Announcement

Collapse
No announcement yet.

PB1 F2 a single mutation ( HK 97 and 1918) increase virulence

Collapse
This is a sticky topic.
X
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • #16
    Re: PB1 F2 a single mutation ( HK 97 and 1918) increase virulence

    Code:
    >A/******/index/2009/02/01(H1N1)
    ATGGATGTCAATCCGACTCTACTTTTCCTAAAAATTCCAGCGCAAAATGCCATAAGCACCACATTCCCTTATACTGGAGATCCTCCATACAGCCATGGAACAGGAACAGGATACACCATGGACACAGTAAACAGAACACACCAATACTCAGAAAAGGGAAAGTGGACGACAAACACAGAGACTGGTGCACCCCAGCTCAACCCGATTGATGGACCACTACCTGAGGATAATGAACCAAGTGGGTATGCACAAACAGACTGTGTTCTAGAGGCTATGGCTTTCCTTGAAGAATCCCACCCAGGAATATTTGAGAATTCATGCCTTGAAACAATGGAAGTTGTTCAACAAACAAGGGTAGATAAACTAACTCAAGGTCGCCAGACTTATGATTGGACATTAAACAGAAATCAACCGGCAGCAACTGCATTGGCCAACACCATAGAAGTCTTTAGATCG...
    >A/Wisconsin/10/98(H1N1)
    ATGGATGTCAATCCGACTCTACTTTTCCTAAAAGTTCCAGCGCAAAATGCCATAAGCACCACATTCCCTTATACTGGAGATCCTCCATACAGCCATGGAACAGGAACAGGATACACCATGGACACAGTCAACAGAACACACCAATATTCAGAAAAGGGGAAGTGGACGACAAACACAGAGACTGGGGCACCCCAGCTCAACCCGATTGATGGACCACTACCTGAGGATAATGAACCAAGTGGATATGCACAAACAGACTGTGTTCTGGAGGCCATGGCTTTCCTTGAAGAATCCCACCCAGGGATATTTGAGAATTCATGCCTTGAAACAATGGAAGTTGTTCAACAAACAAGGGTGGATAAACTAACTCAAGGTCGCCAGACTTATGATTGGACATTGAACAGAAATCAACCGGCAGCAACTGCATTGGCCAACACCATAGAAGTTTTTAGATCG...
                                     x                                                                                              }                                                        x                                                        x                       }     x                             x                                                     }                                         x                                               x
                                 30                            60                            90                            120      129                  150                           180   186                     210                           240243                        270                           300                           330                           360   }                       390
    
    >A/mallard duck/South Dakota/Sg00125/2007(H3N2)
    ---------------ACTCTACTTTTTCTAAAGGTTCCAGCGCAAAATGCCATAAGCACCACATTCCCTTATACTGGAGATCCTCCATACAGCCATGGAACAGGAACAGGATACACCATGGACACAGTCAACAGAACACACCAATATTCAGAAAAAGGGAAGTGGACGACAAACACAGAGACTGGGGCACCCCAGCTCAACCCGATTGATGGACCACTACCTGAGGATAATGAACCAAGTGGATATGCACAAACAGACTGTGTTCTGGAGGCCATGGCTTTCCTTGAAGAATCCCACCCAGGGATATTTGAGAATTCATGCCTTGAAACAATGGAAGTTGTTCAACAAACAAGGGTGGATAAACTAACTCAAGGTCGCCAGACTTATGATTGGACATTAAACAGAAATCAACCGGCAGCAACTGCATTGGCCAACACCATAGAAGTTTTTAGATCG...
    
    
    
