Announcement

Collapse
No announcement yet.

Sequences at Genbank!

Collapse
This is a sticky topic.
X
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Re: Sequences at Genbank!

    2 consecutive weeks with a new minimum of uploaded weekly ****** sequences at genbank

    weekly number of new genbank ****** sequences:
    108,315,298,309,598,338,189,111,523,209,246,211,38 7,228,218,243,048,269,125,1011,31,33
    390,81,72,35,306,746,441,1247,93,65,1245,121,158,1 66,43,48,144,471,156,12,13
    I'm interested in expert panflu damage estimates
    my current links: http://bit.ly/hFI7H ILI-charts: http://bit.ly/CcRgT

    Comment


    • Re: Sequences at Genbank!

      Just to compare: each week at GISAID beginning in November 2, Monday-Sunday until today:
      Nov 2: 0, 0, 146, 226, 65
      Dec 7: 62, 173, 53, 76
      Jan 4: 152, 91, 47, 210
      Feb1: 36, 80, 36

      total: 1453
      The salvage of human life ought to be placed above barter and exchange ~ Louis Harris, 1918

      Comment


      • Re: Sequences at Genbank!

        today 3 genomes and ~40 times HA and NA from Malaysia, July,August 2009

        not available yet from the search-page for bulk-download
        I'm interested in expert panflu damage estimates
        my current links: http://bit.ly/hFI7H ILI-charts: http://bit.ly/CcRgT

        Comment


        • Re: Sequences at Genbank!

          They are now available on the front page.

          Italy submitted an unusual(?) NA sequence. I usually look for the series of YHY for oseltamivir resistance; the series turns to YYY if it's resistant. This one has YXY, with the normal codon for 823,824,825 is cac; this one is yac.

          I can't find any other pH1N1 sequences with an X in that position.

          The salvage of human life ought to be placed above barter and exchange ~ Louis Harris, 1918

          Comment


          • Re: Sequences at Genbank!

            where is our list of nucleotide-letters and amino-acid-letters ?

            presumably X stands for mixture of H and Y

            -----edit----------
            yac is indeed mixing of cac(H) and tac(Y)


            it's here:


            is it available to everyone in your workroom ?
            I copy it here and add some keywords so it can be refound


            Here's a list what the letters in the nucleotide portion mean:

            These are the nucleotides:
            "A" = "Adenosine"
            "C" = "Cytosine"
            "G" = "Guanine"
            "T" = "Thymidine"

            These indicate changes:
            "Y" = "Pyrimidine (C & T)"
            "R" = "Purine (A & G)"
            "W" = "Weak (A & T)"
            "S" = "Strong (G & C)"
            "K" = "Keto (T & G)"
            "D" = "Not C"
            "V" = "Not T"
            "H" = "Not G"
            "B" = "Not A"
            "X" = "Unknown"
            "N" = "Unknown"


            keywords:

            nucleotide r
            nucleotide y
            nucleotide x
            Pyrimidine


            we also had a table for additional(mixed) amino-acid letters
            I'm interested in expert panflu damage estimates
            my current links: http://bit.ly/hFI7H ILI-charts: http://bit.ly/CcRgT

            Comment


            • Re: Sequences at Genbank!

              My workroom is availably to everyone; but feel free to copy it to wherever you like.

              A/Dundgobi/9746/2009 in the NS1 segment was also a bit unusual.

              Thanks to gs for his findings and comments:
              T332C(8){rare},A367G(8){Cancun},G432A(8){synonymou s}{rare}
              I111T,I123V
              The salvage of human life ought to be placed above barter and exchange ~ Louis Harris, 1918

              Comment


              • Re: Sequences at Genbank!

                Here is our most complete list of mutations; it's in the discussion forum:

                The salvage of human life ought to be placed above barter and exchange ~ Louis Harris, 1918

                Comment


                • Re: Sequences at Genbank!

                  Malaysia:

                  Code:
                                                            2 1 2 000001111111 011 00 00 0  
                                                            1 5 1 166890122245 212 37 46 3  
                                                            6 4 4 935761612806 944 14 90 6  
                                                            3 2 3 658137487284 838 62 20 7  
                  -codon-position---------------------------    1 1211     111 1   11    1  
                  ---Index----------------------------------G G C CCTGAGCGAGCC GGG GA GG A  
                     1 >A/******/index/2009/02/01           . . . ............ ... .. .. .  
                     2 >A/Malaysia/9237/2009(H1N1/08/12/    - - - ..A..T....T. --- AG -- -  
                     3 >A/Malaysia/5283/2009(H1N1/07/23/    - - - .TA..T....T. --- AG -- -  
                     4 >A/Malaysia/9117/2009(H1N1/08/12/    - - - .TA..T....T. --- AG -- -  
                     5 >A/Malaysia/9131/2009(H1N1/08/12/    - - - ..A..T....T. --- AG -- -  
                     6 >A/Malaysia/4038/2009(H1N1/07/04/    - - - ..A..T....T. --- AG -- -  
                     7 >A/Malaysia/9451/2009(H1N1/08/13/    - - - ..A..T....T. --- AG -- -  
                     8 >A/Malaysia/5262/2009(H1N1/07/22/    - - - ..A..T....T. --- AG -- -  
                     9 >A/Malaysia/5218/2009(H1N1/07/16/    - - - ..A.CT....T. --- AG -- -  
                    10 >A/Malaysia/5234/2009(H1N1/07/20/    - - - ..A.CT....T. --- AG -- -  
                    11 >A/Malaysia/9541/2009(H1N1/08/12/    - - - ..A.CT....T. --- AG -- -  
                    12 >A/Malaysia/9343/2009(H1N1/08/13/    - - - ..A.CT....T. --- AG -- -  
                    13 >A/Malaysia/5237/2009(H1N1/07/20/    - - - ..A.CT....T. --- AG -- -  
                    14 >A/Malaysia/5670/2009(H1N1/07/31/    - - - ..A.CT....T. --- AG -- -  
                    15 >A/Malaysia/5258/2009(H1N1/07/21/    - - - ..A.CT....T. --- AG -- -  
                    16 >A/Malaysia/5192/2009(H1N1/07/15/    - - - ..A..TT.G.T. --- AG -- -  
                    17 >A/Malaysia/5193/2009(H1N1/07/15/    - - - ..A..TT.G.T. --- AG -- -  
                    18 >A/Malaysia/5112/2009(H1N1/07/11/    - - - ..A......AT. --- AG -- -  
                    19 >A/Malaysia/5286/2009(H1N1/07/23/    - - - ..A....A.AT. --- AG -- -  
                    20 >A/Malaysia/3758/2009(H1N1/07/02/    - - - ..A....A.AT. --- AG -- -  
                    21 >A/Malaysia/4737/2009(H1N1/07/09/    - - - ..A.......T. --- AG -- -  
                    22 >A/Malaysia/5225/2009(H1N1/07/17/    - - - ..A.......T. --- AG -- -  
                    23 >A/Malaysia/4847/2009(H1N1/07/09/    - - - ..A.......T. --- AG -- -  
                    24 >A/Malaysia/9147/2009(H1N1/08/12/    - - - ..A.......T. --- AG -- -  
                    25 >A/Malaysia/5103/2009(H1N1/07/12/    - - - ..A.......T. --- AG -- -  
                    26 >A/Malaysia/9254/2009(H1N1/08/11/    - - - ..A.......T. --- AG -- -  
                    27 >A/Malaysia/5270/2009(H1N1/07/22/    - - - ..A.......T. --- AG -- -  
                    28 >A/Malaysia/5162/2009(H1N1/07/13/    - - - ..A.......T. --- AG -- -  
                    29 >A/Malaysia/5027/2009(H1N1/07/11/    - - - ..A.......T. --- AG -- -  
                    30 >A/Malaysia/8860/2009(H1N1/08/08/    - - - ..A.......T. --- AG -- -  
                    31 >A/Malaysia/9118/2009(H1N1/08/12/    - - - ..A.......T. --- AG -- -  
                    32 >A/Malaysia/5175/2009(H1N1/07/13/    - - - ..A.......TT --- AG -- -  
                    33 >A/Malaysia/5057/2009(H1N1/07/11/    - - - ..A.......TT --- AG -- -  
                    34 >A/Malaysia/5272/2009(H1N1/07/22/    - - - T.A.......T. --- AG -- -  
                    35 >A/Malaysia/5277/2009(H1N1/07/22/    - - - T.A.......T. --- AG -- -  
                    36 >A/Malaysia/5163/2009(H1N1/07/13/    - - - ..A.......T. --- AG -- -  
                    37 >A/Malaysia/4039/2009(H1N1/07/04/    - - - ..A.......T. --- AG -- -  
                    38 >A/Malaysia/5259/2009(H1N1/07/21/    A . . ..A.......T. AAA AG AA G  
                    39 >A/Malaysia/854/2009(H1N1/05/16/     A . . ..AA......T. AAA AG AA G  
                    40 >A/Malaysia/820/2009(H1N1/05/15/     A . . ..AA......T. AAA AG AA G  
                    41 >A/Malaysia/10226/2009(H1N1/08/14/   A A T ..A.......T. AAA AG AA G  
                    42 >A/Malaysia/12617/2009(H1N1/08/20/   A A T ..A..T....T. AAA AG AA G  
                    43 >A/Cancun-NY/Index/2009/04/15        A . . ..A.......T. AAA AG AA G  
                                                                                            
