai/TU613/2009(H1N1)        ......C.......A...........AA...........A......C........AT.........
           145 >A/Sendai/TU618/2009(H1N1)        ......C.......A...........AA...........A......C........AT.........
          
          ---Index-------------------------------GCTAGATCGCTCCGGAAATTACAACTGTACGGGACTCAGGCATGGGTAGATGCGGGCACCAGGAGT
          -codon-position------------------------11  12  222  2 1 1 2  2   1111 1 1 21 1 2    1  2  1  2212   11122
                                                 000000000000000000000000000000000000011111111111111111111111111111
                                                 000011111223333444445555566677888899900000001122222333444444555566
                                                 013901246592359013440366724534079924601113564715589268000158124789
                                                 730066047704960916464437310838411814122792689127913150038558226981
          I'm interested in expert panflu damage estimates
          my current links: http://bit.ly/hFI7H ILI-charts: http://bit.ly/CcRgT

          Comment


          • Re: Sequences at Genbank!

            I was curious about A/Ulaanbaatar/190/2011(H1N1),2011/01/11 so I Blasted it at GISAID. Here are the top 20 matches; first the nucleotides and then amino acids.

            I find it interesting to see the differences in the 2 Blasts, even though it's the same sequence.

            EPI298421 A/Karaj/5327/2010 (A/H1N1 swl) segment 4 (HA) 3125.7
            EPI294405 A/BRUNEI/218/2010 (A/H1N1 swl) segment 4 (HA) 3114.6
            EPI295513 A/Thailand/742/2010 (A/H1N1 swl) segment 4 (HA) 3103.5
            EPI295495 A/Thailand/594/2010 (A/H1N1 swl) segment 4 (HA) 3099.8
            EPI294391 A/SYDNEY/217/2010 (A/H1N1 swl) segment 4 (HA) 3098.0
            EPI294195 A/BRISBANE/69/2010 (A/H1N1 swl) segment 4 (HA) 3094.3
            EPI295411 A/Arizona/08/2010 (A/H1N1 swl) segment 4 (HA) 3092.4
            EPI286992 A/Johannesburg/119/2010 (A/H1N1 swl) segment 4 (HA) 3092.4
            EPI295736 A/England/107/2010 (A/H1N1 swl) segment 4 (HA) 3086.9
            EPI295726 A/England/86/2010 (A/H1N1 swl) segment 4 (HA) 3086.9
            EPI294282 A/BRISBANE/209/2010 (A/H1N1 swl) segment 4 (HA) 3086.9
            EPI287020 A/Ghana/FS-10-4259/2010 (A/H1N1 swl) segment 4 (HA) 3086.9
            EPI287018 A/Ghana/FS-10-4241/2010 (A/H1N1 swl) segment 4 (HA) 3086.9
            EPI286990 A/Johannesburg/115/2010 (A/H1N1 swl) segment 4 (HA) 3086.9
            EPI280311 A/India/8910/2010 (A/H1N1 swl) segment 4 (HA) 3086.9
            EPI279083 A/CHRISTCHURCH/15/2010 (A/H1N1 swl) segment 4 (HA) 3086.9
            EPI278873 A/India/8910/2010 (A/H1N1 swl) segment 4 (HA) 3086.9
            EPI258566 A/California/VRDL91/2009 (A/H1N1 swl) segment 4 (HA) 3086.9
            EPI258366 A/Athens/INS160/2009 (A/H1N1 swl) segment 4 (HA) 3086.9
            EPI244271 A/SAPPORO/576/2009 (A/H1N1 swl) segment 4 (HA) 3086.9



            Amino Acid:

            EPI298421 A/Karaj/5327/2010 (A/H1N1 swl) protein HA 1179.5
            EPI294405 A/BRUNEI/218/2010 (A/H1N1 swl) protein HA 1179.5
            EPI294391 A/SYDNEY/217/2010 (A/H1N1 swl) protein HA 1176.4
            EPI280311 A/India/8910/2010 (A/H1N1 swl) protein HA 1176.4
            EPI278873 A/India/8910/2010 (A/H1N1 swl) protein HA 1176.4
            EPI297192 A/Sendai/TU618/2009 (A/H1N1 swl) protein HA 1175.2
            EPI297188 A/Sendai/TU613/2009 (A/H1N1 swl) protein HA 1175.2
            EPI295513 A/Thailand/742/2010 (A/H1N1 swl) protein HA 1175.2
            EPI295411 A/Arizona/08/2010 (A/H1N1 swl) protein HA 1175.2
            EPI282023 A/Athens/INS335/2009 (A/H1N1) protein HA 1175.2
            EPI244271 A/SAPPORO/576/2009 (A/H1N1 swl) protein HA 1175.2
            EPI295749 A/England/5000135/2010 (A/H1N1 swl) protein HA 1174.8
            EPI295748 A/England/5000125/2010 (A/H1N1 swl) protein HA 1174.8
            EPI295746 A/England/4980074/2010 (A/H1N1 swl) protein HA 1174.8
            EPI295742 A/England/4840022/2010 (A/H1N1 swl) protein HA 1174.8
            EPI295495 A/Thailand/594/2010 (A/H1N1 swl) protein HA 1174.8
            EPI294674 A/England/4880374/2010 (A/H1N1 swl) protein HA 1174.8
            EPI276495 A/SC/76/2009 (A/H1N1 swl) protein HA 1174.8
            EPI300972 A/Kentucky/08/2010 (A/H1N1 swl) protein HA 1174.5
            EPI295757 A/England/4920303/2010 (A/H1N1 swl) protein HA 1174.5
            The salvage of human life ought to be placed above barter and exchange ~ Louis Harris, 1918

            Comment


            • Re: Sequences at Genbank!

              ****** in Boston , Feb.19 ?

              (only that one segment, all the other uploaded Boston H1 are old,seasonal H1N1)




              http://www.ncbi.nlm.nih.gov/nuccore/CY080600?



              COMMENT This influenza isolate was sequenced as part of the NIAID Genome
              Sequencing Center Influenza Project at the J. Craig Venter
              Institute. This sample is being submitted as a draft sequence
              because after two rounds of targeted finishing some or all segments
              do not meet either NCBI or J. Craig Venter Institute standards of
              completeness due to low coverage, low quality, ambiguities,
              frameshifts, gaps, or other problems.
              This work was supported by the National Institute of Allergy and
              Infectious Diseases (NIAID), Genome Sequencing Centers for
              Infectious Diseases (GSCID) program.


              /host="human; age 17Y"
              /db_xref="taxon:744729"
              /segment="2"
              /lab_host="P0 passage(s)"
              /country="USA: Boston"
              /collection_date="19-Feb-2009"


              when was it sequenced ? presumably contaminated with ******


              -----------------------------------------------------



              Code:
                                                000000000000001111111111111112222222 00000000000000111111111111111122 00000000000111111111112 0000000000000000000000000000001111111 00000000000000000111111 000000000000000000111111111 00000000000 0000000000000000000000000000000 
                                                111344557789990001122345557990011111 11223344556789012233357777779902 00115788999013334668990 1112222344555666666667778889991334456 00222344556778889000244 000112456678888999000001224 23355566789 0011112222333333344444466677888 
                                                278818584436680364838570490180734578 38114558491371531545941334691245 45264749238161567247223 6771477877036000112440130890892560705 38489949177381256378324 158294475842235228123383230 40315736187 0755790124223466902333527959223 
                                                945777024770315256512793237464975721 23675493118255618476853253447536 57629767767702653378061 8483303567921128799089584590095983303 37624348068839626216329 763323634473872177110807761 09362033106 6314189196781806680039027870038 
              -codon-position-------------------  2  11            111         1        1    1   2          11    2               21            1    12 21 1222121 11   2 2    2                  1         222   2    1       11                11  111  211  11      111 12211111 
              ---Index--------------------------AAGCCAAGGGCCAAATCTCGTCGTTCGGCCATCAGG CGCTAGCAGACAACTCAAACTTAACCAGAGGC GGGAATCTGGAGTACCTCTAGTA AATCCGGGGCTTAAATAAGGTGGCAGGGCAATCGACC ACTAATTGGAAGGGCCCTGAGAT ATAACGTGTGATCCCTTAAGGAAATGC CTAATGGTACG TCGCTGAGCCAAATCAGGGCGTTGCGGATGG 
                 1 >A/Boston/26/2009/02/20      .................................... ................................ ....................... G.................................... ....................... ........................... ........... ..................A............ 
                 2 >A/Boston/28/2009/02/21      ............................T....... .......................G........ ..A.................... G.................................... ....................... ........................... ........... ..................A............ 
                 3 >A/Boston/92/2009/02/20      .................................... .......................G........ ..A.................... G.................................... ....................... ........................... ........... ..................A............ 
                 4 >A/Boston/63/2009/03/03      .................................... ........A....................... .A.................G... G.............G...................... ....................... .......................G... ........... ...........G................... 
                 5 >A/Boston/24/2009/02/18      .................................... ........A....................... .A.................G... G.................................... ....................... .......................G... ........... ...........G................... 
                 6 >A/Boston/60/2009/02/28      ........A........................... ........A....................... AA..................... G.................................... ....................... .......................G... T.......... ............................... 
                 7 >A/Boston/20/2009/02/11      ........A.................A......... ........A....................... .A..................... G.................................... ....................... .......................G... T.......... ............................... 
                 8 >A/Boston/62/2009/03/01      .................................... ................................ ....................... G.................................... .....C................. ........................... ........... ............................... 
                 9 >A/Boston/18/2009/02/09      ............T....................... ................................ ....................... G.................................... ....................... ...................A....... ........... ............................... 
                10 >A/Boston/41/2009/02/27      ............T....................... ......T......................... ....................... G.................................... ....................... ...................A....... ........... ............................... 
                11 >A/Boston/58/2009/02/27      ............T....................... ................................ ....................... G.................................... .A..................... ...............C...A.G..... .......C... ............................... 
                12 >A/Boston/65/2009/03/09      ............T....................... ...............................T ..................A.... G..................A.A......T........ .A..................... .........A.....C...A.G..... ........... ............................... 
                13 >A/Boston/66/2009/03/10      ............T....................... ...............................T ..................A.... G..................A.A......T........ .A..................... .........A.....C...A.G..... ........... ............................... 
                14 >A/Boston/11/2009/02/08      ............T....................... ................................ ....................... G.................................... .A..................... ...................A.G..... ........... ............................... 
                15 >A/Boston/86/2009/02/13      ............T....................... ................................ ....................... G.................................... ....................... ...................A....... ........... ............................... 
                16 >A/Boston/84/2009/02/11      ............T....................... ................................ ............C.......... G.................................... ....................... ...................A....... ........... ............................... 
                17 >A/Boston/33/2009/02/23      ............T......................A ................................ ....................... G.................................... ....................... ...................A....... ........... .............................T. 
                18 >A/Boston/38/2009/02/25      ............T......................A ................................ ....................... G.................................... ....................... ...................A....... ........... ............................... 
                19 >A/Boston/100/2009/04/27     .................................... ........................A....... ....................... G.................................... ....................... ...................A....... ........... ............................... 
                20 >A/Boston/48/2009/02/13      ..A................................. ................................ ....................... G.................................... ....................... ...................A....... ........... ............................... 
                21 >A/Boston/4/2009/01/31       ................................T... ................................ ....................... G..............................C..... ....................... ........................... ........... ............................... 
                22 >A/Boston/1/2009/01/29       ................................T... ................................ ....................... G.................................... ....................... ........................... ........... ............................... 
                23 >A/Boston/83/2009/02/09      T..T................................ ................................ ....................... ..................A...A.............. ....................... ........................... ........G.. ............................... 
                24 >A/Boston/37/2009/02/24      T..T................................ ................................ ................C...... ..................A...A.............. ....................... ........................... ........G.. ............................... 
                25 >A/Boston/91/2009/02/22      T..T................................ .....A........................A. ................C...... ..................A...A.............. ...........A...T....... ........................... ........G.. ............................... 
                26 >A/Boston/68/2009/03/13      T..T................................ .....A........................A. ................C...... ..................A...A.............. ...........A...T....... ........................... ........G.. ............................... 
                27 >A/Boston/89/2009/02/23      T................................... .....A.......................... ................C...... ..................A...A.............. ...........A...T....... ........................... ........G.. ............................... 
                28 >A/Boston/27/2009/02/20      T..T................................ ................................ ....................... .......A........G.A...A.............. ....................... ........................... ........G.. ............................... 
                29 >A/Boston/64/2009/03/09      T..T................................ ................................ ....................... .......A........G.A...A.............. ....................... ........................... ........G.. ............................... 
                30 >A/Boston/95/2009/04/01      ...T................................ ................................ ....................... ..................A.................. ....................... ........................... ....C...... ............................... 
                31 >A/Boston/42/2009/03/01      ......................A............. ........................T....... ....................... ........................G............ ............A.......... .................G..A...... ........... .......A.........T............. 
                32 >A/Boston/72/2009/03/24      ......................A............. ........................T....... ....................... ........................G............ ............A.......... .................G..A...... ........... .......A.........T............. 
                33 >A/Boston/80/2009/01/30      .................................... ......T......................... ................A...... ..........G.......................... ....................... ....................A...... ........... ............................... 
                34 >A/Boston/39/2009/02/26      ....TGG................C...A........ ..........A.G....C.......T...... ....G.....G..G..C...... ..C.......G............T..A......A.T. G............A...A..... ....................A...... ...G..A.... .AATCA..TTG.GCTGA..TACC.TA.GC.A 
                35 >A/Boston/13/2009/02/10      ....TGG................C...A........ ..........A.G....C.......T...... ....G.....G..G..C...... ..C.......G............T..A......A.T. G............A...A..... ....................A...... ...G..A.... .AATCA..TTG.GCTGA..TACC.TA.GC.A 
                36 >A/Boston/45/2009/03/03      ....T.G................C...A........ ............G....C.......T...... ..........G..G......... ..C.......G...............A........T. G............A...A..... ........C...........A.G.... ...G..A.... .AATCA..TTG.GCTGA.CTACC.TA.GC.A 
                37 >A/Boston/30/2009/02/20      ....T.G................C...A........ ............G....C.......T...... ..........G..G......... ..C.......G...............A........T. G............A...A..... ........C...........A...... ...G..A.... .AATCA..TTG.GCTGA..TACC.TA.GC.A 
                38 >A/Boston/21/2009/02/11      ....T.G................CC..A......A. ............G....C.......T...... ..........G..G......... ..C.......G...............A........T. G............A...A..... .C......C...........A...... ...G..A.... .AATCA..TTG.GCTGA..TACC.TA.GC.A 
                39 >A/Boston/17/2009/02/10      ....T.G................CC..A......A. ............G....C.......T...... ..........G..G......... ..C.......G...............A........T. G............A...A..... .C......C...........A...... ...G..AC... .AATCA..TTG.GCTGA..TACC.TA.GC.A 
                40 >A/Boston/85/2009/02/12      ....T.G................C...A........ ............G....C.......T...... .............G......... ..C.......G...............A........T. G............A...A..... ....................A...... ...G..A.... .AATCA..TTG.GCTGA..TACC.TA.GC.A 
                41 >A/Boston/43/2009/03/01      ....T..................C..AA...C.... ............G....C.......T...... ........A....G......... ..C.......G...............A........T. G............A...A..... ....................A...... ...G..A.... .AATCA..TTG.GCTGA..TACC.TA.GC.A 
                42 >A/Boston/14/2009/02/11      ....T..................C..AA...C.... ............G....C.......T...... ........A....G......... ..C.......G...............A........T. G............A...A..... ....................A...... ...G..A.... .AATCA..TTG.GCTGA..TACC.TA.GC.A 
                43 >A/Boston/71/2009/03/23      ....T..................C..AA...C.... ............G....C.......T...... ........A....G......... ..C.......G...............A........T. G............A...A..... ....................A...... ...G..A.... .AATCA..TTG.GCTGA..TACCATA.GC.A 
                44 >A/Boston/35/2009/02/23      ....T..................C..AA...C.... ............G....C.......T...... ........A....G......... ..C.......G...............A........T. G............A...A..... ....................A...... ...G..A.... .AATCA..TTG.GCT.A..TACC.TA.GC.A 
                45 >A/Boston/76/2009/01/20      .............G.G.....T...........G.. T................CG.C........... .A...C................G ..C..A....GCG.............A........T. ....G.C..........A..... ..G....A....T.......A...... .........T. ......G.............A.......... 
                46 >A/Boston/52/2009/02/14      .............G.G.....T...........G.. T................CG.C........... .A...C..............A.G ..C..A....GC..............A........T. ....G.C..........A..... ..G..A.A....T.......A.....T .........T. ......G.............A.......... 
                47 >A/Boston/36/2009/02/24      ..A............G......A..........G.. .................CG.........G... AA..................... ..C.......GC.............AA........T. ....G.C..........AA.... .......A....T.......A...... .........T. ....................A.......... 
                48 >A/Boston/67/2009/03/10      .T.....A..TT...GTC.A.T...T....G..G.. .......G.....TC..CG...G.....T... .A.C..T....A........... ..C.....A.GC...C..A.......AA.......T. ....G.C.A........A...G. ...G...A..G.T.T.C...A.G..A. ..G.CA...TA C...........G.......A.C........ 
                49 >A/Boston/51/2009/02/13      .T.....A..TT...GTC.A.T...T....G..G.. .......GA....TC..CG...G.....T... .A.C..T....A........... ..C.....A.GC...C..A.......AA.......T. ....GCC.A........A...G. ...G.A.A..G.T.T.C...A.G..A. ..G.CA...TA C...........G.......A.C........ 
                50 >A/Boston/49/2009/02/13      .T........TT..GATCTACT...T...AG..G.. .......G.G.T.T..GCG..AG......... .A.CG..C.......A.....C. .GC.T....AGC.G.G..A.......A..TG.T.GTT ..CGG.CAA.....T.AA.GAGC G...T.CA..G.T...C.G.A...CA. .CG......TA ............G.......A.CA..A..T. 
                51 >A/Boston/88/2009/02/19      .T........TT..GATCTACT...T...AG..G.. .......G.G.T.T..GCG..AG......... .A.CG..C.......A.....C. .GC.T.A..AGC.G.G..A.......A..TG.T.GTT ..CGG.CAA.....T.AA.GAGC G...T.CA..G.T...C.G.A...CA. .CG......TA ............G.......A.C...A..T. 
                52 >A/Boston/93/2009/03/17      .T......AATT...GTC.A.T...T....G..G.. .......G.....T...CG...G...G..A.. .A.C.............T..... ..C.......GC..GG..A.......A........T. ..C.G.C.A.......AA...G. .....T.A..G.T...C...A....A. .CG......TA ............G.......A.C........ 
                53 >A/Brisbane/59/2007/07/01)   ..........T....G.................G.. .TACG..G.....T.T.CGT..G...GA.A.. .A.C.....A....T........ ..CT......GC...G.GA.C.....A........T. ....G.C.AGC......A...G. .....T.A..GCTT..C...A....A. ..G......TA ............G.......ACC........ 
                54 >A/Kansas/UR06-0068/2007)    .........ATT...GT..A........TT...G.. .TACG........T.T.CGT..G...GA.A.. ...C...G.A..C.T..T..A.. ..CT..A...GCG..GGGA.C....AA....C...T. ..C.G.C.AGC......AA..G. .....T.A..GCTT..C....T...AT ..G......TA ............G.......ACC..A..... 
                                                                                                                                                                                                                                                                                    