    >A/Brevig Mission/1/1918(H1N1)
    PB1,758,MDVNPTLLFLKVPAQNAISTTFPYTGDPPYSHGTGTGYTMDTVNRTHQYSEKGRWTTNTETGAPQLNPIDGPLPEDNEPSGYAQTDCVLEAMAFLEESHPGIFENSCLETMEVVQQTRVDKLTQGRQTYDWTLNRNQPAATALANTIEVFRSNGLTANESGRLIDFLKDVMESMDKEEMEITTHFQRKRRVRDNMTKKMVTQRTIGKKKQRLNKRSYLIRALTLNTMTKDAERGKLKRRAIATPGMQIRGFVYFVETLARSICEKLEQSGLPVGGNEKKAKLANVVRKMMTNSQDTELSFTITGDNTKWNENQNPRMFLAMITYITRNQPEWFRNVLSIAPIMFSNKMARLGKGYMFESKSMKLRTQIPAEMLASIDLKYFNDSTRKKIEKIRPLLIDGTASLSPGMMMGMFNMLSTVLGVSILNLGQKRYTKTTYWWDGLQSSDDFALIVNAPNHEGIQAGVDRFYRTCKLLGINMSKKKSYINRTGTFEFTSFFYRYGFVANFSMELPSFGVSGINESADMSIGVTVIKNNMINNDLGPATAQMALQLFIKDYRYTYRCHRGDTQIQTRRSFEIKKLWEQTRSKAGLLVSDGGPNLYNIRNLHIPEVCLKWELMDEDYQGRLCNPLNPFVSHKEIESVNNAVMMPAHGPAKNMEYDAVATTHSWIPKRNRSILNTSQRGILEDEQMYQKCCNLFEKFFPSSSYRRPVGISSMVEAMVSRARIDARIDFESGRIKKEEFAEIMKICSTIEELRRQK}
    PB1-F2,91,MGQEQDTPWILSTGHISTQKREDGQQTPRLEHHNSTRLMDHCQKTMNQVVMPKQIVYWKQWLSLRSPTPVSLKTRVLKRWRLFSKHEWTS}
    
    >A/******/index/2009-02-01
    PB1,757,  MDVNPTLLFLKIPAQNAISTTFPYTGDPPYSHGTGTGYTMDTVNRTHQYSEKGKWTTNTETGAPQLNPIDGPLPEDNEPSGYAQTDCVLEAMAFLEESHPGIFENSCLETMEVVQQTRVDKLTQGRQTYDWTLNRNQPAATALANTIEVFRSNGLTANESGRLIDFLKDVMESMNKEEIEITTHFQRKRRVRDNMTKKMVTQRTIGKKKQRLNKRGYLIRALTLNTMTKDAERGKLKRRAIATPGMQIRGFVYFVETLARSICEKLEQSGLPVGGNEKKAKLANVVRKMMTNSQDTEISFTITGDNTKWNENQNPRMFLAMITYITRNQPEWFRNILSMAPIMFSNKMARLGKGYMFESKRMKIRTQIPAEMLASIDLKYFNESTKKKIEKIRPLLIDGTASLSPGMMMGMFNMLSTVLGVSILNLGQKKYTKTIYWWDGLQSSDDFALIVNAPNHEGIQAGVDRFYRTCKLVGINMSKKKSYINKTGTFEFTSFFYRYGFVANFSMELPSFGVSGVNESADMSIGVTVIKNNMINNDLGPATAQMALQLFIKDYRYTYRCHRGDTQIQTRRSFELKKLWDQTQSKVGLLVSDGGPNLYNIRNLHIPEVCLKWELMDDDYRGRLCNPLNPFVSHKEIDSVNNAVVMPAHGPAKSMEYDAVATTHSWIPKRNRSILNTSQRGILEDEQMYQKCCNLFEKFFPSSSYRRPVGISSMVEAMVSRARIDARVDFESGRIKKEEFSEIMKICSTIEELRRQK}
    PB1-F2,90,MEQEQDTPWTQ}TEHTNTQKRESGRQTQRLVHPSSTRLMDHYLRIMNQVGMHKQTVF}RLWLSLKNPTQEYLRIHALKQWKLFNKQG}IN}
    