                  ---Index----------------------------------G G C CCTGAGCGAGCC GGG GA GG A  
                  -codon-position---------------------------    1 1211     111 1   11    1  
                                                            2 1 2 000001111111 011 00 00 0  
                                                            1 5 1 166890122245 212 37 46 3  
                                                            6 4 4 935761612806 944 14 90 6  
                                                            3 2 3 658137487284 838 62 20 7

                  all are Cancun, 2 Malaysia markers: G1017T,A963C
                  I'm interested in expert panflu damage estimates
                  my current links: http://bit.ly/hFI7H ILI-charts: http://bit.ly/CcRgT

                  Comment


                  • Re: Sequences at Genbank!

                    >100 new genomes today !
                    Australia,California,DC,

                    Oceania:

                    Code:
                                                            000000000011111111112 000000111112 000000011111111122 00000000000001111 0000111111 000000000000011 00000 000000000  
                                                            123334478911245566771 145668001291 023366702366788901 02333556666992344 1247011244 000233446799912 14467 222233566  
                                                            740034784645781967666 341009896658 496704212017746254 27069154566398202 8924347499 117313781467976 02902 368936245  
                                                            890361030397235578793 874394221602 083035274834019358 92840990856332382 7861639867 255163108234033 23209 130167044  
                    -codon-position-------------------------1     2    2 1 221 2    1   2    1 11 1  2   2  2     2221  1112   1 1  11  1   2      1    1 2           21  112   
                    ---Index--------------------------------GTTGTAACCAGTAGACAGAGG ACGGATGTGGTG GGACTCGGAAAGGAGGGG AGATGTGGTGATGGACC AGCCTGAGGA CAAAGGCCAATATAC AAGGA TGAAAAGCG  
                       1 >A/******/index/2009/02/01         ..................... ............ .................. ................. .......... ............... ..... .........  
                       2 >A/Auckland/1/2009/04/25           ..................... ............ ....C............- ...............T. .A...A.... ..G.A....G..... ..... ---------  
                       3 >A/Auckland/3/2009/04/25           --------------------- ------------ ------------------ ...............T. --------AT ..G.A....G..... ..... ---------  
                       4 >A/Auckland/4/2009/04/             --------------------- ------------ ------------------ ...............T. --------AT ..G......G..... ..... ---------  
                       5 >A/Christchurch/2/2009/04/29       --------------------- ------------ ------------------ ................. --------AT T.............. ..... ---------  
                       6 >A/Perth/29/2009/05/26             --------------------- ------------ ------------------ ................. --------AT TG............. ----- ---------  
                       7 >A/Auckland/2/2009/04/24           --------------------- ------------ ------------------ ----------------- --------AT --------------- ..... ---------  
                       8 >A/Victoria/2001/2009/05/19        --------------------- ------------ ------------------ ........AA...A.T. --------AT T...A....G..... ----- ---------  
                       9 >A/Darwin/2001/2009/05/29          --------------------- ------------ ------------------ ........AA...A.T. --------AT T...A....G..... ----- ---------  
                      10 >A/South Australia/2001/2009/05/   --------------------- ------------ ------------------ ........AA...A.T. --------AT TG..A....G..... ..AA. ---------  
                      11 >A/Australia/13/2009/07/20         ....................A ........A... .............C..A. ...C....AA...A.T. .A...A.A.. ....A....G..... ..AA. .....GA..  
                      12 >A/Australia/63/2009/08/03         .................A..A ........A... .............C..A. ...CA...AA...A.T. .A...A.A.. ....A....G..... ..AA. .....GA..  
                      13 >A/Australia/58/2009/08/01         ....................A ........A... ................A. ...C....AA...A.T. .A...A.A.. ....A....G..... ..AA. .....GA..  
                      14 >A/Australia/20/2009/07/21         ....................A .T.......... ..GA.............. ..G..C..AA..A..T. .A...A.A.. ....A...GG..C.. ..AA. .....G...  
                      15 >A/Australia/37/2009/07/24         .C.................AA .T.......... ..GA..A........... ..G..CA.AA..A..T. .A...A.A.. ....A...GG..C.. .GAA. .....G...  
                      16 >A/Australia/36/2009/07/24         .C.................AA .T.......... ..GA..A........... ..G..CA.AA..A..T. .A...A.A.. ....A...GG..C.. .GAA. .....G...  
                      17 >A/Victoria/2005/2009/05/18        --------------------- ------------ ....C...........A- ----------------- .A...A.A.. --------------- ----- ---------  
                      18 >A/Australia/26/2009/07/22         ...............T....A ............ .................. ........A......T. .A...A.A.. ....A....G..... ..AA. .....G...  
                      19 >A/Australia/16/2009/07/21         ...A............G...A ............ .........G........ ........A......T. .AT..A.A.. ....A....G.G... ..AA. C....G...  
                      20 >A/Australia/47/2009/07/27         ...A............G...A ............ .........G........ ........A......T. .AT..A.A.. ....A....G.G... ..AA. C....G...  
                      21 >A/Australia/3/2009/07/17          ................G...A ............ .........G........ ........A......T. .AT..A.A.. ....A....G..... ..AA. C....G...  
                      22 >A/Victoria/2004/2009/05/21        --------------------- ------------ ------------------ ........A......T. --------AT ....A....G..... ----- ---------  
                      23 >A/Brisbane/17/2009/05/07          --------------------- ------------ ------------------ ........A....A.T. --------AT ....A....G..... ..AA. ---------  
                      24 >A/Australia/79/2009/08/20         ....................A ............ .................. ........A......T. .A...A.A.. ....A....G..... ..AA. .....G...  
                      25 >A/Australia/11/2009/07/20         .....G..............A ........A... A................. ........A....A.T. .A...A.A.. ...GA....G..... ..AA. .....G...  
                      26 >A/Australia/48/2009/07/27         .....G..............A ........A... A................. ........A....A.T. .A...A.A.. ...GA....G..... ..AA. .....G...  
                      27 >A/Australia/61/2009/08/03         .....G..............A ........A... A................. ........A......T. .A...A.A.. ....A....G..... ..AA. ...G.G...  
                      28 >A/Australia/32/2009/07/23         .....G..A...........A ........A... A......A......A..A G.......A....A.T. .A...A.A.. ....A....G..... G.AA. .A...G.A.  
                      29 >A/Australia/12/2009/07/20         .....G..A...........A ........A... A......A......A..A G.......A....A.T. .A...A.A.. ....A....G..... G.AA. .A...G.A.  
                      30 >A/Australia/44/2009/07/26         A....G.......A......A .....C..A... A.......G...A.A... .......AA....A.T. GA...A.A.. ...GA.T..G..... ..AA. .....G..A  