              ---Index--------------------------AAGCCAAGGGCCAAATCTCGTCGTTCGGCCATCAGG CGCTAGCAGACAACTCAAACTTAACCAGAGGC GGGAATCTGGAGTACCTCTAGTA AATCCGGGGCTTAAATAAGGTGGCAGGGCAATCGACC ACTAATTGGAAGGGCCCTGAGAT ATAACGTGTGATCCCTTAAGGAAATGC CTAATGGTACG TCGCTGAGCCAAATCAGGGCGTTGCGGATGG 
              -codon-position-------------------  2  11            111         1        1    1   2          11    2               21            1    12 21 1222121 11   2 2    2                  1         222   2    1       11                11  111  211  11      111 12211111 
                                                000000000000001111111111111112222222 00000000000000111111111111111122 00000000000111111111112 0000000000000000000000000000001111111 00000000000000000111111 000000000000000000111111111 00000000000 0000000000000000000000000000000 
                                                111344557789990001122345557990011111 11223344556789012233357777779902 00115788999013334668990 1112222344555666666667778889991334456 00222344556778889000244 000112456678888999000001224 23355566789 0011112222333333344444466677888 
                                                278818584436680364838570490180734578 38114558491371531545941334691245 45264749238161567247223 6771477877036000112440130890892560705 38489949177381256378324 158294475842235228123383230 40315736187 0755790124223466902333527959223 
                                                945777024770315256512793237464975721 23675493118255618476853253447536 57629767767702653378061 8483303567921128799089584590095983303 37624348068839626216329 763323634473872177110807761 09362033106 6314189196781806680039027870038


              reassorted segment 8
              I'm interested in expert panflu damage estimates
              my current links: http://bit.ly/hFI7H ILI-charts: http://bit.ly/CcRgT

              Comment


              • Re: Sequences at Genbank!

                the India-England strain (605,1171,1156,1403)
                was also in Denmark, Dec.2010
                most without the 640 mutation, but with a new Danish 340


                Code:
                                                           00000000000000000000000000000111111111111111111 
                                                           00111122333444455566666667999000122333444444566 
                                                           16458802349235717900455899334258707789003346655 
                                                           63454572309421869857078703035060165467384794636 
                -codon-position----------------------------1  212   1 1 11  1211 1  1      1    221        
                ---Index-----------------------------------GTCAAGGTTGAACGAAATGGGGTGACGTCTTGGGTTATGCACACGTC 
                   1 >A/******/index/2009/02/01            ............................................... 
                   2 >A/swine/IL/25399-2,2010/05/18        .....................AA..T......A......T....A.. 
                   3 >A/swine/IL/25399-4,2010/05/18        .....................AA..T......A......T....A.. 
                   4 >A/Singapore/SS012,2010/05/           -----------------.....A.........A......T..G.... 
                   5 >A/Denmark/116,2010/12/14             -......C...G..........A.........A......T..G.... 
                   6 >A/Denmark/108,2010/12/10             -......C...G..........A.........A......T..G.... 
                   7 >A/Thailand/34-9936,2010/07/14        ----------.G..........A...--------------------- 
                   8 >A/Singapore/GP2362,2010/05/18        ...........G..........A.........A......T....... 
                  11 >A/Thailand/34-9943,2010/07/14        ----------............A...--------------------- 
                   9 >A/Thailand/34-9913,2010/07/14        ----------------......A...--------------------- 
                  34 >A/swine/IL/25399-3,2010/05/18        ...................A..A.........A......T....A.. 
                  35 >A/swine/IL/27486-1,2010/06/02        T....A....G...........A..............C.T....... 
                  36 >A/swine/IL/27486-2,2010/06/02        T....A....G....G......AA.............C.T....... 
                  37 >A/Kenya/029,2010/06/16               ...............G......A..........-------------- 
                  38 >A/Bandar Abbas/5096,2010/10/02       .............A...C....A................T...T... 
                  39 >A/Thailand/ST_0111,2010/10/          -----------..A...C....A------------------------ 
                  40 >A/Thailand/ST_0112_1,2010/10/        ----------...A...C....A..---------------------- 
                  41 >A/Thailand/ST_0113,2010/10/          -----------..A...C....A...--------------------- 
                  42 >A/Thailand/ST_0153,2010/10/          -----------..A...C....A..---------------------- 
                  43 >A/Thailand/SN_0112_2,2010/10/        ----------...A...C....A..---------------------- 
                  44 >A/Tunisia/422,2011/01/07             .............A...C....A................T...T... 
                  45 >A/Shahriar/5336,2010/12/06           .............A...C....A....C.C...ACG...T...T... 
                  46 >A/Karaj/5660,2010/12/13              .............A...C....A....C.C...A.G...T...T... 
                  47 >A/Parana/881,2010/05/17              --.GG.................A.G.A.....A......TG...... 
                  48 >A/Parana/937,2010/05/11              ...GG.................A.G.A.....A......TG....-- 
                  49 >A/Denmark/127,2010/12/22             -........A............A.........A......T....... 
                  50 >A/swine/Taiwan/TD-2542,2010/09/01    ............T.........A...........C....T....... 
                  51 >A/Denmark/111,2010/12/07             -..................A..A........A.......T..G..-- 
                  52 >A/Tunisia/197,2011/01/04             ......................A........AA......T....... 
                  54 >A/swine/Minnesota/54354,2010/10/27   T.......C.G...........A................T....... 
                
                  10 >A/Denmark/104,2010/11/17             -.....................A.......C.A.....AT....... 
                  12 >A/Denmark/125,2010/12/21             -.....A...........C...A.......C.A.....AT.....-- 
                  13 >A/Denmark/132,2010/12/27             -.....A...........C...A.......C.A.....AT.....-- 
                  53 >A/Thailand/SN_0116,2010/10/          -----------.......C.A.A..---------------------- 
                  14 >A/Thailand/34-9912,2010/07/14        ----------........C.A.A...--------------------- 
                  15 >A/Moscow/IIV-33,2010/10/13           ..................C.A.A.......C.A.....AT.T....T 
                  16 >A/Tehran/5675,2010/12/18             ..T...............C.A.A.......C.A.....AT.T....T 
                  17 >A/Karaj/5327,2010/12/06              ..T...........G...C.A.A.......C.A.....AT.T....T 
                  18 >A/Karaj/5718,2010/12/14              ..T.....C.....G...C.A.A.......C.A.....AT.T..... 
                  19 >A/Karaj/5685,2010/12/21              ..T...........G...C.A.A.......C.A.....AT.T..... 
                  20 >A/Denmark/107,2010/12/10             -.T...........G...C.A.A.......C.A.....AT.T..... 
                  21 >A/Vladivistok/7,2010/12/03           ..T...........G...C.A.AA......C.A.....AT.T....T 
                  22 >A/Ulaanbaatar/190,2011/01/11         ..T.........T.G...C.A.A.......C.A.....AT.T....T 
                  23 >A/Denmark/109,2010/12/10             -C.......A........C...A.......C.A.....AT.....C. 
                  24 >A/Denmark/131,2010/12/27             -C.......A........C...A.......C.A.....AT.....C. 
                  25 >A/Denmark/130,2010/12/21             -C.......A........C...A.......C.A.....AT.....C. 
                  27 >A/Denmark/114,2010/12/14             -........A........C...A.......C.A.....AT.....C. 
                  28 >A/Denmark/129,2010/12/26             -........A........C...A.......C.A.....AT.....C. 
                  29 >A/Denmark/115,2010/12/14             -........A......G.C...A.....T.C.A...G.AT....... 
                  30 >A/Denmark/113,2010/12/15             -........A......G.C...A.....T.C.A...G.AT....... 
                  31 >A/Denmark/133,2010/12/25             -........A......G.C...A.....T.C.A...G.AT....... 
                  32 >A/Denmark/137,2010/12/26             -........A......G.C...A.....T.C.A...G.AT....... 
                  33 >A/Denmark/134,2010/12/27             -........A......G.C...A.....T.C.A...G.AT.......
                 
                                                                                                           
                ---Index-----------------------------------GTCAAGGTTGAACGAAATGGGGTGACGTCTTGGGTTATGCACACGTC 
                -codon-position----------------------------1  212   1 1 11  1211 1  1      1    221        
                                                           00000000000000000000000000000111111111111111111 
                                                           00111122333444455566666667999000122333444444566 
                                                           16458802349235717900455899334258707789003346655 
                                                           63454572309421869857078703035060165467384794636

                seems that almost all European NA have now 720,721,1107,1131


                Code:
                                                                          0000000000011111 
                                                                          1123334677701112 
                                                                          3331277322490134 
                                                                          1556782901287618 
                -codon-position-------------------------------------------2 11  1  11      
                ---Index--------------------------------------------------AGTGTCCATGATCGGT 
                   1 >A/******/index/2009/02/01                           ................ 
                  18 >CY080301 A/Thailand/CU-B2357/2010 2010/04/20 6 (N   ...A..T...G..... 
                  19 >HQ853301 A/Karaj/5660/2010 2010/12/13 6 (N          ...A......G..... 
                   3 >HQ897946 A/Denmark/123/2010 2010/12/23 6 (N         ...A....CAG.A.AC 
                   4 >HQ880596 A/Denmark/106/2010 2010/12/04 6 (N         ...A....CAG.A.AC 
                   5 >HQ897944 A/Denmark/129/2010 2010/12/26 6 (N         ...A....CAG.A.AC 
                   6 >HQ897941 A/Denmark/137/2010 2010/12/26 6 (N         ...A....CAG.A.AC 
                   7 >HQ897945 A/Denmark/125/2010 2010/12/21 6 (N         ...A....CAG.A.A. 
                   8 >HQ897942 A/Denmark/126/2010 2010/12/21 6 (N         ..CAC...CAG.A.A. 
                   9 >HQ880598 A/Denmark/104/2010 2010/11/17 6 (N         ..CAC...CAG----- 
                  10 >HQ897948 A/Denmark/132/2010 2010/12/27 6 (N         ..CAC...CAG.A.A. 
                  11 >HQ897947 A/Denmark/130/2010 2010/12/21 6 (N         ...A...GCAG.AAAC 
                  12 >HQ897943 A/Denmark/131/2010 2010/12/27 6 (N         ...A...GCAG.AAAC 
                  13 >HQ853303 A/Tehran/5675/2010 2010/12/18 6 (N         ...A.A..CAGCA.A. 
                   2 >HQ834748 A/Moscow/IIV-33/2010 2010/10/13 6 (N       G..A....CAG.A.A. 
                  14 >HQ853307 A/Karaj/5718/2010 2010/12/14 6 (N          GA.A.A..CAGCA.A. 
                  15 >HQ853304 A/Karaj/5685/2010 2010/12/21 6 (N          GA.A.A..CAGCA.A. 
                  16 >HQ880597 A/Denmark/110/2010 2010/12/10 6 (N         G..A....CAG.A.A. 
                  17 >HQ891282 A/Vladivistok/7/2010 2010/12/03 6 (N       G..A..T.CAG.A.A. 
                  20 >CY080574 A/Ulaanbaatar/190/2011 2011/01/11 6 (N     G..A....CAG.A.A. 
                                                                                           
                ---Index--------------------------------------------------AGTGTCCATGATCGGT 
                -codon-position-------------------------------------------2 11  1  11      
                                                                          0000000000011111 
                                                                          1123334677701112 
                                                                          3331277322490134 
                                                                          1556782901287618


                flu comes from India , where it exists the whole year, to Europe each season ?
                only few introductions, typically <10, that survive and spread


                while for USA it may come from Southern China, Thailand instead
                I'm interested in expert panflu damage estimates
                my current links: http://bit.ly/hFI7H ILI-charts: http://bit.ly/CcRgT

                Comment


                • Re: Sequences at Genbank!