    >A/mallard duck/South Dakota/Sg00125/2007(H3N2)
    PB1:-----TLLFLKVPAQNAISTTFPYTGDPPYSHGTGTGYTMDTVNRTHQYSEKGKWTTNTETGAPQLNPIDGPLPEDNEPSGYAQTDCVLEAMAFLEESHPGIFENSCLETMEVVQQTRVDKLTQGRQTYDWTLNRNQPAATALANTIEVFRSNGLTANESGRLIDFLKDVMESMDKEEIEITTHFQRKRRVRDNMTKKMVTQRTIGKKKQRVNKRGYLIRALTLNTMTKDAERGKLKRRAIATPGMQIRGFVYFVETLARSICEKLEQSGLPVGGNEKKAKLANVVRKMMTNSQDTELSFTITGDNTKWNENQNPRMFLAMITYITRNQPEWFRNILSMAPIMFSNKMARLGKGYMFESKRMKLRTQIPAEMLASIDLKYFNESTRKKIEKIRPLLIDGTASLSPGMMMGMFNMLSTVLGVSILNLGQKKYTRTTYWWDGLQSSDDFALIVNAPNHEGIQAGVDRFYRTCKLVGINMSKKKSYINKTGTFEFTSFFYRYGFVANFSMELPSFGVSGINESADMSIGVTVIKNNMINNDLGPATAQMALQLFIKDYRYTYRCHRGDTQIQTRRSFELKKLWDQTQSKAGLLVSDGGPNLYNIRNLHIPEVCLKWELMDEDYRGRLCNPLNPFVSHKEIDSVNNAVVMPAHGPAKSMEYDAVATTHSWIPKRNRSILNTSQRGILEDEQMYQKCCNLFEKFFPSSSYRRPVGISSMVEAMVSRARIDARIDFESGRIKKEEFSEIMKICSTIEELRRQK}---------
    PB1-F2:MEQEQDTPWTQSTEHTNIQKKGSGRQTQRLGHPSSTRLMDHYLRIMNQVDMHKQTVFWRPWLSLKNPTQGYLRIHALKQWKLFNKQGWIN}LKVARLMIGH}TEINRQQLHWPTP}KFLDRMV}QLMSQEG}}IS}RM}WNQWIKRK}R}QHTFKEKGE}ETT}PRRWSHKEQ}ERKNKE}IREVI}}EH}H}IR}PKMQREAN}KEGLSQHLGCKLEGSCTLLKL}LGAFAKSLNSLDSQ}GAMKRKPNWQML}ER}}LIHKTQSFLSQSLGTTLSGMKIKILECSWR}LHISPEINPSGSETS}AWHP}CSQTKWQD}EKGTCSRVKE}SSEHKYQQKC}QALT}SISMNQQGRKLRK}GLF}}MAQHH}ALE}}WACSTC}VRFWESRY}ILDKRNTPGQHTGGMDSNPPTILPS}}MHQIMREYKQEWIDSTGPAS}WEST}AKRSPI}IRQGHLNSQAFFIAMDLWLILAWSCPVLECLE}MNQLI}VLE}Q}}RTT}}TMTLDLQQPRWPFNCSSKTTDTHIGAIEETHKFRREDHSS}RSCGIKPNQRQDY}YLMEDQTYTISGIFTFLRSA}NGS}WMRIIGEDFVIP}TPLSAIKRLIL}TMLW}CQPMVQPKAWNMMPLQLHTPGFPRGTALFSTQAKGEFLRMNRCTRSAATCSRNFSLVVHTGDRLEFLAWWRPWCLGPGLMPGLTSSLDGLRKKSSLRS}RSVPPLKNSDGKN----------
    