                      31 >A/Australia/15/2009/07/20         A....G.......A......A .....C..A... A.......G...A.A... .......AA....A.T. GA...A.A.. ...GA.T..G..... ..AA. .....G..A  
                      32 >A/Australia/24/2009/07/21         A....G..............A ........A... A.............A... .......AA....A.T. .A...A.A.. ...GA.T..G..... ..AA. .....G...  
                      33 >A/Australia/56/2009/07/30         A....G............G.A ........A... A.............A... .......AA....A.T. .A...A.A.. ...GA.T..G..... ..AA. .....G...  
                      34 >A/Australia/54/2009/08/16         A....G..............A ........A... A.............A... ..G..C..A.....GT. .A...A.A.. ....A..T.G..C.. ..AA. .....G...  
                      35 >A/Australia/10/2009/07/20         ....................A ........A... .............C..A. ..G..C..A......T. .A...A.A.. ....A....G..CG. ..AA. .....G...  
                      36 >A/Australia/69/2009/08/05         ....................A ........A... .............C..A. ..G..C..A......T. .A...A.A.. ....A....G..C.. ..AA. .....G...  
                      37 >A/Australia/66/2009/08/04         ....................A .T.......... ..G............... ..G..C..A..C...T. .A...A.A.. ....A....G..C.. ..AA. .....G...  
                      38 >A/Australia/6/2009/07/18          ....................A .T.......... ..G............... ..G..C..A..C...T. .A...A.A.. ....A....G..C.. ..AA. .....G...  
                      39 >A/Australia/25/2009/07/22         ....................A .T.......... ..G............... ..G..C..A..C...T. .A...A.A.. ....A....G..C.. ..AA. .....G...  
                      40 >A/Australia/39/2009/07/24         ..................G.A .T.....C.... ..G............... ..G..C..A..C...T. .A...A.A.. ....A....G..C.. ..AA. .....G...  
                      41 >A/Australia/53/2009/07/29         ....................A .T.....C.... ..G............... ..G..C..A..C...T. .A...A.A.. ....A....G..C.. ..AA. .....G...  
                      42 >A/Australia/80/2009/08/26         ....................A .T.......... ..G............... ..G..C..A..C...T. .A...A.A.. ....A....G..C.. ..AA. .....G...  
                      43 >A/Australia/42/2009/07/25         ....................A .T.......... ..G............... ..G..C..A..C...T. .A...A.A.. ....A....G..C.. ..AA. .....G...  
                      44 >A/Australia/28/2009/07/23         .......A...C........A .T..G......A ..G............... ..G..C..A......T. .A.T.A.A.. ....AA...G..C.. ..AA. .....G...  
                      45 >A/Australia/31/2009/07/23         .......A...C........A .T..G......A ..G............... ..G..C..A......T. .A.T.A.A.. ....AA...G..C.. ..AA. .....G...  
                      46 >A/Australia/29/2009/07/23         .......A...C........A .T.......... ..G............... ..G..C..A......T. .A.T.A.A.. ....A....G..C.. ..AA. .....G...  
                      47 >A/Australia/45/2009/07/27         ....................A .T.......A.. .AG............A.. ..G.AC..A.T....TT .A...A.A.. ....A....G..C.. ..AAG .....G...  
                      48 >A/Australia/43/2009/07/26         ....................A .T.......A.. .AG............A.. ..G.AC..A.T....TT .A...A.A.. ....A....G..C.. ..AAG .....G...  
                      49 >A/Australia/14/2009/07/20         ....................A .T.......... ..G............... ..G..C..A......T. .A...A.A.. ....A....G..C.. ..AA. .....G...  
                      50 >A/Australia/23/2009/07/22         ....................A .T.......... ..G............... ..G..C..A......T. .A...A.A.. ....A....G..... ..AA. ...G.G...  
                      51 >A/Australia/40/2009/07/24         ..C.......A....T....A .T.......... ..G............... ..G..C..A......T. .A...A.A.. ....A....G..C.. ..AA. .....G...  
                      52 >A/Australia/1/2009/07/16          ..C............T....A .TA......... ..G..T............ ..G..C..A.....GT. .A...A.A.. ....A..T.G..C.. ..AA. .....G...  
                      53 >A/Australia/9/2009/07/20          ..C............T....A .TA......... ..G..T............ ..G..C..A.....GT. .A...A.A.. ....A..T.G..C.. ..AA. .....G...  
                      54 >A/Australia/4/2009/07/17          ....................A .T.......... ..G............... ..G..C..A......T. .A...A.A.. ....A....G..C.. ..AA. .....G...  
                      55 >A/Australia/64/2009/08/03         .................A..A GT....A..... ..G............... .TG..C..A......T. .A...A.A.. ....A....G..C.. ..AA. .....G...  
                      56 >A/Australia/65/2009/08/03         .................A..A GT....A..... ..G............... .TG..C..A......T. .A...A.A.. ....A....G..C.. ..AA. .....G...  
                      57 >A/Australia/35/2009/07/24         ....................A .T.......... ..G............... ..G..C..A......T. .A...A.A.. ....A....G..C.. ..AA. .....G...  
                      58 >A/Australia/59/2009/08/02         ......G.............A .T.......... ..G............... ..G..C..A......T. .A...A.A.. ....A....G..C.. ..AA. .....G...  
                      59 >A/Australia/72/2009/08/10         ......G.............A .T.......... ..G............... ..G..C..A......T. .A...A.A.. ....A....G..C.. ..AA. .....G...  
                      60 >A/Australia/57/2009/08/01         ....................A .T.......... ..G............... ..G..C..A......T. .A...A.A.. ....A....G..C.. ..AA. .....G...  
                      61 >A/Australia/27/2009/07/22         ....................A .T.......... ..G............... ..G..C..A......T. .A...A.A.. ....A....G..C.T ..AA. ....GG...  
                      62 >A/Australia/70/2009/08/06         ....................A .T.A......C. ..G............... ..G..C..A......T. .A...A.A.. ....A....G..C.T ..AA. .....G...  
                      63 >A/Australia/7/2009/07/18          ....................A .T.A......C. ..G............... ..G..C.AA......T. .A...A.A.. ....A....G..CG. ..AA. .....G...  
                      64 >A/Australia/73/2009/08/12         ....................A .T.A..A...C. ..G............... ..G..C.AA......T. .A...A.A.. ....A....G..CG. ..AA. ....GG...  
                      65 >A/Australia/51/2009/07/28         ....................A .T.A......C. ..G............... ..G..C..A......T. .A...A.A.. ....A....G..CG. ..AA. .....G...  
                      66 >A/Australia/21/2009/07/21         ....................A .T.A......C. ..G............... ..G..C..A......T. .A...A.A.. ....A....G..CG. ..AA. .....G...  
                      67 >A/Australia/60/2009/08/02         ........T...........A .T.A......C. ..G............... ..G..C..A......T. .A...A.A.. ....A....G..CG. ..AA. .....G...  
                      68 >A/Australia/82/2009/09/02         ....A....TA.G.G.....A .T.A....A.C. ..G.......GA...... ..G..C..A......T. .A..CAGA.. ....A....GC.CG. ..AA. ..G......  
                      69 >A/Australia/81/2009/09/02         ....A....TA.G.G.....A .T.A....A.C. ..G.......GA...... ..G..C..A......T. .A..CAGA.. ....A....GC.CG. ..AA. ..G......  
                      70 >A/Cancun-NY/Index/2009/04/15      ....................A ............ .................. ........A......T. .A...A.A.. ....A....G..... ..AA. .....G...  
                                                                                                                                                                                