                  Ontario update:


                  Code:
                    
                                                            0000000000000011111111111111111122 000000000000000111111111111111222222222 00000000000000000001111111111111111122 000000000000000000111111111111111 00000000000001111 000000000000111111111111 0000000000 000000000000    
                                                            1335666677888900011234555667899901 001224446666679001223334477889011111222 00011235677778888890013346677778899901 001445555666779999001122344455566 00234457999991233 033356678899011111122233 0123456778 012223334467    
                                                            1094336916589503547084356378001696 136031660335629588050072626195704589145 58909625601280122764640431113391478820 044591359056120023053757900606799 67905813044674428 401565642734000268968902 4333940260 461693661562    
                                                            7306396413686750493316123945667813 202441283262003826643545760865633540117 18958872384096925339295372734712870646 475126158585790610561162438493705 62816096328623891 736419823385117860467026 5689210704 937459074234    
                  -codon-position---------------------------       1 11 2  11   1 11 1   1              2 1   221  1    12  2  11    1  1   1       2     2   2 1          2  1211    1212         12 221   21    11   1        1 2 1  2211 2 2   21        11  1 11  111 1  1 2 1    
                  ---Index----------------------------------AGCGGTCTGGACGTAGCGGCAAGGGGACATTCGG TAGGAACAGGGCATGAGCACAAACATTTCCCTGGCCATC GACTTGGTGCGCGGGTTTCACCTCCGACCGGGGGTGAT AACGTAGTTGTGTAGTCGGTAGAAAGCCCGGAT CAGGATCCACGACGGAC CTGGCGTACGAAGACTTGGCGACC CCGGGCGCTT CGTCTCCATCAG    
                     1 >A/******/index/2009/02/01           .................................. ....................................... ...................................... ................................. ................. ........................ .......... ............    
                  
                  --------Cancun2,SC,Airplane-------------
                     2 >A/Ontario/152846,2009/06/04         ...A.............................. ...............G.....G................. ...........T.A........................ .......................G......... ................. .C.A.................... .......... ............    
                     3 >A/Ontario/147265,2009/06/01         ...A.............................. ...............G.....G................. ...........T.A........................ .......................G......... ................. .C.A.................... .......... ............    
                     4 >A/Ontario/147723,2009/06/02         ...A.............................. ...............G.....G................. ...........T.A........................ .......................G......... ................. .C.A.................... .......... ............    
                     5 >A/Ontario/152439,2009/06/04         ...A.............................. ...............G.....G................. ...........T.A........................ .......................G......... ................. .C.A.................... .......... ............    
                     6 >A/Ontario/156785,2009/06/08         ...A.............................. ...............G.....G................. ...........T.A........................ .......................G......... ................. .C.A.................... .......... ............    
                     7 >A/Ontario/142358,2009/05/27         ...A.............................. ...............G....................... ....C................................. ..A.............................. ................. ........................ .......... ............    
                  
                  -------pre-Cancun----------------
                     8 >A/Tk/Ontario/FAV117-1C,2009/12/07   ---------------------------------- --------------------------------------- -------------------------------------- ..A.....C........................ ----------------- .......G................ ---------- ------------    
                     9 >A/Ontario/9739,2009/06/15           ...........T...................... ......T.A.....................T........ ...................................... G................T....C...T...... ..A..........A... ..A....G................ A......... ............    
                    10 >A/Ontario/9698,2009/06/15           ...........T...................... ......T.A.....................T........ ...................................... G................T....C...T...... ..A..........A... ..A....G................ A......... ............    
                    11 >A/Ontario/25389,2009/08/09          ...........T...............T...... ....G..GA.....................T........ .......C.T.........G..........A....... G..........A.....T........T...A.. ..A....A.....A... ..A....G..........A....T .......... ............    
                    12 >A/Ontario/10016,2009/08/24          ..........RT...............T...... ....G..GA.....................T........ .......C.T.........G..........A....... G.......Y..A.....T........T...A.. ..A....A.....A... ..A....GT...R.....A....T .......... ............    
                    13 >A/Ontario/25913,2009/09/07          ..........GT...............T...... ....G..GA.....................T........ .......C.T.........G..........A....... G.......C..A.....T........T...A.. ..A....A.....A... ..A....GT...A.....A....T .......... ............    
                    14 >A/Ontario/10296,2009/08/17          ..........RT...............T...... ....G..GA.....................T........ .......C.T.........G..........A....... G..........A.....T........T...A.. ..A....A.....A... ..A....GT...R.....A....T .......... ............    
                    15 >A/Tk/Ontario/FAV110,2009/10/23      .......C...T...............T.C.... ...AG..GA..................C..T..A..... .........T.........G..........A.....G. G..........A.....T........T...A.. ..AA...A....TA..A ..A....G..........A....T .......... ............    
                    16 >A/Tk/Ontario/FAV114-17,2009/11/03   .......C...T...............T.C.... ...AG..GA..................C..T..A..... .........T.........G..........A.....G. G.......C..A.....T........T...A.. ..AA...A....TA..A ..A....G..........A....T .......... ............    
                    17 >A/Tk/Ontario/FAV110-4,2009/11/03    ---------------------------------- --------------------------------------- -------------------------------------- G..........A.....T........T...A.. ..AA...A....TA..A ..A....G..........A....T ---------- ------------    
                  
                  -----------Cancun------------
                    22 >A/Ontario/35273,2009/08/13          .....C...........................A .......................T............... ...................................... ..........A...............T...... ..A..........AA.. ..A....G................ ....A.A... .......G....    
                    23 >A/Ontario/235657,2009/08/21         .................................A ....................................... ...................................... ..........A...............T...... ..A..........AA.. ..A....G................ ....A.A... .......G....    
                    24 >A/Ontario/222656,2009/08/11         .................................A ....................................... .............A.....G.................. ..........A........C......T...... ..A..........AA.. ..A....G................ ....A.A... A......G....    
                    25 >A/Ontario/237882,2009/08/24         .................................A ....................................... ...................................... ..........A..............AT...... ..A..........AA.. ..A....G................ ....A.A... .......G....    
                    26 >A/Ontario/29801,2009/10/19          ....................G.....G......A ..........................G..T.......C. ......................C............... ..........A...............T...... ..A..........AA.. ..A....G................ ....A.A... .......G...A    
                    27 >A/Ontario/26184,2009/09/29          ....................G.....G......A ..........................G..T.......C. ......................C............... ..........A...............T...... ..A..........AA.. ..A....G................ ....A.A... .......G...A    
                    28 >A/Ontario/328474,2009/11/17         .................................A ....................................G.. ...................................... .....G....A..........A....T...... ..A..........AA.. ..A..A.G..........A..... ....A.A... .......G....    
                    29 >A/Ontario/320266,2009/11/08         ...................A...A.........A ....................................G.. A....A.......................A........ ..........A.A..C..A.......T....GC .GA..C.....G.AA.. ..A....G.A.G............ ....A.A... .......G..G.    
                    30 >A/Ontario/314137,2009/11/03         ...................A...A.........A ....................................G.. A....A.......................A........ ..........A.A..C..A.......T....GC .GA..C.....G.AA.. ..A....G.A.G............ ....A.A... .......G..G.    
                    31 >A/Ontario/296008,2009/10/18         ...................A...A.........A ....................................... A....A........................A....... ..........A.A.....A.......T....GC .GA..C.....G.AA.. ..A....G.A.............. ....A.A... .......G....    
                    32 >A/Ontario/315003,2009/11/03         ...................A...A.........A ....................................... A....A................................ ..........A.A.....A.......T....GC .GA..C.....G.AA.. ..A....G.A.............. ....A.A..C .......G.A..    
                    33 >A/Ontario/309862,2009/10/29         ...................A...A.........A ....................................... A....A................................ ..........A.A.....A.......T....GC .GA..C.....G.AA.. ..A....G.A.............. ....A.A..C .......G.A..    
                    34 >A/Ontario/315181,2009/11/03         ...................A...A.........A ....................................... A....A................................ ..........A.A.....A.......T....GC .GA..C.....G.AA.. ..A....G.A.............. ....A.A... .......G....    
                    35 >A/Ontario/314603,2009/11/02         ...................A...A.........A ....................................... A..C.A................................ ..........A.A.....A.......T....GC .GA..C.....G.AA.. ..A....G.A.............. ....A.A... .......G....    
                    36 >A/Ontario/315107,2009/11/04         ...................A...A.........A ....................................... A..C.A................................ ..........A.A.....A.......T....GC .GA........G.AA.. ..A....G.A.............. ....A.A... .......G....    
                    37 >A/Ontario/314095,2009/11/02         .......................A.........A ........................G.............. A...C....................A............ ..........A.A.....A.....G.T.T..GC .GA.......A..AA.. T.A....G.A....A.....A... ....A.A... ....C.TG....    
                    38 >A/Ontario/315637,2009/11/04         .................................A ........................G.............. ....C.....A..............A............ ..........A.A...........G.T.T.... ..A.......A..AA.. T.A....G.A....A.....A... ....A.A... ....C.TG....    
                    39 >A/Ontario/315613,2009/11/03         .................................A ........................GC............. ....C.....A..............A......A..... ..........A.A...........G.T.T.... ..A.......A..AA.. T.A....G.A....A.....A... ....A.A... ....C.TG....    
                    40 >A/Ontario/315187,2009/11/03         .................................A ........................GC............. ....C.....A..............A......A..... .....G....A.A...........G.T.T.... ..A.......A..AA.. T.A....G.A....A.....A... ....A.A... ....C.TG....    
                    41 >A/Ontario/308054,2009/10/28         .................................A .............G.....A....G.............. ....C.....A..............A......A..... ..........A.A...........G.T.T.... ..A.......A..AA.. T.A....G.A....A.....A... ....A.A... ....C.TG....    
                    42 >A/Ontario/305598,2009/10/27         .................................A .............G.....A....G.............. ....C.....A..............A............ ..........A.A...........G.T.T.... ..A.......A..AA.. T.A....G.A....A.....A... ....A.A... ....C.TG....    
                    43 >A/Ontario/315047,2009/11/02         .................................A ........................G.............. ....C.....A..............A............ ..........A.A...........G.T.T.... ..A.......A..AA.. T.A....G.A....A.....A... ....A.A... ....C.TG....    
                    44 >A/Ontario/305139,2009/10/27         .................................A ........................G.............. ....C.....A..............A............ ..........A.A...........G.T.T.... ..A.......A..AA.. T.A....G.A....A.....A... ....A.A... ....C.TG....    
                    45 >A/Ontario/304434,2009/10/24         .....C...........................A ........................G.............. ....C.....A..............A............ ..........A.A...........G.T.T.... ..A.......A..AA.. T.A....G.A....A.....A... ....A.A... A...C.TG....    
                    46 >A/Ontario/315015,2009/11/04         .................................A ........................G.............. ....C.....A..............A............ ..........A.A...........G.T.T.... ..A.......A..AA.. T.A....G.A....A.....A... ....A.A... ....C.TG....    
                    47 >A/Ontario/313762,2009/10/30         .................................A ........................G.............. ....C.....A..............A............ ..........A.A...........G.T.T.... ..A.......A..AA.. T.A...GG.A....A.....A... ....A.A... ....C.TG....    
                  
                  ----------england virus ----------
                                                                                                                                                                                       e          e e   e
                    48 >A/Ontario/130741,2010/10/13         ......T......C.A.A...G..........AA .................T..........A......T... ..T.....A........CA................A.. .........CAA.......C.A...AT...... ..A..........AAG. T.A...GG.A....A.....A... ..A.ATA... ...T...GC...    
                    49 >A/Ontario/720545,2010/11/17         ......T......C.A.A...G..........AA .................T..........A......T... ..T.....A........CA................A.. .........CA........C.A...AT...... ..A..........AAG. ..A....G......A......... ..A.A.A... ...T...GC...    
                  