    >A/Wisconsin/10/98(H1N1)
    PB1:MDVNPTLLFLKVPAQNAISTTFPYTGDPPYSHGTGTGYTMDTVNRTHQYSEKGKWTTNTETGAPQLNPIDGPLPEDNEPSGYAQTDCVLEAMAFLEESHPGIFENSCLETMEVVQQTRVDKLTQGRQTYDWTLNRNQPAATALANTIEVFRSNGLTANESGRLIDFLKDVMESMDKEEIEITTHFQRKRRVRDNMTKKMVTQRTIGKKKQRVNKRGYLIRALTLNTMTKDAERGKLKRRAIATPGMQIRGFVYFVETLARSICEKLEQSGLPVGGNEKKAKLANVVRKMMTNSQDTELSFTITGDNTKWNENQNPRMFLAMITYITRNQPEWFRNILSMAPIMFSNKMARLGKGYMFESKRMKLRTQIPAEMLASIDLKYFNESTRKKIEKIRPLLIDGTASLSPGMMMGMFNMLSTVLGVSILNLGQKKYTRTTYWWDGLQSSDDFALIVNAPNHEGIQAGVDRFYRTCKLVGINMSKKKSYINKTGTFEFTSFFYRYGFVANFSMELPSFGVSGINESADMSIGVTVIKNNMINNDLGPATAQMALQLFIKDYRYTYRCHRGDTQIQTRRSFELKKLWDQTQSKAGLLVSDGGPNLYNIRNLHIPEVCLKWELMDEDYRGRLCNPLNPFVSHKEIDSVNNAVVMPAHGPAKSMEYDAVATTHSWIPKRNRSILNTSQRGILEDEQMYQKCCNLFEKFFPSSSYRRPVGISSMVEAMVSRARIDARIDFESGRIKKEEFSEIMKICSTIEELRRQK}---------
    PB1-F2:MEQEQDTPWTQSTEHTNIQKRGSGRQTQRLGHPSSTRLMDHYLRIMNQVDMHKQTVFWRPWLSLKNPTQGYLRIHALKQWKLFNKQGWIN}LKVARLMIGH}TEINRQQLHWPTP}KFLDRMV}QLMSQEG}}IS}RM}WNQWIKRK}R}QHTFKEKGE}ETT}PRRWSHKEQ}ERKNKE}IREVI}}EH}H}IR}PKMQREAN}KEGLSQHLGCKLEGSCTLLKL}LGAFAKSLNSLDSQ}GAMKRRPNWQML}ER}}LIHKTQSFLSQSLGTTLSGMKIKILECSWR}LHISPEINPSGSETS}AWHP}CFQTKWQD}EKGTCSRVKE}SSEHKYQQKC}QALT}SISMNQQGRKLRK}GLF}}MAQHH}ALE}}WACSTC}VRFWESRY}ILDKRNTPGQHTGGMGSNPPTILPS}}MHQIMREYKQEWIDSTGPAS}WEST}AKRSPI}IRQGHLNSQAFFIAMDLWLILAWSCPVLECLE}MNQLI}VLE}Q}}RTT}}TMTLDLQQPRWPFNCSSKTTDTHIGAIEETHKFRREDHSS}RSCGIKPNQRQDY}YLMEDQTYTISGIFTFLKSA}NGS}WMRIIGEDFVIP}IPLSAIKRLIL}TMLW}CQPMVQPKAWNMMPLQLHTPGFPRGTALFSTQAKGEFLRMNRCTRSAATCSRNFSLVVHTGDRLEFLAWWRPWCLGPGLMPGSTSSLDGLRKKSSLRS}RSVPPLKNSDGKN----------
    
    PB1-F2:
    MGQEQDTPWILSTGHISTQKREDGQQTPRLEHHNSTRLMDHCQKTMNQVVMPKQIVYWKQWLSLRSPTPVSLKTRVLKRWRLFSKHEWTS}
    MEQEQDTPWTQ}TEHTNTQKRESGRQTQRLVHPSSTRLMDHYLRIMNQVGMHKQTVF}RLWLSLKNPTQEYLRIHALKQWKLFNKQG}IN}
    MEQEQDTPWTQSTEHTNIQKKGSGRQTQRLGHPSSTRLMDHYLRIMNQVDMHKQTVFWRPWLSLKNPTQGYLRIHALKQWKLFNKQGWIN}
    MEQEQDTPWTQSTEHTNIQKRGSGRQTQRLGHPSSTRLMDHYLRIMNQVDMHKQTVFWRPWLSLKNPTQGYLRIHALKQWKLFNKQGWIN}
               x                                             x                             x  x
    32         43                 .                  .       89         100
    