                    ---Index--------------------------------GTTGTAACCAGTAGACAGAGG ACGGATGTGGTG GGACTCGGAAAGGAGGGG AGATGTGGTGATGGACC AGCCTGAGGA CAAAGGCCAATATAC AAGGA TGAAAAGCG  
                    -codon-position-------------------------1     2    2 1 221 2    1   2    1 11 1  2   2  2     2221  1112   1 1  11  1   2      1    1 2           21  112   
                                                            000000000011111111112 000000111112 000000011111111122 00000000000001111 0000111111 000000000000011 00000 000000000  
                                                            123334478911245566771 145668001291 023366702366788901 02333556666992344 1247011244 000233446799912 14467 222233566  
                                                            740034784645781967666 341009896658 496704212017746254 27069154566398202 8924347499 117313781467976 02902 368936245  
                                                            890361030397235578793 874394221602 083035274834019358 92840990856332382 7861639867 255163108234033 23209 130167044

                    Australia substrain with
                    C447T(2),A363G(3),A308G(4),T519C(4),T990C(6)

                    123-46??? reassorted are 54,10,69

                    also seen in A/Gifu-C/67/2009/07/07 (Japan)

                    >A/Gifu-C/67/2009/07/07,
                    A751G(1),G1173A(1),G2163A(1),C447T(2),G603A(2),T19 50C(2),A363G(3),G375A(3),
                    A308G(4),T519C(4),T658A(4),C1408T(4),G1552A(4),G29 8A(5),G1143A(5),G1248A(5),
                    G316A(6),A742G(6),T990C(6),A1173G(6),G492A(7),G600 A(7),A367G(8),

                    <-- A/NY/3420/2009/05/13
                    I'm interested in expert panflu damage estimates
                    my current links: http://bit.ly/hFI7H ILI-charts: http://bit.ly/CcRgT

                    Comment


                    • Re: Sequences at Genbank!

                      I'm updating my whole big ****** database now (from genbank)
                      2796 viruses, 1185 with almost full genome


                      for first mutation pictures see here:
                      I'm interested in expert panflu damage estimates
                      my current links: http://bit.ly/hFI7H ILI-charts: http://bit.ly/CcRgT

                      Comment


                      • Re: Sequences at Genbank!

                        About this chart....

                        What does the average number of mutations mean? Is this to be expected now that we are 1 year from the start of the pandemic last year?




                        number of acuired mutations in ****** over time :

                        Comment


                        • Re: Sequences at Genbank!

                          average number of nucleotide-differences of the genomes
                          from the assumed Index at creation ~early 2009

                          the collection dates are different, most are early sequences with
                          few mutations.

                          horizontal lines are 0,10,20,30,40 mutations

                          The Cancun (index) virus had 11 mutations in early April already,
                          maybe I can make the same graph for Cancun viruses only


                          it's clear now, that ****** doesn't mutate much faster than old seasonal flu
                          (~35 mutations per genome per year).
                          Earlier estimates i.e. by the English group gave much higher mutation-rate etimates.

                          this is work in progress, I may change the picture...
                          I'm interested in expert panflu damage estimates
                          my current links: http://bit.ly/hFI7H ILI-charts: http://bit.ly/CcRgT

                          Comment


                          • Re: Sequences at Genbank!

                            Thanks gs.

                            Comment


                            • Re: Sequences at Genbank!

                              3 Saskatchewan viruses in humans with triple-reassortant swine
                              are available now, whole genomes.
                              Also lots of H3 from 2002, maybe a new insight how Fujian-flu
                              developed ...(the anchestor of (almost)all H3N2 since 2004)

                              the current first isolate is HK/24044 from early June 2002
                              ----edit---- no new Fujian-flu origin found------------
                              ---edit---- again many new H3N2 fro Hong Kong

                              -------------------------

                              thread here:

                              HA,NA are Brisbane-like
                              the other segments mutated away from triple-reassortant-swine(1998)
                              at a similar rate as ****** did


                              differences in promille:
                              Code:
                                1 >A/Sw/Index/triple-reassortant/1998(H3N2)   2280 2274 2151    3 1497    3  982  844   
                                1:  0,  0,  0,---,  0,---,  0,  0   A/Sw/Index/triple-reassortant/1998(H3N2)   2280 2274 2151    3 1497    3  982  844
                                2: 33, 25, 31,---, 28,---, 21, 26   A/Saskatchewan/5131/2009/06/19(H1N1)       2308 2309 2200 1741 1529 1426  992  855
                                3: 33, 24, 30,---, 28,---, 21, 24   A/Saskatchewan/5350/2009/06/18(H1N1)       2308 2309 2200 1741 1529 1426  992  855
                                4: 33, 25, 30,---, 28,---, 21, 24   A/Saskatchewan/5351/2009/06/18(H1N1)       2308 2309 2200 1741 1529 1426  992  855
                                5:157,189,162,---,147,---,111,160   A/Kansas/UR06-0068/2007(H1N1)              2280 2274 2151 1698 1497 1413  982  838
                                6:142,181,156,---,145,---, 89,138   A/Index/1977(H1N1)                         2280 2274 2151 1701 1497 1413  982  838
                                7: 28, 31, 33,---, 29,---,115, 34   A/******/index/2009/02/01                  2280 2274 2151 1701 1497 1410  982  838
                                8:157,188,161,---,146,---,114,151   A/New Caledonia/20/1999///                 2280 2274 2151 1698 1497 1413  982  838
                                9:157,189,162,---,147,---,111,160   A/Kansas/UR06-0068/2007(H1N1)              2280 2274 2151 1698 1497 1413  982  838
                               10:---,---,---,---,---,---,115,---   A/Solomon Islands/3/2006/08/21/               3    3    3 1698    3 1372  982    3
                               11:---,---,---,---,---,---,115,---   A/Brisbane/59/2007/07/01/                     3    3    3 1698    3 1402  979    3
                              
                                2 >A/Saskatchewan/5131/2009/06/19(H1N1)       2308 2309 2200 1741 1529 1426  992  855   
                                1: 33, 25, 31,---, 28,---, 21, 26   A/Sw/Index/triple-reassortant/1998(H3N2)   2280 2274 2151    3 1497    3  982  844
                                2:  0,  0,  0,  0,  0,  0,  0,  0   A/Saskatchewan/5131/2009/06/19(H1N1)       2308 2309 2200 1741 1529 1426  992  855
                                3:  0,  1,  0,  0,  0,  1,  0,  1   A/Saskatchewan/5350/2009/06/18(H1N1)       2308 2309 2200 1741 1529 1426  992  855
                                4:  0,  0,  0,  1,  0,  0,  0,  1   A/Saskatchewan/5351/2009/06/18(H1N1)       2308 2309 2200 1741 1529 1426  992  855
                                5:168,191,170, 35,157, 33,116,172   A/Kansas/UR06-0068/2007(H1N1)              2280 2274 2151 1698 1497 1413  982  838
                                6:154,181,163, 78,152, 88, 95,151   A/Index/1977(H1N1)                         2280 2274 2151 1701 1497 1413  982  838
                                7: 55, 54, 58,239, 50,218,121, 52   A/******/index/2009/02/01                  2280 2274 2151 1701 1497 1410  982  838
                                8:169,190,168, 31,157, 27,120,165   A/New Caledonia/20/1999///                 2280 2274 2151 1698 1497 1413  982  838
                                9:168,191,170, 35,157, 33,116,172   A/Kansas/UR06-0068/2007(H1N1)              2280 2274 2151 1698 1497 1413  982  838
                               10:---,---,---, 21,---, 29,119,---   A/Solomon Islands/3/2006/08/21/               3    3    3 1698    3 1372  982    3
                               11:---,---,---,  7,---, 10,122,---   A/Brisbane/59/2007/07/01/                     3    3    3 1698    3 1402  979    3
                              