                  ----------2010--------------
                    18 >A/Ontario/804635,2010/12/14         GAT.A....A....G.T.A...A..A..G.CT.A CGA..G...AA.G.A.A...G..T.....T....T.... .G......TT....A.C...T..AA.G.T....AC..C ...A..A.C.A.....T...G.....TT..... T.A.G...TT...AA.. ..A.TA.G..G....CAA...G.. .T.AAAA.C. .CA....G....    
                    19 >A/Ontario/778873,2010//             GAT.A....A....G.T.A...A..A..G.CT.A CGA..G...AA.G.A.A...G..T.....T....T.... .G......TT....A.C...T..AA.G.T....AC..C ...A..A.C.A.....T...G.....TT..... T.A.G...TT...AA.. ..A.TA.G..G....CAA...G.. .T.AAAA.C. .CA....G....    
                    20 >A/Ontario/741328,2010/11/23         G...A...AA..A.....A...A.AA..G..T.A ---..G..AA.T..A...G.G.GT.....T.AA.T...T .G....A.....A.AC.....T.AA..T...A.AC..C .G.AC.ACC.A..GT.....G.....TT.A... --A...T..T...AA.. ..A....G..G..G...A.T.GT. ...AA.AA.. .CA..T.G....    
                    21 >A/Ontario/3620,2010/11/24           G...A...AA..A.....A...A.AA..G..T.A .G...G..AA.T..A...G.G.GT.....T.AA.T...T .G....A.....A.AC.....T.AA..T...A.AC..C .G.AC.ACC.A..GT.....G.....TT.A... ..A...T..T...AA.. ..A....G..G..G...A.T.GT. ...AA.AA.. .CA..T.G....    
                                                                                                                                                                                                                                                   
                                                     
                  ---Index----------------------------------AGCGGTCTGGACGTAGCGGCAAGGGGACATTCGG TAGGAACAGGGCATGAGCACAAACATTTCCCTGGCCATC GACTTGGTGCGCGGGTTTCACCTCCGACCGGGGGTGAT AACGTAGTTGTGTAGTCGGTAGAAAGCCCGGAT CAGGATCCACGACGGAC CTGGCGTACGAAGACTTGGCGACC CCGGGCGCTT CGTCTCCATCAG    
                  -codon-position---------------------------       1 11 2  11   1 11 1   1              2 1   221  1    12  2  11    1  1   1       2     2   2 1          2  1211    1212         12 221   21    11   1        1 2 1  2211 2 2   21        11  1 11  111 1  1 2 1    
                                                            0000000000000011111111111111111122 000000000000000111111111111111222222222 00000000000000000001111111111111111122 000000000000000000111111111111111 00000000000001111 000000000000111111111111 0000000000 000000000000    
                                                            1335666677888900011234555667899901 001224446666679001223334477889011111222 00011235677778888890013346677778899901 001445555666779999001122344455566 00234457999991233 033356678899011111122233 0123456778 012223334467    
                                                            1094336916589503547084356378001696 136031660335629588050072626195704589145 58909625601280122764640431113391478820 044591359056120023053757900606799 67905813044674428 401565642734000268968902 4333940260 461693661562    
                                                            7306396413686750493316123945667813 202441283262003826643545760865633540117 18958872384096925339295372734712870646 475126158585790610561162438493705 62816096328623891 736419823385117860467026 5689210704 937459074234
                  I'm interested in expert panflu damage estimates
                  my current links: http://bit.ly/hFI7H ILI-charts: http://bit.ly/CcRgT

                  Comment


                  • Re: Sequences at Genbank!

                    update with new Thailand sequences:



                    Code:
                                                               00000001111111111111112222 000000000001111111111122222 0000000000001111111111122 00000000000000000000000000000000000000000000011111111111111111111 0000001111 00000000000000000000000000111111111111 000000000000 00000000000000 
                                                               16677890001145566788990111 013446666991123333489911112 0033456788890134477899911 00011111223333334444455555566666666677789999900011223334444445566 2599990123 01111223333333456777777789011111112223 023334566679 11222233344777 
                                                               13616953464743636109679116 336190335998900037290504895 8923606812762442317178801 14645688023344692357913567900345568912980233425837077890033466655 9134685442 33356381127788163112247923900133894690 833339102721 06166736615134 
                                                               73613670409361395069891253 056173022396163454565533407 8976273992337938736270665 67345345722308094218261589857007857079300103506011654673847943636 8902379389 71575545678901769140121028817614048602 783692001576 83748997842975 
                    -codon-position----------------------------    12 1 1   1 1     2         2  21  1  12     2 1  1 1           1 2           12  2112  2 1   1 11    1 121 1 12    11         1    221         1          12 1 12 1  12  2    11 1 2      1       1        11  11 1  12 2221 
                    ---Index-----------------------------------AGCGGGTGCAGGAGGGGGATCAGTCG AAAATGAGCGCCAAATCACCACTGCCC ACGCGAGGGTTCGCCCCCTGGTGTT GATCAAAGGTATGGGAACGATAGTGATGGGGGTGGATACAGCGTCTTGAGGTTATGCACACGGTC GCCCCGTGGA GAGGTTGTGTCTTGGAATCTGAAGTATACGGCGGTCAC AGGCGGTGTCCT CGTCCGCATTCAGG 
                       1 >A/******/index/2009/02/01            .......................... ........................... ......................... ................................................................. .......... ...................................... ............ ..............        0      0 ,      0      0       1:>A/******/index/2009/02/01            
                                                                                                                                                                           e                  e  e     e
                       2 >A/Singapore/SS012/2010/05/           -------------------------- --------------------------- ------------------------- --------------------------......A................A......T..G..... ---------- ........A............G................ ------------ --------------      410    146 ,      7      6       2:>A/Singapore/SS012/2010/05/           
                      62 >A/Denmark/116/2010/12/14             -------------------------- --------------------------- ------------------------- --.......C......G...............A................A......T..G..... ---------- -------------------------------------- ------------ --------------      447    160 ,      7      6      62:>A/Denmark/116/2010/12/14             
                      56 >A/Denmark/108/2010/12/10             -------------------------- --------------------------- ------------------------- -........C......G............R..A................A......T..G..... ---------- -------------------------------------- ------------ --------------      445    160 ,      8      7      56:>A/Denmark/108/2010/12/10             
                       4 >A/Parana/881/2010/05/17              -------------------------- --------------------------- ------------------------- ---.G.G......................R..A..G......A......A......TG....... ---------- -------------------------------------- ------------ --------------      450    164 ,     10      9       4:>A/Parana/881/2010/05/17              
                       3 >A/Parana/937/2010/05/11              -------------------------- --------------------------- ------------------------- ....G.G.........................A..G......A......A......TG.....-- ---------- -------------------------------------- ------------ --------------      448    162 ,     12      8       3:>A/Parana/937/2010/05/11              
                      71 >A/Denmark/127/2010/12/22             -------------------------- --------------------------- ------------------------- --..........AA..................AA...............A......T........ ---------- -------------------------------------- ------------ --------------      452    160 ,     13      6      71:>A/Denmark/127/2010/12/22             
                      80 >A/Tunisia/197/2011(H1N1/01/04        -------------------------- --------------------------- ------------------------- ................................A..............A.A......T........ ---------- -------------------------------------- ------------ --------------      448    156 ,     15      4      80:>A/Tunisia/197/2011(H1N1/01/04        
                       5 >A/Singapore/GP2362/2010/05/18        -------------------------- --------------------------- ------------------------- ..............A.G...............A................A......T........ ---------- ........A......G..T..G................ ------------ --------------      340    123 ,     13      9       5:>A/Singapore/GP2362/2010/05/18        
                       7 >A/swine/IL/25399-3/2010/05/18        -------------------------- --------------------------- ------------------------- ............................A...A................A......T.....A.. ---------- A...C.A.A....T.......G.A.........A.... .....A.A.... --------------      318    117 ,     22     15       7:>A/swine/IL/25399-3/2010/05/18        
                       6 >A/swine/IL/25399-2/2010/05/18        -------------------------- --------------------------- ------------------------- ...............................AA.....T..........A......T.....A.. ---------- A...C.A.A....T.......G.A.........A.... ..AA.A.A.T.. --------------      316    121 ,     20     19       6:>A/swine/IL/25399-2/2010/05/18        
                       8 >A/swine/IL/25399-4/2010/05/18        -------------------------- --------------------------- ------------------------- ...............................AA.....T..........A......T.....A.. ---------- A...C.ACA....T.......G.A.........A.... ..AA.A.A.T.. --------------      319    122 ,     23     20       8:>A/swine/IL/25399-4/2010/05/18        
                    
                                                               00000001111111111111112222 000000000001111111111122222 0000000000001111111111122 00000000000000000000000000000000000000000000011111111111111111111 0000001111 00000000000000000000000000111111111111 000000000000 00000000000000 
                                                               16677890001145566788990111 013446666991123333489911112 0033456788890134477899911 00011111223333334444455555566666666677789999900011223334444445566 2599990123 01111223333333456777777789011111112223 023334566679 11222233344777 
                                                               13616953464743636109679116 336190335998900037290504895 8923606812762442317178801 14645688023344692357913567900345568912980233425837077890033466655 9134685442 33356381127788163112247923900133894690 833339102721 06166736615134 
                                                               73613670409361395069891253 056173022396163454565533407 8976273992337938736270665 67345345722308094218261589857007857079300103506011654673847943636 8902379389 71575545678901769140121028817614048602 783692001576 83748997842975 
                    ---Index-----------------------------------AGCGGGTGCAGGAGGGGGATCAGTCG AAAATGAGCGCCAAATCACCACTGCCC ACGCGAGGGTTCGCCCCCTGGTGTT GATCAAAGGTATGGGAACGATAGTGATGGGGGTGGATACAGCGTCTTGAGGTTATGCACACGGTC GCCCCGTGGA GAGGTTGTGTCTTGGAATCTGAAGTATACGGCGGTCAC AGGCGGTGTCCT CGTCCGCATTCAGG 
                    
                      46 >A/Denmark/104/2010/11/17             -------------------------- --------------------------- ------------------------- --..............................A.............C..A.....AT........ ---------- .....C..AC.........CAG---------------- ------------ --------------      394    143 ,     13     11      46:>A/Denmark/104/2010/11/17             
                      44 >A/Ontario/130741/2010/10/13          ..T...CA.TA.G.........A..A ...........T....T..A.....T. .T....A...CA..........A.. ...........................C....AA............C..A.....AT........ A......AAG ........A............G......A......... .A...A.A.... ...T...G.C....       70     37 ,     70     37      44:>A/Ontario/130741/2010/10/13          
                      43 >A/Moscow/IIV-33/2010/10/13           ..T...CATTA.G...A.....A..A ..G...G...TTG......AG....T. .T.T.GA...CAA..T..C...A.C ...........................C..A.A.............C..A.....AT.T.....T A.T.TA.AAG .G......A..........CAG......A.A....... .A...A.A...C ...TA..G.C....       78     60 ,     78     60      43:>A/Moscow/IIV-33/2010/10/13           
                      47 >A/Ontario/720545/2010/11/17          ..T...CAT.A.G...A.....A..A ..G...G...TTG..C...AG....T. .T.T.GA...CAA..T..C...A.C ...T.......................C..A.A.............C..A.....AT.T.....T A.T.TACAAG .G......A..........CAG......A.A....... GA...A.A.... ...TA..G.C....       85     62 ,     85     62      47:>A/Ontario/720545/2010/11/17          
                      66 >A/Tehran/5675/2010/12/18             -------------------------- --------------------------- ------------------------- ...T.......................C..A.A.............C..A.....AT.T.....T ---------- ........A.A........CAG....C.A.A....... ------------ --------------      346    132 ,     19     18      66:>A/Tehran/5675/2010/12/18             
                      50 >A/Vladivistok/7/2010/12/03           ..T...CATTA.G...A.....A..A ..G...G...TTG..CT..AG....T. .T.TAGA...CAA..T..C...A.C ...T...............G.......C..A.A.A...........C..A.....AT.T.....T A.T.TACAAG .G......A..........CAG......A.A....... .A...A.A.... ...TA..G.C....       80     66 ,     80     66      50:>A/Vladivistok/7/2010/12/03           
                      52 >A/Karaj/5327/2010/12/06              -------------------------- --------------------------- ------------------------- ...T...............G.......C..A.A.............C..A.....AT.T.....T ---------- .GA.....A.A........CAG....C.A.A....... ------------ --------------      348    135 ,     21     21      52:>A/Karaj/5327/2010/12/06              
                      82 >A/Ulaanbaatar/190/2011/01/11         ..T...CATTA.G...A.....A..A .GG...G...TTG..C...AG....T. .T.TAGA...CAA..T..C...A.C ...T.............T.G.......C..A.A.............C..A.....AT.T.....T A.T.TACAAG .G......A...C.A....CAG......A.A....... .A...A.A.... ...TA..G.C....       87     68 ,     87     68      82:>A/Ulaanbaatar/190/2011(H1N1/01/11    
                      55 >A/Denmark/107/2010/12/10             -------------------------- --------------------------- ------------------------- --.T...............G.......C..A.A.............C..A.....AT.T...... ---------- -------------------------------------- ------------ --------------      453    164 ,     13     10      55:>A/Denmark/107/2010/12/10             
                      63 >A/Karaj/5718/2010/12/14              -------------------------- --------------------------- ------------------------- ...T.......C.......G.......C..A.A.............C..A.....AT.T...... ---------- .GA.....A.A........CAG....C.A.A....... ------------ --------------      348    135 ,     21     21      63:>A/Karaj/5718/2010/12/14              
                      70 >A/Karaj/5685/2010/12/21              -------------------------- --------------------------- ------------------------- ...T...............G.......C..A.A.............C..A.....AT.T...... ---------- .GA.....A.A........CAG....C.A.A....... ------------ --------------      349    134 ,     22     20      70:>A/Karaj/5685/2010/12/21              
                      79 >A/Hangzhou/1/2011/01/04              -------------------------- --------------------------- ------------------------- ...T...............G.......C..A.A.............C..A.....AT.T....-- ---------- -G......A..........CAG......A.AT...... ------------ --------------      357    135 ,     21     18      79:>A/Hangzhou/1/2011(H1N1/01/04         
                      61 >A/Denmark/115/2010/12/14             -------------------------- --------------------------- ------------------------- -...........A............G.C....A...........T.C..A...G.AT........ ---------- -------------------------------------- ------------ --------------      447    163 ,     10     10      61:>A/Denmark/115/2010/12/14             
                      65 >A/Denmark/113/2010/12/15             -------------------------- --------------------------- ------------------------- --..........A............G.C....A...........T.C..A...G.AT........ ---------- -------------------------------------- ------------ --------------      450    164 ,     10     10      65:>A/Denmark/113/2010/12/15             
                      73 >A/Denmark/133/2010/12/25             -------------------------- --------------------------- ------------------------- --..........A............G.C....A...........T.C..A...G.AT........ ---------- -------------------------------------- ------------ --------------      450    164 ,     10     10      73:>A/Denmark/133/2010/12/25             
                      75 >A/Denmark/137/2010/12/26             -------------------------- --------------------------- ------------------------- --..........A............G.C....A...........T.C..A...G.AT........ ---------- ........A..........CAG......A.A...C... ------------ --------------      351    133 ,     18     17      75:>A/Denmark/137/2010/12/26             
                      78 >A/Denmark/134/2010/12/27             -------------------------- --------------------------- ------------------------- --..........A............G.C....A...........T.C..A...G.AT........ ---------- -------------------------------------- ------------ --------------      450    164 ,     10     10      78:>A/Denmark/134/2010/12/27             
                      57 >A/Denmark/109/2010/12/10             -------------------------- --------------------------- ------------------------- --C.........A..............C....A.............C..A.....AT......C. ---------- -------------------------------------- ------------ --------------      449    163 ,      9      9      57:>A/Denmark/109/2010/12/10             
                      69 >A/Denmark/130/2010/12/21             -------------------------- --------------------------- ------------------------- --C.........A..............C....A.............C..A.....AT......C. ---------- ........A.......G..CAG......AAA...C... ------------ --------------      353    134 ,     20     18      69:>A/Denmark/130/2010/12/21             
                      76 >A/Denmark/131/2010/12/27             -------------------------- --------------------------- ------------------------- -.C.........A..............C....A.............C..A.....AT......C. ---------- ........A.......G..CAG......AAA...C... ------------ --------------      354    133 ,     22     18      76:>A/Denmark/131/2010/12/27             
                      60 >A/Denmark/114/2010/12/14             -------------------------- --------------------------- ------------------------- -...........A..............C....A.............C..A.....AT......C. ---------- -------------------------------------- ------------ --------------      447    161 ,     10      8      60:>A/Denmark/114/2010/12/14             
                      74 >A/Denmark/129/2010/12/26             -------------------------- --------------------------- ------------------------- -...........A..............C....A.............C..A.....AT......C. ---------- ........A..........CAG......A.A...C... ------------ --------------      350    130 ,     19     15      74:>A/Denmark/129/2010/12/26             
                      67 >A/Denmark/125/2010/12/21             -------------------------- --------------------------- ------------------------- -.......A..................C....A.............C..A.....AT......-- ---------- ........A..........CAG......A.A....... ------------ --------------      348    130 ,     14     13      67:>A/Denmark/125/2010/12/21             
                      77 >A/Denmark/132/2010/12/27             -------------------------- --------------------------- ------------------------- -.......A..................C....A.............C..A.....AT......-- ---------- .....C..AC.........CAG......A.A....... ------------ --------------      351    132 ,     17     15      77:>A/Denmark/132/2010/12/27             
                    