    
    mex :MDVNPTLLFLKIPAQNAISTTFPYTGDPPYSHGTGTGYTMDTVNRTHQYSEKGKWTTNTETGAPQLNPIDGPLPEDNEPSGYAQTDCVLEAMAFLEESHPGIFENSCLETMEVVQQTRVDKLTQGRQTYDWTLNRNQPAATALANTIEVFRSNGLTANESGRLIDFLKDVMESMNKEEIEITTHFQRKRRVRDNMTKKMVTQRTIGKKKQRLNKRGYLIRALTLNTMTKDAERGKLKRRAIATPGMQIRGFVYFVETLARSICEKLEQSGLPVGGNEKKAKLANVVRKMMTNSQDTEISFTITGDNTKWNENQNPRMFLAMITYITRNQPEWFRNILSMAPIMFSNKMARLGKGYMFESKRMKIRTQIPAEMLASIDLKYFNESTKKKIEKIRPLLIDGTASLSPGMMMGMFNMLSTVLGVSILNLGQKKYTKTIYWWDGLQSSDDFALIVNAPNHEGIQAGVDRFYRTCKLVGINMSKKKSYINKTGTFEFTSFFYRYGFVANFSMELPSFGVSGVNESADMSIGVTVIKNNMINNDLGPATAQMALQLFIKDYRYTYRCHRGDTQIQTRRSFELKKLWDQTQSKVGLLVSDGGPNLYNIRNLHIPEVCLKWELMDDDYRGRLCNPLNPFVSHKEIDSVNNAVVMPAHGPAKSMEYDAVATTHSWIPKRNRSILNTSQRGILEDEQMYQKCCNLFEKFFPSSSYRRPVGISSMVEAMVSRARIDARVDFESGRIKKEEFSEIMKICSTIEELRRQK}
    wisc:MDVNPTLLFLKVPAQNAISTTFPYTGDPPYSHGTGTGYTMDTVNRTHQYSEKGKWTTNTETGAPQLNPIDGPLPEDNEPSGYAQTDCVLEAMAFLEESHPGIFENSCLETMEVVQQTRVDKLTQGRQTYDWTLNRNQPAATALANTIEVFRSNGLTANESGRLIDFLKDVMESMDKEEIEITTHFQRKRRVRDNMTKKMVTQRTIGKKKQRVNKRGYLIRALTLNTMTKDAERGKLKRRAIATPGMQIRGFVYFVETLARSICEKLEQSGLPVGGNEKKAKLANVVRKMMTNSQDTELSFTITGDNTKWNENQNPRMFLAMITYITRNQPEWFRNILSMAPIMFSNKMARLGKGYMFESKRMKLRTQIPAEMLASIDLKYFNESTRKKIEKIRPLLIDGTASLSPGMMMGMFNMLSTVLGVSILNLGQKKYTRTTYWWDGLQSSDDFALIVNAPNHEGIQAGVDRFYRTCKLVGINMSKKKSYINKTGTFEFTSFFYRYGFVANFSMELPSFGVSGINESADMSIGVTVIKNNMINNDLGPATAQMALQLFIKDYRYTYRCHRGDTQIQTRRSFELKKLWDQTQSKAGLLVSDGGPNLYNIRNLHIPEVCLKWELMDEDYRGRLCNPLNPFVSHKEIDSVNNAVVMPAHGPAKSMEYDAVATTHSWIPKRNRSILNTSQRGILEDEQMYQKCCNLFEKFFPSSSYRRPVGISSMVEAMVSRARIDARIDFESGRIKKEEFSEIMKICSTIEELRRQK}---------
                    x
    I'm interested in expert panflu damage estimates
    my current links: [url]http://bit.ly/hFI7H[/url] ILI-charts: [url]http://bit.ly/CcRgT[/url]

    Comment


    • #17
      Re: PB1 F2 a single mutation ( HK 97 and 1918) increase virulence

      Interpretation, please!

      .
      "The next major advancement in the health of American people will be determined by what the individual is willing to do for himself"-- John Knowles, Former President of the Rockefeller Foundation

      Comment


      • #18
        Re: PB1 F2 a single mutation ( HK 97 and 1918) increase virulence

        so, it's just 2 or 3 synonymous mutations which would generate
        a full-length PB1-F2 similar in amino-acids to the 1998
        ancestor viruses (birds-->humans(1968)-->swine(1995)-->humans(2009) )

        but during 1998-2009 these mutations were "lost" creating
        a non-functional PB1-F2, so I assume the nonfunctional version is
        better in swine and humans, or at least PB1-F2 has no advantage
        in humans and swine here.

        Else these two synonymous mutations could easily be done ?!?

        --------------

        ****** has 7 amino-acid differences to Wisconsin/10/98
        but these changes are synonymous in PB1, don't change PB1,
        so it's apparantly not PB1 that forced this evolution by selection


        create a seasonal H3N2 virus with defect PB1-F2
        and test it in the lab ! Has it disadvantages compared with
        the original virus ? Is it less virulent ?
        I'm interested in expert panflu damage estimates
        my current links: [url]http://bit.ly/hFI7H[/url] ILI-charts: [url]http://bit.ly/CcRgT[/url]

        Comment


        • #19
          Re: PB1 F2 a single mutation ( HK 97 and 1918) increase virulence

          a functional PB1-F2 may increase virulence in humans and swine
          but it doesn't seem to give the virus any advantage in spreading.
          At least not in this constellation of genes.

          Or it only gets these additional "features" in connection with
          another genetical background (e.g. H3N2(1968) or H1N1(1918) )


          The virus "deliberately" lost its PB1-F2 between 1998 and 2009
          and made no attempts so far to get it back
          I'm interested in expert panflu damage estimates
          my current links: [url]http://bit.ly/hFI7H[/url] ILI-charts: [url]http://bit.ly/CcRgT[/url]

          Comment

          Working...
          X