                                3 >A/Saskatchewan/5350/2009/06/18(H1N1)       2308 2309 2200 1741 1529 1426  992  855   
                                1: 33, 24, 30,---, 28,---, 21, 24   A/Sw/Index/triple-reassortant/1998(H3N2)   2280 2274 2151    3 1497    3  982  844
                                2:  0,  1,  0,  0,  0,  1,  0,  1   A/Saskatchewan/5131/2009/06/19(H1N1)       2308 2309 2200 1741 1529 1426  992  855
                                3:  0,  0,  0,  0,  0,  0,  0,  0   A/Saskatchewan/5350/2009/06/18(H1N1)       2308 2309 2200 1741 1529 1426  992  855
                                4:  0,  0,  0,  1,  0,  0,  0,  0   A/Saskatchewan/5351/2009/06/18(H1N1)       2308 2309 2200 1741 1529 1426  992  855
                                5:167,192,169, 35,157, 33,116,171   A/Kansas/UR06-0068/2007(H1N1)              2280 2274 2151 1698 1497 1413  982  838
                                6:153,181,162, 78,152, 88, 95,150   A/Index/1977(H1N1)                         2280 2274 2151 1701 1497 1413  982  838
                                7: 55, 53, 58,239, 50,218,121, 51   A/******/index/2009/02/01                  2280 2274 2151 1701 1497 1410  982  838
                                8:168,190,167, 31,157, 27,120,164   A/New Caledonia/20/1999///                 2280 2274 2151 1698 1497 1413  982  838
                                9:167,192,169, 35,157, 33,116,171   A/Kansas/UR06-0068/2007(H1N1)              2280 2274 2151 1698 1497 1413  982  838
                               10:---,---,---, 21,---, 29,119,---   A/Solomon Islands/3/2006/08/21/               3    3    3 1698    3 1372  982    3
                               11:---,---,---,  7,---, 10,122,---   A/Brisbane/59/2007/07/01/                     3    3    3 1698    3 1402  979    3
                              
                                4 >A/Saskatchewan/5351/2009/06/18(H1N1)       2308 2309 2200 1741 1529 1426  992  855   
                                1: 33, 25, 30,---, 28,---, 21, 24   A/Sw/Index/triple-reassortant/1998(H3N2)   2280 2274 2151    3 1497    3  982  844
                                2:  0,  0,  0,  1,  0,  0,  0,  1   A/Saskatchewan/5131/2009/06/19(H1N1)       2308 2309 2200 1741 1529 1426  992  855
                                3:  0,  0,  0,  1,  0,  0,  0,  0   A/Saskatchewan/5350/2009/06/18(H1N1)       2308 2309 2200 1741 1529 1426  992  855
                                4:  0,  0,  0,  0,  0,  0,  0,  0   A/Saskatchewan/5351/2009/06/18(H1N1)       2308 2309 2200 1741 1529 1426  992  855
                                5:168,191,169, 36,157, 33,116,171   A/Kansas/UR06-0068/2007(H1N1)              2280 2274 2151 1698 1497 1413  982  838
                                6:153,181,162, 79,152, 87, 95,150   A/Index/1977(H1N1)                         2280 2274 2151 1701 1497 1413  982  838
                                7: 55, 54, 58,240, 50,217,121, 51   A/******/index/2009/02/01                  2280 2274 2151 1701 1497 1410  982  838
                                8:168,190,167, 32,157, 26,120,164   A/New Caledonia/20/1999///                 2280 2274 2151 1698 1497 1413  982  838
                                9:168,191,169, 36,157, 33,116,171   A/Kansas/UR06-0068/2007(H1N1)              2280 2274 2151 1698 1497 1413  982  838
                               10:---,---,---, 22,---, 28,119,---   A/Solomon Islands/3/2006/08/21/               3    3    3 1698    3 1372  982    3
                               11:---,---,---,  8,---,  9,122,---   A/Brisbane/59/2007/07/01/                     3    3    3 1698    3 1402  979    3
                              
                                5 >A/Kansas/UR06-0068/2007(H1N1)              2280 2274 2151 1698 1497 1413  982  838   
                                1:157,189,162,---,147,---,111,160   A/Sw/Index/triple-reassortant/1998(H3N2)   2280 2274 2151    3 1497    3  982  844
                                2:168,191,170, 35,157, 33,116,172   A/Saskatchewan/5131/2009/06/19(H1N1)       2308 2309 2200 1741 1529 1426  992  855
                                3:167,192,169, 35,157, 33,116,171   A/Saskatchewan/5350/2009/06/18(H1N1)       2308 2309 2200 1741 1529 1426  992  855
                                4:168,191,169, 36,157, 33,116,171   A/Saskatchewan/5351/2009/06/18(H1N1)       2308 2309 2200 1741 1529 1426  992  855
                                5:  0,  0,  0,  0,  0,  0,  0,  0   A/Kansas/UR06-0068/2007(H1N1)              2280 2274 2151 1698 1497 1413  982  838
                                6: 53, 57, 51, 75, 44, 78, 39, 56   A/Index/1977(H1N1)                         2280 2274 2151 1701 1497 1413  982  838
                                7:164,192,171,235,157,216,125,179   A/******/index/2009/02/01                  2280 2274 2151 1701 1497 1410  982  838
                                8: 20, 15, 13, 21, 14, 14, 12, 17   A/New Caledonia/20/1999///                 2280 2274 2151 1698 1497 1413  982  838
                                9:  0,  0,  0,  0,  0,  0,  0,  0   A/Kansas/UR06-0068/2007(H1N1)              2280 2274 2151 1698 1497 1413  982  838
                               10:---,---,---, 30,---, 26, 13,---   A/Solomon Islands/3/2006/08/21/               3    3    3 1698    3 1372  982    3
                               11:---,---,---, 35,---, 29,  7,---   A/Brisbane/59/2007/07/01/                     3    3    3 1698    3 1402  979    3
                              
                                6 >A/Index/1977(H1N1)                         2280 2274 2151 1701 1497 1413  982  838   
                                1:142,181,156,---,145,---, 89,138   A/Sw/Index/triple-reassortant/1998(H3N2)   2280 2274 2151    3 1497    3  982  844
                                2:154,181,163, 78,152, 88, 95,151   A/Saskatchewan/5131/2009/06/19(H1N1)       2308 2309 2200 1741 1529 1426  992  855
                                3:153,181,162, 78,152, 88, 95,150   A/Saskatchewan/5350/2009/06/18(H1N1)       2308 2309 2200 1741 1529 1426  992  855
                                4:153,181,162, 79,152, 87, 95,150   A/Saskatchewan/5351/2009/06/18(H1N1)       2308 2309 2200 1741 1529 1426  992  855
                                5: 53, 57, 51, 75, 44, 78, 39, 56   A/Kansas/UR06-0068/2007(H1N1)              2280 2274 2151 1698 1497 1413  982  838
                                6:  0,  0,  0,  0,  0,  0,  0,  0   A/Index/1977(H1N1)                         2280 2274 2151 1701 1497 1413  982  838
                                7:147,182,165,222,151,192,106,157   A/******/index/2009/02/01                  2280 2274 2151 1701 1497 1410  982  838
                                8: 41, 47, 42, 61, 34, 67, 35, 42   A/New Caledonia/20/1999///                 2280 2274 2151 1698 1497 1413  982  838
                                9: 53, 57, 51, 75, 44, 78, 39, 56   A/Kansas/UR06-0068/2007(H1N1)              2280 2274 2151 1698 1497 1413  982  838
                               10:---,---,---, 74,---, 79, 41,---   A/Solomon Islands/3/2006/08/21/               3    3    3 1698    3 1372  982    3
                               11:---,---,---, 80,---, 82, 44,---   A/Brisbane/59/2007/07/01/                     3    3    3 1698    3 1402  979    3
                              