                       9 >A/swine/IL/27486-1/2010/06/02        -------------------------- --------------------------- ------------------------- T......A.......G................A.....................C.T........ ---------- ........A..CA......................... .....A.A.... --------------      309    113 ,     13     11       9:>A/swine/IL/27486-1/2010/06/02        
                      10 >A/swine/IL/27486-2/2010/06/02        -------------------------- --------------------------- ------------------------- T......A.......G.....G..........A.A.....A.............C.T........ ---------- ........A..CA........G................ .....A.A.... --------------      314    117 ,     18     15      10:>A/swine/IL/27486-2/2010/06/02        
                      11 >A/Kenya/029/2010/06/16               -------------------------- --------------------------- ------------------------- .....................G..........A.................--------------- ---------- -------------------------------------- ------------ --------------      474    169 ,      6      2      11:>A/Kenya/029/2010/06/16               
                      12 >A/Thailand/CU-H2079/2010/07/07       ----------------...C.G.CTA ....A---------------------- ------------------------- ----------....A.G...............A.............------------------- ---------- ----....A......G..T..G...------------- .....ACA.... .....A.G....A.      356    138 ,     21     19      12:>A/Thailand/CU-H2079/2010/07/07       
                      13 >A/Thailand/CU-H2085/2010/07/07       ----------------...C.G.CTA ....A---------------------- ------------------------- ---------.....A.G...............A.............------------------- ---------- -.......A.....AG..T..G...------------- .....ACA.... .....A.G......      341    134 ,     21     19      13:>A/Thailand/CU-H2085/2010/07/07       
                      14 >A/Thailand/34-9912/2010/07/14        -------------------------- --------------------------- ------------------------- ---------------............C..A.A......-------------------------- ---------- -------------------------------------- ------------ --------------      560    196 ,      3      3      14:>A/Thailand/34-9912/2010/07/14        
                      15 >A/Thailand/34-9913/2010/07/14        -------------------------- --------------------------- ------------------------- ------------------------........A......-------------------------- ---------- -------------------------------------- ------------ --------------      584    203 ,      2      1      15:>A/Thailand/34-9913/2010/07/14        
                      16 >A/Thailand/34-9936/2010/07/14        -------------------------- --------------------------- ------------------------- ---------------.G...............A......-------------------------- ---------- -------------------------------------- ------------ --------------      560    195 ,      3      2      16:>A/Thailand/34-9936/2010/07/14        
                      17 >A/Thailand/34-9937/2010/07/14        -------------------------- --------------------------- ------------------------- ---------------............C....A......-------------------------- ---------- -------------------------------------- ------------ --------------      561    195 ,      3      2      17:>A/Thailand/34-9937/2010/07/14        
                      18 >A/Thailand/34-9943/2010/07/14        -------------------------- --------------------------- ------------------------- ---------------.................A......-------------------------- ---------- -------------------------------------- ------------ --------------      559    194 ,      2      1      18:>A/Thailand/34-9943/2010/07/14        
                      19 >A/Thailand/CU-C1005/2010/07/22       ---------------..........A ....----------------------- ------------------------- ---..G.......A..........A.......A......G.......------------------ ---------- ---A....A............GG..------------- .....A.AC... .......G...G..      319    125 ,     15     15      19:>A/Thailand/CU-C1005/2010/07/22       
                      20 >A/Thailand/CU-C1006/2010/07/22       ---------------..........A ....----------------------- ------------------------- ------------------------------..A...A..G.......------------------ ---------- -.......A............GG..------------- .....A.AC..- .......G...G..      385    148 ,     12     12      20:>A/Thailand/CU-C1006/2010/07/22       
                      21 >A/Thailand/CU-C1025/2010/07/29       ---------------..........A ....----------------------- ------------------------- -------------------------.......A...A..G......------------------- ---------- -.......A............GG..------------- .....A.AC..- .......G...G..      377    144 ,     15     12      21:>A/Thailand/CU-C1025/2010/07/29       
                      22 >A/Thailand/CU-C1028/2010/08/05       ---------------..........A ....----------------------- ------------------------- ---..G.......A..........A.......A......G......------------------- ---------- ------..A............GG..------------- .....A.AC..- T..TA..G.GG...      342    133 ,     33     18      22:>A/Thailand/CU-C1028/2010/08/05       
                      23 >A/Thailand/CU-C1070/2010/08/18       ---------------.AA....A..A ..G.----------------------- ------------------------- -----------------------....C..A.A...A.........------------------- ---------- -G......A..........CAG...------------- .A...A.A...- .......G..AG..      389    150 ,     26     20      23:>A/Thailand/CU-C1070/2010/08/18       
                      24 >A/Thailand/CU-H2216/2010/08/21       ----------------A.....A..A ..G.A---------------------- ------------------------- -..T...............G.......C..A.A.............------------------- ---------- -------.A..........CAG...------------- .A...A.A.... ...TA..G.C....      335    134 ,     25     21      24:>A/Thailand/CU-H2216/2010/08/21       
                      25 >A/Thailand/CU-C1099/2010/08/25       ---------------.AA....A..A ..G.----------------------- ------------------------- ---T.......................C..A.A.............------------------- ---------- -----...A..........CAG...------------- .A...A.A...- T..TA..G..A...      340    135 ,     31     21      25:>A/Thailand/CU-C1099/2010/08/25       
                      26 >A/Thailand/CU-C1119/2010/09/01       ----------------......A..A ....----------------------- ------------------------- ----------.................C....A.............------------------- ---------- -----...A..........CAG...------------- .A...A.A...- ...T...G.C...A      354    137 ,     16     15      26:>A/Thailand/CU-C1119/2010/09/01       
                      27 >A/swine/Taiwan/TD-2542/2010/09/01    .........................A .G......................... ......T.................. .................T..............A..................C....T........ A......AA. ........A....A.......G................ .....A.A.... .......G......       83     16 ,     83     16      27:>A/swine/Taiwan/TD-2542/2010/09/01    
                      28 >A/Thailand/CU-H2293/2010/09/02       ---------------....C.G.CTA ....----------------------- ------------------------- ------........A.G...............A.............------------------- ---------- -----...A......G..T..G...------------- .....ACA...- .....A.G....A.      339    135 ,     19     18      28:>A/Thailand/CU-H2293/2010/09/02       
                      29 >A/Thailand/CU-H2295/2010/09/02       ---------------A..G.T....A G..G----------------------- ------------------------- ---------.........A...A...C.....A.............------------------- ---------- ----....A............G...------------- ....AA.A...- .CA....G......      349    137 ,     22     18      29:>A/Thailand/CU-H2295/2010/09/02       
                      30 >A/Thailand/CU-H2301/2010/09/02       ---------------...G.T....A G...----------------------- ------------------------- ----------........A.......C.....A.............------------------- ---------- -----...A............G...------------- G...AA.A.... .C.....GC.....      355    136 ,     28     16      30:>A/Thailand/CU-H2301/2010/09/02       
                      31 >A/Thailand/CU-C1151/2010/09/07       ----------------......AC.A ....----------------------- ------------------------- --------..T................C....A.............------------------- ---------- ----------.........CAG...------------- .A...A.A...- ...T...GC....A      360    141 ,     19     16      31:>A/Thailand/CU-C1151/2010/09/07       
                      32 >A/Thailand/CU-C1157/2010/09/07       ---------------.A.....A..- ..G.----------------------- ------------------------- ----.......................C..A.A.............------------------- ---------- -----...A..........CAG...------------- .A...A.A...- T..TA..G.C....      342    134 ,     20     18      32:>A/Thailand/CU-C1157/2010/09/07       
                      33 >A/Thailand/CU-H2359/2010/09/09       ---------------.A.....A..A ..G.----------------------- ------------------------- ---------------............C..A.A.............------------------- ---------- ------..A..........CAG...------------- .A...A.A.... ...TA..G.C....      366    144 ,     21     18      33:>A/Thailand/CU-H2359/2010/09/09       
                      34 >A/Thailand/CU-H2364/2010/09/09       ---------------.A.....---- ..G.----------------------- ------------------------- ---------------....G.......C..A.A.............------------------- ---------- ------..A..........CAG...------------- .A...A.A.... ...TA..G.C....      374    147 ,     20     17      34:>A/Thailand/CU-H2364/2010/09/09       
                      35 >A/Thailand/CU-C1192/2010/09/15       ---------------.......A..A ....A---------------------- ------------------------- ---.......T................C....A.............------------------- ---------- -.......A..........CAG...------------- .A...A.A.... ...T...G.C...A      317    125 ,     18     17      35:>A/Thailand/CU-C1192/2010/09/15       
                      36 >A/Thailand/SN_0112_2/2010/10/        -------------------------- --------------------------- ------------------------- ---------------...A.......C.....A.....--------------------------- ---------- -------------------------------------- ------------ --------------      564    197 ,      4      3      36:>A/Thailand/SN_0112_2/2010/10/        
                      37 >A/Thailand/SN_0116/2010/10/          -------------------------- --------------------------- ------------------------- ----------------...........C..A.A.....--------------------------- ---------- -------------------------------------- ------------ --------------      569    198 ,      5      3      37:>A/Thailand/SN_0116/2010/10/          
                      38 >A/Thailand/ST_0111/2010/10/          -------------------------- --------------------------- ------------------------- ----------------..A.......C.....A-------------------------------- ---------- -------------------------------------- ------------ --------------      582    203 ,      3      3      38:>A/Thailand/ST_0111/2010/10/          
                      39 >A/Thailand/ST_0112_1/2010/10/        -------------------------- --------------------------- ------------------------- ---------------...A.......C.....A...----------------------------- ---------- -------------------------------------- ------------ --------------      569    199 ,      3      3      39:>A/Thailand/ST_0112_1/2010/10/        
                      40 >A/Thailand/ST_0113/2010/10/          -------------------------- --------------------------- ------------------------- ----------------..A.......C.....A........------------------------ ---------- -------------------------------------- ------------ --------------      547    195 ,      3      3      40:>A/Thailand/ST_0113/2010/10/          
                      41 >A/Thailand/ST_0153/2010/10/          -------------------------- --------------------------- ------------------------- ----------------..A.......C.....A...----------------------------- ---------- -------------------------------------- ------------ --------------      577    200 ,      3      3      41:>A/Thailand/ST_0153/2010/10/          
                      42 >A/Bandar Abbas/5096/2010/10/02       -------------------------- --------------------------- ------------------------- ..................A.......C.....A.......................T...T.... ---------- -------------------------------------- ------------ --------------      442    157 ,      9      5      42:>A/Bandar Abbas/5096/2010/10/02       
                      45 >A/swine/Minnesota/54354/2010/10/27   -------------------------- --------------------------- ------------------------- T..........C...G................A.......................T........ ---------- ...A....A..C...................T...... .....A.A...C --------------      326    114 ,     30     12      45:>A/swine/Minnesota/54354/2010/10/27   
                      48 >A/Ontario/741328/2010/11/23          GA.AAA.....A.AAA..G.T....A --.G.A.ATA...GG..GT..TAAT.T G.A....AAC...TA.AT.AAC.C. .G................A.C.AC..C.....A....G..T.......G.......T...TA... AT.T...AA. ........A............G...G.G....A..TGT ....AA.A..A. .CA...TG......       85     75 ,     75     73      48:>A/Ontario/741328/2010/11/23          
                      49 >A/Ontario/3620/2010/11/24            GA.AAA.....A.AAA..G.T....A G..G.A.ATA...GG..GT..TAAT.T G.A....AAC...TA.AT.AAC.C. .G................A.C.AC..C.....A....G..T.......G.......T...TA... AT.T...AA. ........A............G...G.G....A..TGT ....AA.A..A. .CA...TG......       75     74 ,     75     74      49:>A/Ontario/3620/2010/11/24            
                      51 >A/Denmark/106/2010/12/04             -------------------------- --------------------------- ------------------------- ----------------------------------------------------------------- ---------- ........A..........CAG......A.A...C... ------------ --------------      517    186 ,      8      7      51:>A/Denmark/106/2010/12/04             
                      53 >A/Shahriar/5336/2010/12/06           -------------------------- --------------------------- ------------------------- ..................A.......C.....A..........C.C....ACG...T...T.... ---------- .......CA........A...G..C....A..A..... ------------ --------------      347    131 ,     20     17      53:>A/Shahriar/5336/2010/12/06           
                      54 >A/Denmark/111/2010/12/07             -------------------------- --------------------------- ------------------------- --..........................A...A..............A........T..G...-- ---------- -------------------------------------- ------------ --------------      456    161 ,     14      5      54:>A/Denmark/111/2010/12/07             
                      58 >A/Denmark/110/2010/12/10             -------------------------- --------------------------- ------------------------- ----------------------------------------------------------------- ---------- .G......A........A.CAG......A.A....... ------------ --------------      520    187 ,     10      8      58:>A/Denmark/110/2010/12/10             
                      59 >A/Karaj/5660/2010/12/13              -------------------------- --------------------------- ------------------------- ..................A.......C.....A..........C.C....A.G...T...T.... ---------- ........A............G..C.......A..... ------------ --------------      348    127 ,     21     13      59:>A/Karaj/5660/2010/12/13              
                      64 >A/Ontario/804635/2010/12/14          GA..A......A.A.A..G.T....A G..G...A.A....G...T..T..T.. G.....T.A.....A.A...AC.C. ..................A...A...C.....A........T......G.......T...T.... A..T...AA. ........A............G...G......A...G. ....AA.A.... .CA....G......       77     48 ,     77     48      64:>A/Ontario/804635/2010/12/14          
                      68 >A/Denmark/126/2010/12/21             -------------------------- --------------------------- ------------------------- ----------------------------------------------------------------- ---------- .....C..AC.........CAG......A.A....... ------------ --------------      517    187 ,      8      8      68:>A/Denmark/126/2010/12/21             
                      72 >A/Denmark/123/2010/12/23             -------------------------- --------------------------- ------------------------- ----------------------------------------------------------------- ---------- ........A..........CAG......A.A...C... ------------ --------------      516    186 ,      7      7      72:>A/Denmark/123/2010/12/23             
                      81 >A/Tunisia/422/2011(H1N1/01/07        -------------------------- --------------------------- ------------------------- ..................A...A...C.....A........T......G.......T...T.... ---------- -------------------------------------- ------------ --------------      442    160 ,      9      8      81:>A/Tunisia/422/2011(H1N1/01/07        
                                                                                                                                                                                                                                                                                                