                                7 >A/******/index/2009/02/01                  2280 2274 2151 1701 1497 1410  982  838   
                                1: 28, 31, 33,---, 29,---,115, 34   A/Sw/Index/triple-reassortant/1998(H3N2)   2280 2274 2151    3 1497    3  982  844
                                2: 55, 54, 58,239, 50,218,121, 52   A/Saskatchewan/5131/2009/06/19(H1N1)       2308 2309 2200 1741 1529 1426  992  855
                                3: 55, 53, 58,239, 50,218,121, 51   A/Saskatchewan/5350/2009/06/18(H1N1)       2308 2309 2200 1741 1529 1426  992  855
                                4: 55, 54, 58,240, 50,217,121, 51   A/Saskatchewan/5351/2009/06/18(H1N1)       2308 2309 2200 1741 1529 1426  992  855
                                5:164,192,171,235,157,216,125,179   A/Kansas/UR06-0068/2007(H1N1)              2280 2274 2151 1698 1497 1413  982  838
                                6:147,182,165,222,151,192,106,157   A/Index/1977(H1N1)                         2280 2274 2151 1701 1497 1413  982  838
                                7:  0,  0,  0,  0,  0,  0,  0,  0   A/******/index/2009/02/01                  2280 2274 2151 1701 1497 1410  982  838
                                8:165,189,171,236,157,209,121,170   A/New Caledonia/20/1999///                 2280 2274 2151 1698 1497 1413  982  838
                                9:164,192,171,235,157,216,125,179   A/Kansas/UR06-0068/2007(H1N1)              2280 2274 2151 1698 1497 1413  982  838
                               10:---,---,---,235,---,218,124,---   A/Solomon Islands/3/2006/08/21/               3    3    3 1698    3 1372  982    3
                               11:---,---,---,241,---,217,129,---   A/Brisbane/59/2007/07/01/                     3    3    3 1698    3 1402  979    3
                              
                                8 >A/New Caledonia/20/1999///                 2280 2274 2151 1698 1497 1413  982  838   
                                1:157,188,161,---,146,---,114,151   A/Sw/Index/triple-reassortant/1998(H3N2)   2280 2274 2151    3 1497    3  982  844
                                2:169,190,168, 31,157, 27,120,165   A/Saskatchewan/5131/2009/06/19(H1N1)       2308 2309 2200 1741 1529 1426  992  855
                                3:168,190,167, 31,157, 27,120,164   A/Saskatchewan/5350/2009/06/18(H1N1)       2308 2309 2200 1741 1529 1426  992  855
                                4:168,190,167, 32,157, 26,120,164   A/Saskatchewan/5351/2009/06/18(H1N1)       2308 2309 2200 1741 1529 1426  992  855
                                5: 20, 15, 13, 21, 14, 14, 12, 17   A/Kansas/UR06-0068/2007(H1N1)              2280 2274 2151 1698 1497 1413  982  838
                                6: 41, 47, 42, 61, 34, 67, 35, 42   A/Index/1977(H1N1)                         2280 2274 2151 1701 1497 1413  982  838
                                7:165,189,171,236,157,209,121,170   A/******/index/2009/02/01                  2280 2274 2151 1701 1497 1410  982  838
                                8:  0,  0,  0,  0,  0,  0,  0,  0   A/New Caledonia/20/1999///                 2280 2274 2151 1698 1497 1413  982  838
                                9: 20, 15, 13, 21, 14, 14, 12, 17   A/Kansas/UR06-0068/2007(H1N1)              2280 2274 2151 1698 1497 1413  982  838
                               10:---,---,---, 22,---, 19, 13,---   A/Solomon Islands/3/2006/08/21/               3    3    3 1698    3 1372  982    3
                               11:---,---,---, 29,---, 21, 17,---   A/Brisbane/59/2007/07/01/                     3    3    3 1698    3 1402  979    3
                              
                                9 >A/Kansas/UR06-0068/2007(H1N1)              2280 2274 2151 1698 1497 1413  982  838   
                                1:157,189,162,---,147,---,111,160   A/Sw/Index/triple-reassortant/1998(H3N2)   2280 2274 2151    3 1497    3  982  844
                                2:168,191,170, 35,157, 33,116,172   A/Saskatchewan/5131/2009/06/19(H1N1)       2308 2309 2200 1741 1529 1426  992  855
                                3:167,192,169, 35,157, 33,116,171   A/Saskatchewan/5350/2009/06/18(H1N1)       2308 2309 2200 1741 1529 1426  992  855
                                4:168,191,169, 36,157, 33,116,171   A/Saskatchewan/5351/2009/06/18(H1N1)       2308 2309 2200 1741 1529 1426  992  855
                                5:  0,  0,  0,  0,  0,  0,  0,  0   A/Kansas/UR06-0068/2007(H1N1)              2280 2274 2151 1698 1497 1413  982  838
                                6: 53, 57, 51, 75, 44, 78, 39, 56   A/Index/1977(H1N1)                         2280 2274 2151 1701 1497 1413  982  838
                                7:164,192,171,235,157,216,125,179   A/******/index/2009/02/01                  2280 2274 2151 1701 1497 1410  982  838
                                8: 20, 15, 13, 21, 14, 14, 12, 17   A/New Caledonia/20/1999///                 2280 2274 2151 1698 1497 1413  982  838
                                9:  0,  0,  0,  0,  0,  0,  0,  0   A/Kansas/UR06-0068/2007(H1N1)              2280 2274 2151 1698 1497 1413  982  838
                               10:---,---,---, 30,---, 26, 13,---   A/Solomon Islands/3/2006/08/21/               3    3    3 1698    3 1372  982    3
                               11:---,---,---, 35,---, 29,  7,---   A/Brisbane/59/2007/07/01/                     3    3    3 1698    3 1402  979    3
                              
                               10 >A/Solomon Islands/3/2006/08/21/               3    3    3 1698    3 1372  982    3   
                                1:---,---,---,---,---,---,115,---   A/Sw/Index/triple-reassortant/1998(H3N2)   2280 2274 2151    3 1497    3  982  844
                                2:---,---,---, 21,---, 29,119,---   A/Saskatchewan/5131/2009/06/19(H1N1)       2308 2309 2200 1741 1529 1426  992  855
                                3:---,---,---, 21,---, 29,119,---   A/Saskatchewan/5350/2009/06/18(H1N1)       2308 2309 2200 1741 1529 1426  992  855
                                4:---,---,---, 22,---, 28,119,---   A/Saskatchewan/5351/2009/06/18(H1N1)       2308 2309 2200 1741 1529 1426  992  855
                                5:---,---,---, 30,---, 26, 13,---   A/Kansas/UR06-0068/2007(H1N1)              2280 2274 2151 1698 1497 1413  982  838
                                6:---,---,---, 74,---, 79, 41,---   A/Index/1977(H1N1)                         2280 2274 2151 1701 1497 1413  982  838
                                7:---,---,---,235,---,218,124,---   A/******/index/2009/02/01                  2280 2274 2151 1701 1497 1410  982  838
                                8:---,---,---, 22,---, 19, 13,---   A/New Caledonia/20/1999///                 2280 2274 2151 1698 1497 1413  982  838
                                9:---,---,---, 30,---, 26, 13,---   A/Kansas/UR06-0068/2007(H1N1)              2280 2274 2151 1698 1497 1413  982  838
                               10:---,---,---,  0,---,  0,  0,---   A/Solomon Islands/3/2006/08/21/               3    3    3 1698    3 1372  982    3
                               11:---,---,---, 20,---, 21, 16,---   A/Brisbane/59/2007/07/01/                     3    3    3 1698    3 1402  979    3
                              
                               11 >A/Brisbane/59/2007/07/01/                     3    3    3 1698    3 1402  979    3   
                                1:---,---,---,---,---,---,115,---   A/Sw/Index/triple-reassortant/1998(H3N2)   2280 2274 2151    3 1497    3  982  844
                                2:---,---,---,  7,---, 10,122,---   A/Saskatchewan/5131/2009/06/19(H1N1)       2308 2309 2200 1741 1529 1426  992  855
                                3:---,---,---,  7,---, 10,122,---   A/Saskatchewan/5350/2009/06/18(H1N1)       2308 2309 2200 1741 1529 1426  992  855
                                4:---,---,---,  8,---,  9,122,---   A/Saskatchewan/5351/2009/06/18(H1N1)       2308 2309 2200 1741 1529 1426  992  855
                                5:---,---,---, 35,---, 29,  7,---   A/Kansas/UR06-0068/2007(H1N1)              2280 2274 2151 1698 1497 1413  982  838
                                6:---,---,---, 80,---, 82, 44,---   A/Index/1977(H1N1)                         2280 2274 2151 1701 1497 1413  982  838
                                7:---,---,---,241,---,217,129,---   A/******/index/2009/02/01                  2280 2274 2151 1701 1497 1410  982  838
                                8:---,---,---, 29,---, 21, 17,---   A/New Caledonia/20/1999///                 2280 2274 2151 1698 1497 1413  982  838
                                9:---,---,---, 35,---, 29,  7,---   A/Kansas/UR06-0068/2007(H1N1)              2280 2274 2151 1698 1497 1413  982  838
                               10:---,---,---, 20,---, 21, 16,---   A/Solomon Islands/3/2006/08/21/               3    3    3 1698    3 1372  982    3
                               11:---,---,---,  0,---,  0,  0,---   A/Brisbane/59/2007/07/01/                     3    3    3 1698    3 1402  979    3
                              I'm interested in expert panflu damage estimates
                              my current links: http://bit.ly/hFI7H ILI-charts: http://bit.ly/CcRgT

                              Comment


                              • Re: Sequences at Genbank!