                    ---Index-----------------------------------AGCGGGTGCAGGAGGGGGATCAGTCG AAAATGAGCGCCAAATCACCACTGCCC ACGCGAGGGTTCGCCCCCTGGTGTT GATCAAAGGTATGGGAACGATAGTGATGGGGGTGGATACAGCGTCTTGAGGTTATGCACACGGTC GCCCCGTGGA GAGGTTGTGTCTTGGAATCTGAAGTATACGGCGGTCAC AGGCGGTGTCCT CGTCCGCATTCAGG 
                    -codon-position----------------------------    12 1 1   1 1     2         2  21  1  12     2 1  1 1           1 2           12  2112  2 1   1 11    1 121 1 12    11         1    221         1          12 1 12 1  12  2    11 1 2      1       1        11  11 1  12 2221 
                                                               00000001111111111111112222 000000000001111111111122222 0000000000001111111111122 00000000000000000000000000000000000000000000011111111111111111111 0000001111 00000000000000000000000000111111111111 000000000000 00000000000000 
                                                               16677890001145566788990111 013446666991123333489911112 0033456788890134477899911 00011111223333334444455555566666666677789999900011223334444445566 2599990123 01111223333333456777777789011111112223 023334566679 11222233344777 
                                                               13616953464743636109679116 336190335998900037290504895 8923606812762442317178801 14645688023344692357913567900345568912980233425837077890033466655 9134685442 33356381127788163112247923900133894690 833339102721 06166736615134 
                                                               73613670409361395069891253 056173022396163454565533407 8976273992337938736270665 67345345722308094218261589857007857079300103506011654673847943636 8902379389 71575545678901769140121028817614048602 783692001576 83748997842975




                    already in Thailand, August/September 2010 were:

                    G1665A(1),G2091A(1)
                    A366G(2)
                    C144T(4),G605A(4),G640A(4)
                    T720C(6),G721A(6),C1107A(6),G1131A(6)
                    G238A(7)
                    C264T(8),T414C(8),C268A(8)
                    I'm interested in expert panflu damage estimates
                    my current links: http://bit.ly/hFI7H ILI-charts: http://bit.ly/CcRgT

                    Comment


                    • Re: Sequences at Genbank!

                      182 is out now
                      download finished , took ~1hour
                      3.87GB uncompressed , 1:45h
                      958086 virus records
                      154773/154788 of them influenza , 3:15h
                      768MB of flu-records, 134MB compressed




                      Originally posted by gsgs View Post
                      Close-of-data for the upcoming GenBank Release 181.0 occurred on
                      Tuesday December 14 2010, at approximately 1:30am EST.


                      ftp://ftp.ncbi.nih.gov/genbank/
                      ftp://ftp.ncbi.nih.gov/genbank/gbrel.txt
                      to be updated soon
                      --------updated now (2010/12/21)--------------



                      Uncompressed,the Release 181.0 flatfiles require roughly 468 GB (sequence files only)

                      Release Date Base Pairs Entries
                      180 Oct 2010 118551641086 125764384
                      181 Dec 2010 122082812719 129902276

                      BCT (bacterial and archeal) : 63 files (+3)
                      CON (constructed) : 143 files (+1)
                      ENV (Environmental Samples) : 33 files (+3)
                      EST (Expressed Sequence Tag) : 427 files (+5)
                      GSS (Genome Survey Sequence) : 224 files (+7)
                      INV (invertebrate) : 26 files (+1)
                      PAT (patent) : 138 files (+10)
                      PLN (plant) : 44 files (+1)
                      TSA (Transcriptome Shotgun Assembly) : 15 files (+3)
                      VRL (viral) : 16 files (+1)

                      files are copressed and contain ~300MB uncompressed

                      1. PRI - primate
                      2. ROD - rodent
                      3. MAM - other mammals
                      4. VRT - other vertebrate
                      5. INV - invertebrate
                      6. PLN - plant, fungal, and algal
                      7. BCT - bacterial
                      8. VRL - viral
                      9. PHG - bacteriophage
                      10. SYN - synthetic
                      11. UNA - unannotated
                      12. EST - expressed sequence tags)
                      13. PAT - patent sequences
                      14. STS - sequence tagged sites)
                      15. GSS - genome survey sequences)
                      16. HTG - high throughput genomic sequences)
                      17. HTC - high throughput cDNA sequences)
                      18. ENV - Environmental
                      19. CON - Constructed


                      ----------------------------

                      3.5B new base pairs, biggest increase since April 2007

                      158 Feb 2007 71292211453 67218344
                      159 Apr 2007 75742041056 71802595
                      160 Jun 2007 77248690945 73078143
                      161 Aug 2007 79525559650 76146236
                      162 Oct 2007 81563399765 77632813
                      163 Dec 2007 83874179730 80388382
                      164 Feb 2008 85759586764 82853685
                      165 Apr 2008 89172350468 85500730
                      166 Jun 2008 92008611867 88554578
                      167 Aug 2008 95033791652 92748599
                      168 Oct 2008 97381682336 96400790
                      169 Dec 2008 99116431942 98868465
                      170 Feb 2009 101467270308 101815678
                      171 Apr 2009 102980268709 103335421
                      172 Jun 2009 105277306080 106073709
                      173 Aug 2009 106533156756 108431692
                      174 Oct 2009 108560236506 110946879
                      175 Dec 2009 110118557163 112910950
                      176 Feb 2010 112326229652 116461672
                      177 Apr 2010 114348888771 119112251
                      178 Jun 2010 115624497715 120604423
                      179 Aug 2010 117476523128 122941883
                      180 Oct 2010 118551641086 125764384
                      181 Dec 2010 122082812719 129902276
                      182 Feb 2011 124277818310 132015054




                      I think I'm not updating my flu-database with this release 181
                      but rather wait until 182 or later
                      I'm interested in expert panflu damage estimates
                      my current links: http://bit.ly/hFI7H ILI-charts: http://bit.ly/CcRgT

                      Comment


                      • Re: Sequences at Genbank!

                        H3N2 from 2010,2011 , HA only


                        Code:
                                                                      00000000000000000000000000000000000000000000000000000000000000000000000000000111111111111111111111111111
                                                                      00001111111112222222223333344444444455555556666666666677777778888888888999999000000001111112233444555555
                                                                      14450123788990113368891222700133688911223560014456788912233792233337888135788001234550333892958057114467
                                                                      14558706126065361241918038525957803589282550952310212021956192803475267797334591327361017571637314385808
                        -codon-position-------------------------------22 1   1 2 111   1 21  221   2 2    2   1 1    1    1 11  1 1  22  2 122  12  1       2       12211     
                        ---Index--------------------------------------TTCCAAGAGGCAGGTTAGAGATCGATGGGGATATCTTAAACAACGTATACAAACAACAACCCAGGTGATGAAAGGACGCAGTCCGCTAAGGACTCAAGGAGCCA
                           1 >A/Denmark/105,2010/12/2                 .C..G.A......A.......CA..C........T...C...C..G...A..GT..T.G.T........AC......AA....A..GG..A.TC.....GA.AG
                           2 >A/Hawaii/AF2685,2010/09/2               ....G...A....A.......CA..C......G.T...C...C..G...A..GT..T.G...........C......AA....A.TGGG.A-------------
                           3 >A/Hawaii/AF2684,2010/09/1               ....G...A....A.......CA..C......G.T...C...C..G...A..GT..T.G...........C......AA....A.TGGG.A-------------
                           4 >A/South Carolina/AF2724,2011/01/1       ....G........A.......CA..C........T...C...C..G.G.A..GT..T.G....A......CG.....AA....ATTGG..A-------------
                           5 >A/Arizona/AF2697,2011/01/0              ....G....A...A.......CA..C........T...C...C..G.G.A..GT..T.G...........C......AA....AT.GG..A-------------
                           6 >A/Arizona/AF2689,2010/12/0              ....G....A...A.......CA..C........T...C...C..G.G.A..GT..T.G...........C......AA....AT.GG..A-------------
                           7 >A/Colorado/AF2701,2011/01/0             ....G........A.......CA..C........T...C...C..G.G.A..GT..T.G...........C......AA....AT.GG..A-------------
                           8 >A/Texas/AF2727,2010/12/2                ....G........A.......CA..C........T...C...C..G.G.A..GT..T.G...........C.....AAA....AT.GG..A-------------
                           9 >A/Texas/AF2726,2010/12/2                ....G........A.......CA..C........T...C...C..G.G.A..GT..T.G...........C.....AAA....AT.GG..A-------------
                          10 >A/Oklahoma/AF2722,2011/01/0             ....G........A.......CA..C........T...C...C..G.G.A..GT..T.G...........C.....TAA....AT.GG..A-------------
                          11 >A/Texas/AF2725,2010/12/2                ....G........A.......CA..C........T...C...C..G.G.A..GT..T.G...........C.....TAA....AT.GG..A-------------
                          12 >A/Oklahoma/AF2720,2010/12/2             ....G........A.......CA..CA.......T...C...C..G.G.A..GT..T.G...........C......AA....AT.GG..A-------------
                          13 >A/Ohio/AF2718,2010/12/3                 ....G........A.......CA..C........T...C...C..G.G.A..GT..T.G...........C......AA....AT.GG..A-------------
                          14 >A/Texas/AF2729,2011/01/0                ....G........A.C.....CAA.C........T...C...C..G.G.A..GT..T.G..T........C......AA...TAT.GG..A-------------
                          15 >A/Arizona/AF2696,2010/12/2              ....G........A.C.....CA..C........T...C...C..G.G.A..GT..T.G..T........C......AA...TAT.GG..A-------------
                          16 >A/Nevada/AF2714,2011/01/1               ....G........A.......CA..C........T...C...C..G.G.A..GT..T.G...........C......AA....AT.GG..A-------------
                          17 >A/Texas/AF2730,2011/01/1                ....G........A.......CA..C........T...C...C..G.G.A..GT..T.G...........C......AA....AT.GG..A-------------
                          18 >A/Florida/AF2705,2011/01/1              ....G........A.......CA..C........T...C...C..G.G.A..GT..T.G...........C......AA....AT.GG..A-------------
                          19 >A/Arizona/AF2698,2011/01/1              ....G........A.......CA..C........T...C...C..G.G.A..GT..T.G...........C......AA....AT.GG..A-------------
                          20 >A/California/AF2699,2011/01/1           ....G........A.......CA..C........T...C...C..G.G.A..GT.GT.G...........C......AA....AT.GG..A-------------
                          21 >A/Oklahoma/5386,2010/11/2               -...G........A.......CA..C........T...C...C..G.G.A.GGT.GT.G...........C......AA...----------------------
                          22 >A/Oklahoma/5342,2010/11/2               -...G........A.......CA..C........T...C...C..G.G.A.GGT.GT.G...........C......AA...----------------------
                          23 >A/Florida/AF2704,2010/12/1              ....G........A.......CA..C........T...C...C..G...A..GT..T.G..........AC......AA....A..GG..A-------------
                          24 >A/Nevada/AF2693,2010/11/0               ....G........A.......CA..C........T...C...C..G...A..GT..T.G...........C......AA....A..GG..A-------------
                          25 >A/Colorado/AF2700,2010/12/1             ....G........A.......CA..C........T...C...C..G...A..GT..T.G...........C......AA....A..GG..A-------------
                          26 >A/Oklahoma/AF2719,2010/10/1             ....G........A.......CA..C........T...C...C..G...A..GT..T.G...........C......AA....A..GG..A-------------
                          27 >A/Delaware/AF2703,2011/01/0             ....G........A.......CA..C........T...C...C..G...A..GT..T.G...........C......AA....A..GG..A-------------
                          28 >A/Oklahoma/AF2721,2011/01/0             ....G........A.......CA..C........T...C...C..G...A..GT..T.G...........C......AA....A..GG..A-------------
                          29 >A/Ulaanbaatar/3380,2010/11/0            ----------------------A..C........T...C...C..G...A..GT..T.G...........C......AA.------------------------
                          30 >A/South Carolina/AF2723,2011/01/0       .CT.G........A.......CA..C........T...C...C..G...A..GT..T.G...........C......AA....AA.GGG.A-------------
                          31 >A/Massachusetts/AF2713,2011/01/1        .CT.G........A.......CA..C........T...C...C..G...A..GT..T.G...........C......AA....AA.GGG.A-------------
                          32 >A/Alabama/AF2692,2010/12/1              .CT.G........A.......CA..C........T...C...C..G...A..GT..T.G...........C......AA....A..GGG.A.TC.....GA.AG
                          33 >A/Colorado/AF2702,2011/01/1             .CT.G........A.......CA..C........T...C...C..G...A..GT..T.G...........C......AA....A..GGG.A-------------
                          34 >A/Nevada/AF2715,2011/01/1               ....G........A.......CA..C........T...CG..C..G...A..GT..T.G...........C......AA....A..GG..A-------------
                          35 >A/Korea/AF2686,2010/10/0                ....G........A.......CA..C........T..GC...CT.G...A..GT..T.GT..........C......A.....A..GG..A-------------
                          36 >A/Alabama/AF2156,2010/07/1              ....G........A.......CA..C........T..GC...C..G...A..GT..T.GT..........C......A.....A..GG..A-------------
                          37 >A/Habana/14684,2010/08                  -------...............A...........T...C...C..G...A..G...T....................A...-----------------------
                          38 >A/Kenya/012,2010/05/2                   .........A............A...........T...C...C..G...A..G...T....................A.....A..G...A-------------
                          39 >A/Kenya/013,2010/05/2                   .........A............A...........T...C...C..G...A..G...T....................A.....A..G...A-------------
                          40 >A/Kenya/048,2010/07/0                   .........A............A...........T...C...C..G...A..G...T....................A.....A..G...A-------------
                          41 >A/Kenya/039,2010/06/2                   .........A............A...........T...C...C..G...A..G...T....................A.....A..G...A-------------
                          42 >A/Kenya/050,2010/07/0                   .........A............A...........T...C...C..G...A..G...T....................A.....A..G...A-------------
                          43 >A/Kenya/011,2010/05/2                   C........A............A...........T...C...C..G...A..G...T....................A.....A..G...A-------------
                          44 >A/Kenya/016,2010/05/2                   .........A............A...........T...C...C..G...A..G...T....................A.....A..G...A-------------
                          45 >A/Kenya/038,2010/06/2                   .........A............A...........T...C...C..G...A..G...T....................A.....A..G...A-------------
                          46 >A/Kenya/010,2010/05/1                   .........A............A...........T...C...C..G...A..G...T....................A.....A..G...A-------------
                          47 >A/Kenya/047,2010/07/0                   .........A............A...........T...C...C..G...A..G...T....................A.....A..G...A-------------
                          48 >A/Kenya/045,2010/06/2                   .........A............A...........T...C...C..G...A..G...T....................A.....A..G...A-------------
                          49 >A/Kenya/023,2010/06/0                   .........A............A...........T...C...C..G...A..G...T....................A.....A..G...A-------------
                          50 >A/Kenya/031,2010/06/2                   .........A............A...........T...C...C..G...A..G...T....................A.....A..G...A-------------
                          51 >A/Kenya/020,2010/06/0                   .........A............A...........T...C...C..G...A..G...T....................A.....A..G...A-------------
                          52 >A/Kenya/018,2010/05/2                   .........A............A...........T...C...C..G...A..G...T....................A.....A..G...A-------------
                          53 >A/Kenya/007,2010/05/1                   .........A............A...........T...C...C..G...A..G...T....................A.....A..G...A-------------
                          54 >A/Kenya/035,2010/06/2                   .........A............A...........T...C...C..G...A..G...T....................A.....A..G...A-------------
                          55 >A/Kenya/026,2010/06/1                   .........A............A...........T...C...C..G...A..G...T..............G.....A.....A..G...A-------------
                          56 >A/Kenya/006,2010/05/1                   .........A............A...........T...C...C..G...A..G...T....................A.....A..G...A-------------
                          57 >A/Kenya/042,2010/06/2                   .........A............A...........T...C...C..G...A..G...T....................A.....A..G...A-------------
                          58 >A/Kenya/040,2010/06/2                   .........A............A...........T...C...C..G...A..G...T....................A.....A..G...A-------------
                          59 >A/Kenya/022,2010/06/0                   .........A............A...........T...C...C..G...A..G...T....................A.....A..G...A-------------
                          60 >A/Kenya/033,2010/06/2                   .........A............A...........T...C...C..G...A..G...T....................A.....A..G...A-------------
                          61 >A/Kenya/003,2010/05/1                   .........A............A...........T...C...C..G...A..G...T....................A.....A..G...A-------------
                          62 >A/Kenya/005,2010/05/1                   .........A............A...........T...C...C..G...A..G...T....................A.....A..G...A-------------
                          63 >A/Kenya/030,2010/06/1                   .........A............A...........T...C...C..G...A..G...T....................A.....A..G...A-------------
                          64 >A/Kenya/041,2010/06/2                   .........A............A...........T...C...C..G...A..G...T....................A.....A..G...A-------------
                          65 >A/Kenya/019,2010/05/3                   ...A.....A............A...........T...C...C..G...A..G...T....................A.....A..G...A-------------
                          66 >A/Kenya/036,2010/06/2                   .........A............A...........T...C...C..G...A..G...T....................A.....A..G...A-------------
                          67 >A/Kenya/032,2010/06/2                   .........A............A...........T...C...C..G...A..G...T....................A.....A..G...A-------------
                          68 >A/Kenya/043,2010/06/2                   .........A............A...........TC..C...C..G...A..G..GT....................A.....A..G...A-------------
                          69 >A/Kenya/014,2010/05/2                   .........A............A...........TC..C...C..G...A..G...T....................A.....A..G...A-------------
                          70 >A/Kenya/037,2010/06/2                   .........A............A...........T...C...C..G...A..G...T....................A.....A..G...A-------------
                          71 >A/Kenya/028,2010/06/1                   .........A............A...........T...C...C..G...A..G...T....................A.....A..G...A-------------
                          72 >A/Kenya/024,2010/06/1                   .........A............A...........T...C...C..G...A..G...T....................A.....A..G...A-------------
                          73 >A/Kenya/021,2010/06/0                   .........A............A...........T...C...C..G...A..G...T....................A.....A..G...A-------------
                          74 >A/Texas/AF2728,2010/12/2                .........A............A...........T...C...C..G...A..G...T....................A.....A..G...A-------------
                          75 >A/Kenya/046,2010/07/0                   .........A............A...........T...C...C..G...A..G...T....................A.....A..G...A-------------
                          76 >A/Kenya/052,2010/07/0                   ........AA............A...A.......T...C...C..G...A..G...T....................A.....A..G...A-------------
                          77 >A/Kenya/002,2010/05/0                   .........A............A...........T...C...C..G...A..G...T....................A.....A..G...A-------------
                          78 >A/Kenya/051,2010/07/0                   .........A............A...........T...C...C..G...A..G...T....................A.....A..G...A-------------
                          79 >A/Kenya/004,2010/05/1                   .........A............A...........T...C...C..G..GA..G...T....................A.....A..G...A-------------
                          80 >A/Kenya/001,2010/05/0                   .......G.A.........A..A...........T...C...C..G..GA..G...T....................A.....A..G...A-------------
                          81 >A/Kenya/015,2010/05/2                   .......G.A.........A..AA......G...T...C...C..G..GA..G...T....................A.....A..G...A-------------
                          82 >A/Kenya/034,2010/06/2                   .........A............A...........T...C...C..G...A..G...T....................A.....A..G...A-------------
                          83 >A/Kenya/044,2010/06/2                   .........A............A...........T...C...C..G...A..G...T....................A.....A..G...A-------------
                          84 >A/Kenya/049,2010/07/0                   .........A............A...........T...C...C..G...A..G...T....................A.....A..G...A-------------
                          85 >A/Italy/AF2157,2010/05/1                .........A........G...A...........T...C...C..G...A..G...T....................A.....A..G...A-------------
                          86 >A/Habana/14685,2010/08                  -------...........G...A...........T...C...C.TGG..A..G...T....................C...-----------------------
                          87 >A/Habana/14686,2010/08                  -------...........G...A......A....T...C...C.TGG..A..G...T....................C...-----------------------
                          88 >A/Habana/14696,2010/08                  -------...............A...........T...C...C.TG...A..G...T....................A...-----------------------
                          89 >Index/2009/Egypt/Iowa                   ......................A...........T...C...C..G...A..G...T....................A.....A..G...A.T.........AG
                          90 >A/New York/20342,2010/06/1              ......................A...........T...T...C..G...A..G...T.......A............A.....A..G...A.T.........AG
                          91 >A/Kenya/009,2010/05/1                   ......................A...........T.C.C...C..G...A..G...TG......A............A.....A..G...A-------------
                          92 >A/Kenya/008,2010/05/1                   ......................A...........T.C.C...C..G...A..G...TG......A............A.....A..G...A-------------
                          93 >A/Kenya/017,2010/05/2                   ......................A...........T.C.C...C..G...A..G...TG.....T.............A.....A..G...A-------------
                          94 >A/Kenya/027,2010/06/1                   ......................A...........T...C...C..G...A..G...T..................G.A.....A..G...A-------------
                          95 >A/Managua/1535.03,2010/06/0             ......................A...........T...C...C..G...A..G...T.........A........G.A.....A..G...A.T...C.A...AG
                          96 >A/Habana/14720,2010/08                  -------...............A...........T...C...C..G...A..G...T.........A........G.A...-----------------------
                          97 >A/Managua/5871.02,2010/06/0             ......................A...........T...C...C..G...A..G...T.........A........G.A.....A..G...A.T...C.A...AG
                          98 >A/Managua/3192.01,2010/06/0             ......................A...........T...C...C..G...A..G...T.........A........G.A.....A..G...A.T...C.A...AG
                          99 >A/Managua/395.02,2010/06/0              ......................A...........T...C...C..G...A..G...T.........A........G.A.....A..G...A.T...C.A...AG
                         100 >A/Managua/4203.02,2010/06/0             ......................A...........T...C...C..G...A..G...T.........A........G.A.....A..G...A.T...C.A...AG
                         101 >A/Managua/5674.05,2010/06/0             ......................A...........T...C...C..G...A..G...T.........A........G.A.....A..G...A.T...C.A...AG
                         102 >A/Managua/1181.03,2010/06/0             ......................A...........T...C...C..G...A..G...T.........A........G.A.....A..G...A.T...C.A...AG
                         103 >A/Managua/5543.01,2010/06/0             ......................A...........T...C...C..G...A..G...T.........A........G.A.....A..G...A.T...C.A...AG
                         104 >A/Managua/1807.03,2010/06/0             ......................A...........T...C...C..G...A..G...T.........A........G.A.....A..G...A.T...C.A...AG
                         105 >A/Managua/506.02,2010/06/0              ......................A...........T...C...C..G...A..G...T.........A........G.A.....A..G...A.T...C.A...AG
                         106 >A/Managua/3433.02,2010/06/0             ......................A...........T...C...C..G...A..G...T.........A........G.A.....A..G...A.T...C.A...AG
                         107 >A/Managua/4456.02,2010/06/0             ......................A...........T...C...C..G...A..G...T.........A........G.A.....A..G...A.T...C.A...AG
                         108 >A/Managua/3527.02,2010/06/0             ......................A...........T...C...C..G...A..G...T.........A........G.A.....A..G...A.T...C.A...AG
                         109 >A/Managua/4131.04,2010/06/0             ......................A...........T...C...C..G...A..G...T.........A........G.A.....A..G...A.T...C.A...AG
                         110 >A/Managua/4009.02,2010/06/1             ......................A...........T...C...C..G...A..G...T.........A........G.A.....A..G...A.T...C.A...AG
                         111 >A/Managua/1167.03,2010/06/0             ......................A...........T...C...C..G...A..G...T.........A........G.A.....A..G...A.T...C.A...AG
                         112 >A/Managua/5259.02,2010/06/0             ......................A...........T...C...C..G...A..G...T.........A........G.A.....A..G...A.T...C.A...AG
                         113 >A/Managua/4134.04,2010/06/0             ......................A...........T...C...C..G...A..G...T.........A........G.A.....A..G...A.T...C.A...AG
                         114 >A/Managua/194.01,2010/06/0              ......................A...........T...C...C..G...A..G...T.........A........G.A.....A..G...A.T...C.A...AG
                         115 >A/Managua/1166.03,2010/06/0             ......................A...........T...C...C..G...A..G...T.........A........G.A.....A..G...A.T...C.A...AG
                         116 >A/Managua/3570.04,2010/06/0             ......................A...........T...C...C..G...A..G...T.........A........G.A.....A..G...A.T...C.A...AG
                         117 >A/Managua/5863.02,2010/06/0             ......................A...........T...C...C..G...A..G...T.........A........G.A.....A..G...A.T...C.A...AG
                         118 >A/Managua/5806.01,2010/06/0             ......................A...........T...C...C..G...A..G...T.........A........G.A.....A..G...A.T...C.A...AG
                         119 >A/Managua/80.1,2010/06/0                ......................A...........T...C...C..G...A..G...T......A..A........G.A.....A..G...A.T...C.A...AG
                         120 >A/Managua/1856.03,2010/06/0             ......................A...........T...C...C..G...A..G...T.........A........G.A.....A..G...A.T...C.A...AG
                         121 >A/Managua/1784.03,2010/06/0             ......................A...........T...C...C..G...A..G...T.........A........G.A.....A..G...A.T...C.A...AG
                         122 >A/Managua/2614.02,2010/06/0             ......................A...........T...C...C..G...A..G...T.........A........G.A.....A..G...A.T...C.A...AG
                         123 >A/Managua/3244.02,2010/06/0             ......................A...........T...C...C..G...A..G...T.........A........G.A.....A..G...A.T...C.A...AG
                         124 >A/Managua/3715.02,2010/06/0             ......................A...........T...C...C..G...A..G...T.........A........G.A.....A..G...A.T...C.A...AG
                         125 >A/Managua/1422.03,2010/06/0             ......................A...........T...C...C..G...A..G...T.........A........G.A.....A..G...A.T...C.A...AG
                         126 >A/Managua/2867.01,2010/06/1             ......................A...........T...C...C..G...A..G...T.........A........G.A.....A..G...A.T...C.A...AG
                         127 >A/Managua/2912.04,2010/06/1             ......................A...........T...C...C..G...A..G...T.........A........G.A.....A..G...A.T...C.A...AG
                         128 >A/Managua/4763.03,2010/06/0             ......................A...........T...C...C..G...A..G...T.........A........G.A.....A..G...A.T..GC.A...AG
                         129 >A/Managua/305-10,2010/03/1              ......................A...........T...C...C..G...A..G...T.........A........G.A.....A..G...A.T...C.A...AG
                         130 >A/Managua/905.02,2010/06/0              ......................A...........T...C...C..G...A..G...T.........A........G.A.....A..G...A.T...C.A...AG
                         131 >A/Managua/90.01,2010/06/1               ......................A...........T...C...C..G...A..G...T.........A........G.A.....A..G...A.T...C.A...AG
                         132 >A/Managua/4218.02,2010/06/0             ......................A...........T...C...C..G...A..G...T.........A........G.A.....A..G...A.T...C.A...AG
                         133 >A/Managua/5906.01,2010/06/0             ......................A...........T...C...C..G...A..G...T.........A........G.A.....A..G...A.T...C.A...AG
                         134 >A/Managua/410.02,2010/06/0              ......................A...........T...C...C..G...A..G...T.........A........G.A.....A..G...A.T...C.A...AG
                         135 >A/North Carolina/AF2716,2011/01/0       ...........G..........A.G.........T...C...C..G...A..G...T..................G.A.....A..G..AA-------------
                         136 >A/New York/20343,2010/06/1              C..........G..........A.G.........T...C...C..G...A..G...T..................G.A.....A..G..AA.T.........AG
                         137 >A/Acre/26954,2010/04/0                  .....GA.......C..A.........T...C.A....C...C..A..........T...........C....A......AC....G...A.T.TG.A...TAG
                         138 >A/Acre/15093,2010/03/0                  .....G........C..A.........T...C.A....C...C..A..........T...........C....A......AC....G...A.T.TG.A...TAG
                         139 >A/Thailand/CU-H1817,2010/03/2           .................A...............A....C..GC..A........C.T......A......................G...A.T........TAG
                         140 >A/Niigata/1148,2010/08/0                ..........T.A....A...............A....C.TGC..A....G...C.T.....GA........G.............G...AGT........TAG
                         141 >A/Niigata/1147,2010/08/0                ..........T.A....A...............A....C.TGC..A....G...C.T.....GA........G.............G...AGT........TAG
                         142 >A/Niigata/1143,2010/08/0                ..........T.A....A...............A....C.TGC..A....G...C.T.....GA........G.............G...AGT........TAG
                         143 >A/Stockholm/4,2010/07/0                 ..........T.A....A...............A....C.TGC..A....G...C.T.....GA........G.............G...AGT........TAG
                         144 >A/Niigata/1150,2010/08/0                ..........T.A....A...............A....C.TGC..A....G...C.T.....GA........G.............G...AGT........TAG
                         145 >A/Niigata/1146,2010/08/0                ..........T.A....A...............A....C.TGC..A....G...C.T.....GA........G.............G...AGT........TAG
                         146 >A/Nanjing/1663,2010/09/1                ..........T.A....A...........A...A....C.TGC..A....G...C.T...T.GA.G......G.............G...AGT........TAG
                         147 >A/Nanjing/1655,2010/09/1                ..........T.A....A...........A...A....C.TGC..A....G...C.T...T.GA.G......G.............G...AGT........TAG
                         148 >A/Niigata/1144,2010/08/0                ..........T.A....A...............A....C.TGC..A....G...C.T.....GA........G.............G...AGT........TAG
                         149 >A/Korea/AF2707,2011/01/0                .C........T.....GA..G.......A.G..A....C.TGC..A....G...C.T.....GA........G.A....G......G...A-------------
                         150 >A/Korea/AF2710,2011/01/0                .C........T.....GA..G.......A.G..A....C.TGC..A....G...C.T.....GA...G....G.A....G......G...A-------------
                         151 >A/Korea/AF2709,2011/01/0                .C........T.....GA..G.......A.G..A....C.TGC..A....G...C.T.....GA...G....G.A....G......G...A-------------
                         152 >A/Korea/AF2708,2011/01/0                .C........T.....GA..G.......A.G..A....C.TGCT.A....G...C.T.....GA........G.A....G......G...A-------------
                         153 >A/Korea/AF2711,2011/01/1                .C........T.....GA..G.......A.G..A....C.TGC..A....G...C.T.....GA........G.A....G......G...A-------------
                         154 >A/Nevada/AF2690,2010/12/0               ...A......T.A....A...............A....C.TGC..A....G...C.T.....GA........G.............G...A-------------
                         155 >A/Niigata/1149,2010/08/0                ..........T.A....A...............A....C.TGC..A....G...C.T.....GA........G.............G...AGT........TAG
                         156 >A/Korea/AF2706,2010/12/2                ..........T.A....A...............A....C.TGC..A.C..G...CGT.....GA........G.............G...A-------------
                         157 >A/Nanjing/1654,2010/09/1                .................A...............A....CGTGC..A....G...C.T.....GA........G.............G...A.T........TAG
                         158 >A/Sao Paulo/16363,2010/07               ................GA...............A....C...C..A..........T.............................G...A.T........TAG
                         159 >Index/Perth-like/2009                   .................A...............A....C...C..A..........T.............................G...A.T........TAG
                         160 >A/Habana/11052,2010/04                  -.........................................C.............T.................................A...........AG
                         161 >2007/02/06,14278,AUS,A/Brisbane/10/07   ........................................................................................................
                         162 >Index/USA-2007                          ........................................................................................................
                         163 >Index/Brisbane-like/2007                ........................................................................................................
                                                                                                                                                                              