                                swine

                                Code:
                                                                                2   0000000000000000000000000000000111111111 000111 000000000001111 00000000000 0 
                                                                                1   0000123334555666677888888999999001111234 123112 111222237790113 14555666899 3 
                                                                                6   1249553497139345909578899002335152478810 598144 445237812498090 39125068801 6 
                                                                                3   9223403098518938096292518024465228015188 989838 237606369250446 82985039340 7 
                                -codon-position---------------------------------    11  11 1 12 1 11 11     1 2 1 112  1  11  122   12112 11 12   1        2111 1 
                                ---Index----------------------------------------G   GCCCGTTGAAGGTTTTAGGTTATGAGGAAAAGCACGAAGC TGCCGG ACGGGCAGCACGAGA AGCAGGTAGGA A 
                                   1 >A/******/index/2009/02/01                 .   ........................................ ...... ............... ........... .        0      0 ,      0      0       1:>A/******/index/2009/02/01                 
                                   2 >A/Sw/4/Mexico/2009/04/                    .   ............C........................... G..... ............... ........... .       37      2 ,     37      2       2:>A/Sw/4/Mexico/2009/04/                    
                                   3 >A/Sw/ALB/OTH-33-14/2009/05/05             -   ---------------------------------------- ...T.. ......G........ ........... -      210     44 ,      4      2       3:>A/Sw/ALB/OTH-33-14/2009/05/05             
                                   4 >A/Sw/ALB/OTH-33-22/2009/05/05             -   ---------------------------------------- ...T.. ......G........ ...G....... -      214     45 ,      8      3       4:>A/Sw/ALB/OTH-33-22/2009/05/05             
                                   5 >A/Sw/ALB/OTH-33-25/2009/05/02             -   ---------------------------------------- ------ ......G........ .........A. -      242     50 ,      3      2       5:>A/Sw/ALB/OTH-33-25/2009/05/02             
                                   6 >A/Sw/ALB/OTH-33-7/2009/05/05              -   AA...................................... ------ ......G........ .........A. -      144     12 ,     15      4       6:>A/Sw/ALB/OTH-33-7/2009/05/05              
                                   7 >A/Sw/ALB/OTH-33-3/2009/05/03              -   AA...................................... ..TT.. ......G........ .......G... -      113      8 ,     17      6       7:>A/Sw/ALB/OTH-33-3/2009/05/03              
                                   8 >A/Sw/ALB/OTH-33-1/2009/05/03              -   AA...C.............C.................... ...T.. ......G........ .......G... -      110      9 ,     14      7       8:>A/Sw/ALB/OTH-33-1/2009/05/03              
                                   9 >A/Sw/ALB/OTH-33-21/2009/05/05             -   AA...C..........GA..........G........... ------ ......G........ ........... -      139     15 ,     10      7       9:>A/Sw/ALB/OTH-33-21/2009/05/05             
                                  10 >A/Sw/ALB/OTH-33-24/2009/05/03             -   AA..............GA...................... ...T.. ......G........ ........... -      110      8 ,     14      6      10:>A/Sw/ALB/OTH-33-24/2009/05/03             
                                  11 >A/Sw/ALB/OTH-33-23/2009/05/03             -   AA...................................... ...T.. ......G....A... ........... -      108      7 ,     12      5      11:>A/Sw/ALB/OTH-33-23/2009/05/03             
                                  12 >A/Sw/ALB/OTH-33-2/2009/05/03              -   AA............A............G....T....... A.TT.. ......G........ ........... -      111     11 ,     15      9      12:>A/Sw/ALB/OTH-33-2/2009/05/03              
                                  13 >A/Sw/ALB/OTH-33-8/2009//                  .   AA............A............G....T....... ...T.. ......G........ ........... .       42      7 ,     42      7      13:>A/Sw/ALB/OTH-33-8/2009//                  
                                  14 >A/Sw/IA/35572/2009/12/16                  -   .......................................T ------ .......A.G...A. ........... -      142     12 ,     13      4      14:>A/Sw/IA/35572/2009/12/16                  
                                  15 >A/turkey/Chile/28317-6504-3/2009/08/17    A   ...............A.......................T .A..AA .......A.G..... .A...A..... G       28     11 ,     24     11      15:>A/turkey/Chile/28317-6504-3/2009/08/17    
                                  16 >A/Sw/Osaka/1/2009/10/                     -   ...............A.......................T ------ .......A.G..... ----------- -      182     23 ,      7      4      16:>A/Sw/Osaka/1/2009/10/                     
                                  17 >A/Sw/IA/35573/2009/12/16                  -   ..T.....G......A.......................T ------ ....AT.A.G..G.. GA...A....G -      145     21 ,     16     13      17:>A/Sw/IA/35573/2009/12/16                  
                                  18 >A/Sw/IL/5265-2/2010/01/25                 -   ..T.....GG..C..A..A....................T ------ ....AT.A.G..G.. GA...A....G -      145     24 ,     16     16      18:>A/Sw/IL/5265-2/2010/01/25                 
                                  19 >A/Sw/IL/5265-1/2010/01/25                 -   ..T.....GG..C..A..A....................T ------ ....AT.A.G..G.. GA...A....G -      145     24 ,     16     16      19:>A/Sw/IL/5265-1/2010/01/25                 
                                  20 >A/Sw/IL/02957/2010/01/26                  -   ..T.....GG..C..A..A.CGGACA-------------- ------ --------------- ----------- -      312     60 ,     12     12      20:>A/Sw/IL/02957/2010/01/26                  
                                  21 >A/Sw/IL/02960/2010/01/25                  -   ..T.....GG..C..A..A.-------------------- ------ --------------- ----------- -      320     60 ,     11      6      21:>A/Sw/IL/02960/2010/01/25                  
                                  22 >A/Sw/Taiwan/TD-4119B2/2009/11/04          A   ...............A.......................T AA..AA .......A.G.A... .A...A..... G       46     13 ,     46     13      22:>A/Sw/Taiwan/TD-4119B2/2009/11/04          
                                  23 >A/cat/PA/30187/2009/11/07                 -   ...............A........G..............T ------ .......A.G..... .A...A..... -      142     15 ,     13      7      23:>A/cat/PA/30187/2009/11/07                 
                                  24 >A/cat/IA/26991/2009//                     -   ...............A.......................T ------ .......A.G..... .A...A..... -      146     14 ,     17      6      24:>A/cat/IA/26991/2009//                     
                                  25 >A/Sw/Singapore-Q/M168/2009/08/            A   ...............A.......................T .A..AA .......A.G..... .A...A..... G       26     11 ,     23     11      25:>A/Sw/Singapore-Q/M168/2009/08/            
                                  26 >A/Sw/NC/34543/2009/11/24                  -   .......A.......A...C...................T ------ .......A.G..... .A...A..... -      140     16 ,     11      8      26:>A/Sw/NC/34543/2009/11/24                  
                                  27 >A/Sw/Argentina/SAGiles-31215/2009/06/24   -   ...............A.......A.......A.......T AA..AA .......A.G..... .A...A..--- G       91     17 ,     17     13      27:>A/Sw/Argentina/SAGiles-31215/2009/06/24   
                                  28 >A/Sw/Indiana/27007/2009//                 -   ...............A.....................G.T ------ .......A.G..... .A...A..A.. -      138     16 ,      9      8      28:>A/Sw/Indiana/27007/2009//                 
                                  29 >A/Sw/IL/32974/2009/11/11                  -   ...............A.....................G.T ------ .......A....... .A...A..A.. -      138     15 ,      9      7      29:>A/Sw/IL/32974/2009/11/11                  
                                  30 >A/ferret/OR/23775/2009/10/05              -   ......C........A.....................G.T ------ .......A.G..... .A...A..... -      140     16 ,     11      8      30:>A/ferret/OR/23775/2009/10/05              
                                  31 >A/Sw/NC/34752/2009/12/14                  -   ...............A............G........G.T ------ .......A.G..... .A...A..... -      144     16 ,     15      8      31:>A/Sw/NC/34752/2009/12/14                  
                                  32 >A/ferret/OR/27004/2009//                  -   ...A..C........A...................AG..T ------ .AA....A.G..... .A...A..... -      147     20 ,     15     12      32:>A/ferret/OR/27004/2009//                  
                                  33 >A/ferret/OR/27004-3/2009/10/23            -   ...A..C........A...................AG..T ------ .AA....A.G...A. .A...A..... -      142     21 ,     13     13      33:>A/ferret/OR/27004-3/2009/10/23            
                                  34 >A/cat/OR/29573/2009/11/09                 -   ...............A.......A...........A...T ------ .......A.GA..A. .A...A..... -      144     18 ,     15     10      34:>A/cat/OR/29573/2009/11/09                 
                                  35 >A/Sw/Italy/290271/2009/11/27              A   ...............A...............A...A...T .A..AA .......A.GA..A. .A...A..... G       47     15 ,     46     15      35:>A/Sw/Italy/290271/2009/11/27              
                                  36 >A/Sw/Minnesota/02979/2010/02/17           -   ....T..........A....-------------------- ------ --------------- ----------- -      313     56 ,      4      2      36:>A/Sw/Minnesota/02979/2010/02/17           
                                  37 >A/Sw/IL/10-001550/2009/12/29              -   ....T..........A..............G..T...GTT ------ ............... .A.GAAC.... -      142     20 ,     13     12      37:>A/Sw/IL/10-001550/2009/12/29              
                                  38 >A/Sw/Minnesota/02976/2010/01/12           -   ....T..........A.............CG..T...GTT ------ --------------- ----------- -      264     42 ,      8      8      38:>A/Sw/Minnesota/02976/2010/01/12           
                                  39 >A/Sw/IL/3910/2010/01/11                   -   ....T..........A.............CG..T...GTT ------ C..A...A.G....G .A.GAAC.... -      148     26 ,     19     18      39:>A/Sw/IL/3910/2010/01/11                   
                                  40 >A/Sw/MN/8762-2/2010/02/16                 -   ....T.....A....A..............G..T...GTT ------ C..A...A.G....G .A.GAAC.... -      147     26 ,     18     18      40:>A/Sw/MN/8762-2/2010/02/16                 
                                  41 >A/Sw/MN/8762-1/2010/02/16                 -   ....T.....A....A..............G..T...GTT ------ C..A...A.G....G .A.GAAC.... -      147     26 ,     18     18      41:>A/Sw/MN/8762-1/2010/02/16                 
                                  42 >A/Sw/MN/8761/2010/02/16                   -   ....T..........A.........A....G..T...GTT ------ C..A...A.G....G .A.GAAC.... -      151     26 ,     22     18      42:>A/Sw/MN/8761/2010/02/16                   
                                  43 >A/Sw/IL/02938/2009/12/29                  -   ....T..........A....C------------------- ------ --------------- ----------- -      310     56 ,      3      3      43:>A/Sw/IL/02938/2009/12/29                  
                                  44 >A/Sw/IL/02919/2009/11/12                  -   ...............A....CGGACAT------------- ------ --------------- ----------- -      306     55 ,      8      8      44:>A/Sw/IL/02919/2009/11/12                  
                                  45 >A/Sw/IL/02935/2009/12/20                  -   .............C.A....CGGACA-------------- ------ --------------- ----------- -      308     56 ,      8      8      45:>A/Sw/IL/02935/2009/12/20                  
                                  46 >A/Sw/IL/10-001551-1/2009/12/20            -   .............C.A..................TA...T ------ .......ATG...A. .AT..A..... -      143     20 ,     14     12      46:>A/Sw/IL/10-001551-1/2009/12/20            
                                  47 >A/Sw/IL/10-001551-2/2009/12/20            -   ...........A.C.A..................TA...T ------ .......ATG...A. .AT..A..... -      143     21 ,     14     13      47:>A/Sw/IL/10-001551-2/2009/12/20            
                                  48 >A/Sw/IL/02936/2009/12/20                  -   ...........A.C.A....CGGACA-------------- ------ --------------- ----------- -      309     57 ,      9      9      48:>A/Sw/IL/02936/2009/12/20                  
                                  49 >A/Sw/North Carolina/02926/2009/11/24      -   .......A.......A...CCGGACAT------------- ------ --------------- ----------- -      310     57 ,     14     10      49:>A/Sw/North Carolina/02926/2009/11/24      
                                  50 >A/Sw/North Carolina/02921/2009/11/25      -   .......A.......A...CCGGACA-------------- ------ --------------- ----------- -      308     57 ,      9      9      50:>A/Sw/North Carolina/02921/2009/11/25      
                                  51 >A/Cancun-NY/Index/2009/04/15              A   ...............A.......................T .A..AA .......A.G..... .A...A..... G       11     11 ,     11     11      51:>A/Cancun-NY/Index/2009/04/15              
                                                                                                                                                                  
                                ---Index----------------------------------------G   GCCCGTTGAAGGTTTTAGGTTATGAGGAAAAGCACGAAGC TGCCGG ACGGGCAGCACGAGA AGCAGGTAGGA A 
                                -codon-position---------------------------------    11  11 1 12 1 11 11     1 2 1 112  1  11  122   12112 11 12   1        2111 1 
                                                                                2   0000000000000000000000000000000111111111 000111 000000000001111 00000000000 0 
                                                                                1   0000123334555666677888888999999001111234 123112 111222237790113 14555666899 3 
                                                                                6   1249553497139345909578899002335152478810 598144 445237812498090 39125068801 6 
                                                                                3   9223403098518938096292518024465228015188 989838 237606369250446 82985039340 7
                                I'm interested in expert panflu damage estimates
                                my current links: http://bit.ly/hFI7H ILI-charts: http://bit.ly/CcRgT

                                Comment

                                Working...
                                X