                        ---Index--------------------------------------TTCCAAGAGGCAGGTTAGAGATCGATGGGGATATCTTAAACAACGTATACAAACAACAACCCAGGTGATGAAAGGACGCAGTCCGCTAAGGACTCAAGGAGCCA
                        -codon-position-------------------------------22 1   1 2 111   1 21  221   2 2    2   1 1    1    1 11  1 1  22  2 122  12  1       2       12211     
                                                                      00000000000000000000000000000000000000000000000000000000000000000000000000000111111111111111111111111111
                                                                      00001111111112222222223333344444444455555556666666666677777778888888888999999000000001111112233444555555
                                                                      14450123788990113368891222700133688911223560014456788912233792233337888135788001234550333892958057114467
                                                                      14558706126065361241918038525957803589282550952310212021956192803475267797334591327361017571637314385808

                        .
                        .

                        the first group , #1-#35 is the new PA/02 strain
                        the 2nd group, #37-#136 is the Egypt/Kenya/Iowa strain
                        #140-#158 is a new Asian strain

                        all 3 are descendents of Perth/2009 or a similar virus, which may go back to
                        2009 or 2008. So we do see 3 different strains of H3N2 in humans
                        all going back to one ancestor from ~2008.
                        A 2-3 years variation. While ******, ph1n1, has ~1-2 years.
                        Flu may die each year in all but a few places (India ?) where it stays
                        yearround and from where it always starts with new strains.
                        And it doesn't seem to get feedback in those place -viruswise- from what
                        happens elsewhere.
                        Find those central flu-base-places and track the evolution there !
                        Rather than tracking it in the peripheral USA,Europe.
                        I'm interested in expert panflu damage estimates
                        my current links: http://bit.ly/hFI7H ILI-charts: http://bit.ly/CcRgT

                        Comment


                        • Re: Sequences at Genbank!

                          reassortment in H3N2:

                          Kenya/Egypt/Iowa provides segments 3,4,5,(7?) to Denmark/105
                          while CA/VRDL362 provides segments 1,2,6,(7?),8

                          that Denmark/105 virus seems to be the dominant variant
                          in USA this season. First seen in A/Pennsylvania/02/2010



                          Code:
                                                                 000000000000000000001111111111111112222 0000000000000000000111111111112222 0000000011111111111111 00000000000000000000000000001111111111111111 000000000111 00000000000111111111 00000000 000000000000 
                                                                 122223345667788888990011223366666770011 0111111334444778899023356777890222 0011334400012233667779 01112223334455555566667778880001112234555566 001122336034 00001446678011112223 22233455 000113444777 
                                                                 804480448660646778683547286823578340647 8015599580468281358853468025580013 9955360816660926185880 40230891284802226716892398890053390959146778 031605008758 07781372443800014899 06713924 057458012349 
                                                                 742323848168361385615893142196380761128 1513558715756396151215466769467014 0603938970843395405782 48055318827311285950209696775930176634850812 934512064715 67859919347906735100 77654216 646406469576 
                          -codon-position------------------------1 2      1  1   2    2     1 1 1            2            1 2      11   1 2          1         2   2   11  11   2  1   1  1112  1 2           2           1   2 121 21   22     1     1 2    1  222   1 
                          ---Index-------------------------------AGTGGAGCCGCAGGAGGGCGTAGAGGCAGTAGCATTGTC TAGGAACGGATAGTCGATAGGCCTTGCGGTGCGA TATTGGTCGAGCGCGCGTCTTG TAGCGTTCTGCCGAAAAGTCACCACGATGCCTAGGCTAAGCAAG CAAGGCAAAAGG TTTTAGCGAACAGAGCAAAA CTCGGAGC TCGTCTGACAAA 
                             1 >Index/USA-2007                   ....................................... .................................. ...................... ............................................ ............ .................... ........ ............ 
                             2 >Index/2009/Egypt/Iowa            G....G.....G..GA...C.GA.A..G........... .G..GG...G........G.A..C.AAA..AA.G .C.CAA....A....T.G.... .......A...T..C.C.GAG.T.....A.AG.A.T....AG.. ....A.CG.... .CCCGAT.G.....A...G. .C...GA. ......AG.G.. 
                             3 >A/Denmark/105/2010/12/22(H3N2)   .ACAA.ATTTAGAA..A.AAC..C.A..ACGATGCCACA CGA.G.ATA.CGACTA.CGA.TT.---------- CCCCAACT..ATATATAG.A.. CGA.ACCAC..T..C.CAGAGTTGTAC.AAAGGA.TC.GAAGG. T..TA.CGG.T. .....A.AG.TGAC.T.T.C ACTATGAA CAA.TC..T.GG 
                             4 >A/CA/VRDL362/2009/08/11(H3N2)    ......A.TT.G....ATA.......A..CGAT..CAC. CG.AG.A.A.....T.G.GA....C.A.AC.AAG .C.C....AG.......GT.CA ...A.....AT.AG.GC.....T....A...G.AA..G..AG.A .GG.AT...C.A C....A..GGT.AC..GT.C .C.A.GAA C..C.C.....G 
                                                                                                                                                                                                                                                                        
                          ---Index-------------------------------AGTGGAGCCGCAGGAGGGCGTAGAGGCAGTAGCATTGTC TAGGAACGGATAGTCGATAGGCCTTGCGGTGCGA TATTGGTCGAGCGCGCGTCTTG TAGCGTTCTGCCGAAAAGTCACCACGATGCCTAGGCTAAGCAAG CAAGGCAAAAGG TTTTAGCGAACAGAGCAAAA CTCGGAGC TCGTCTGACAAA 
                          -codon-position------------------------1 2      1  1   2    2     1 1 1            2            1 2      11   1 2          1         2   2   11  11   2  1   1  1112  1 2           2           1   2 121 21   22     1     1 2    1  222   1 
                                                                 000000000000000000001111111111111112222 0000000000000000000111111111112222 0000000011111111111111 00000000000000000000000000001111111111111111 000000000111 00000000000111111111 00000000 000000000000 
                                                                 122223345667788888990011223366666770011 0111111334444778899023356777890222 0011334400012233667779 01112223334455555566667778880001112234555566 001122336034 00001446678011112223 22233455 000113444777 
                                                                 804480448660646778683547286823578340647 8015599580468281358853468025580013 9955360816660926185880 40230891284802226716892398890053390959146778 031605008758 07781372443800014899 06713924 057458012349 
                                                                 742323848168361385615893142196380761128 1513558715756396151215466769467014 0603938970843395405782 48055318827311285950209696775930176634850812 934512064715 67859919347906735100 77654216 646406469576


                          -----------------------------------
                          29.7.2011, checking China H3N2 (lots of segment 7)

                          A/Beijing/385/2009/10(H3N2) had segment 8 from ******

                          A/Shanxi-Qindu/1124/2007(H3N2)
                          and A/Hunan-Kaifu/198/2007/03/01(H3N2)
                          have segment 7 from old H1N1

                          ---------------------------------------------
                          I'm interested in expert panflu damage estimates
                          my current links: http://bit.ly/hFI7H ILI-charts: http://bit.ly/CcRgT

                          Comment


                          • Re: Sequences at Genbank!

                            I Blasted the PB2 for A/Shanghai-Luwan/1400/2010; here are the top matches at GISAID. It looks like 4 of them have California's PB2?

                            EPI293837 A/Shanghai-Luwan/1400/2010 (A/H3N2) segment 1 (PB2) 4324.1
                            EPI293885 A/Hubei-Wuchang/1271/2010 (A/H3N2) segment 1 (PB2) 4263.2
                            EPI293877 A/Shanghai-Luwan/1568/2010 (A/H3N2) segment 1 (PB2) 4257.6
                            EPI295222 A/Mexico/4553/2010 (A/H3N2) segment 1 (PB2) 4167.2
                            EPI295214 A/Mexico/4553/2010 (A/H3N2) segment 1 (PB2) 4167.2
                            EPI273519 A/California/VRDL362/2009 (A/H3N2) segment 1 (PB2) 4167.2
                            EPI274425 A/California/VRDL335/2009 (A/H3N2) segment 1 (PB2) 4150.5
                            EPI274638 A/California/VRDL196/2009 (A/H3N2) segment 1 (PB2) 4133.9
                            EPI274017 A/California/VRDL170/2009 (A/H3N2) segment 1 (PB2) 4133.9
                            EPI273375 A/California/VRDL286/2009 (A/H3N2) segment 1 (PB2) 4133.9
                            EPI256731 A/Mexico city/CIA8/2009 (A/H1N1) segment 1 (PB2) 4133.9
                            EPI274409 A/California/VRDL333/2009 (A/H3N2) segment 1 (PB2) 4130.2
                            EPI274233 A/California/VRDL278/2009 (A/H3N2) segment 1 (PB2) 4130.2
                            EPI274217 A/California/VRDL274/2009 (A/H3N2) segment 1 (PB2) 4130.2
                            EPI274289 A/California/VRDL309/2009 (A/H3N2) segment 1 (PB2) 4128.4
                            EPI274257 A/California/VRDL293/2009 (A/H3N2) segment 1 (PB2) 4128.4
                            The salvage of human life ought to be placed above barter and exchange ~ Louis Harris, 1918

                            Comment


                            • Re: Sequences at Genbank!

                              genbank H3N2-genomes since 2007
                              (some (~20) of the old Wisconsin/67/2005 viruses from 2007 were removed)

                              http://magictour.free.fr/panflu/32ge4d.GIF


                              presumably many new genomes similar to Denmark will be added
                              later in 2011
                              I hope you can see the reassortment in the picture


                              1.) original 2007
                              1.a) Illinois,Vermont/2007
                              1.b) Brisbane
                              1.c) Managua/2007
                              2.)Perth
                              ...
                              2.c) Kenya/Egypt/Iowa/2009
                              318,483,522,565,615,660,682,729,1005,1053,1130,119 7,1296,1560,1578
                              2.d) CAlifornia/2009
                              565,729,1130,1197,1560,1578
                              2.e) Penn/02,Denmark/105 reassorted
                              108,205,690,736,887,1131,1545
                              3.) Boston/2008
                              55,297,518,567,729,1056,1371,1455,1518,1632,1633



                              for another view:
                              http://magictour.free.fr/panflu/32ge4e.GIF
                              I'm interested in expert panflu damage estimates
                              my current links: http://bit.ly/hFI7H ILI-charts: http://bit.ly/CcRgT

                              Comment


                              • Re: Sequences at Genbank!

                                Thanks for further explanation of your pic; I'd like to pass it on to those who are still not quite sure
                                what they're seeing. Please feel free to ask questions.

                                First of all, his pics need to be viewed in full size. I use Opera and always "fit to width", which shrinks
                                the pic to the point that I can't see it properly.

                                In his green pic, the red lines to the right mark the substrains and the red line at the bottom middle
                                indicates HA (segment 4). When the pic is fully enlarged, you can better see the pale blue lines that
                                divide the segments. He has added color in the linked pic to differentiate the 8 segments.

                                I knew the pixels were mutations but I could never quite put it together until he showed me his table
                                of the same sequences.

                                Here's a portion of his table shrunk 50&#37;. You can still see the atcg mutations but look how the pixel
                                columns begin to form.



                                And here, you can see even better how the mutation table transforms into a picture with pixel columns.


                                Attached Files
                                The salvage of human life ought to be placed above barter and exchange ~ Louis Harris, 1918

                                Comment

                                Working...
                                X