Announcement

**gsgs** · August 28, 2009, 01:15 AM

Re: New Study Finds Wild Pikas Are Natural Mammalian Hosts To H5N1 Avian Influenza Virus

wasn't it Dutch who went to Indo for cats ?

The Qinghai-lake sequences are explained without the pikas.
(else we would have been wondering about missing links,
as we are now with newflu)

The pikas got sequences from different strains and created
crazy reassortments and maybe a recombination, which were
not seen elsewhere.
So I assume the pika-viruses are not (or rarely) being transported to
other places.

**AlaskaDenise** · August 28, 2009, 01:15 AM

Re: New Study Finds Wild Pikas Are Natural Mammalian Hosts To H5N1 Avian Influenza Virus

Originally posted by gsgs View Post

...this is the first time it was
found in rodent-like animals in nature.

Pika is a rabbit-relative, not rodent.
(they even have a fluffy stubby tail hiding in their fur)

So we cannot apply conclusions from mice.

.

**gsgs** · August 28, 2009, 01:19 AM

Re: New Study Finds Wild Pikas Are Natural Mammalian Hosts To H5N1 Avian Influenza Virus

Originally posted by Dutchy View Post

Nigeria makes sense: H5N1 outbreak suspected to be related with imported live poultry (chicks) from China.

but no such poultry viruses were found in China.
Looks more like the pikas got it from Nigeria.

**AlaskaDenise** · August 28, 2009, 01:34 AM

Re: New Study Finds Wild Pikas Are Natural Mammalian Hosts To H5N1 Avian Influenza Virus

Originally posted by gsgs View Post

I think any flu (human,swine,avian) in Canadian mammals other
then humans,pigs,horses would be a "sensation"
and has being searched for unsuccessfully.
No bear ever found with flu, this is the first time it was
found in rodent-like animals in nature.

I can't speak for Canada, but I doubt many of the 112 mammal species have been tested for influenza here. I'd look at: lynx, coyotes, wolves, fox, mice/voles/shrews/pikas, hares, wolverines, martens, mink, & bears.

.

**AlaskaDenise** · August 28, 2009, 02:00 AM

Re: New Study Finds Wild Pikas Are Natural Mammalian Hosts To H5N1 Avian Influenza Virus

Since the Pika samples were taken in 2007, I looked at it's HA and the HA from miratory birds that went through nearby countries. The pikas had picked up genes from most of them. Looks like recombination again.

ABF84066 A/chicken/Afghanistan/1207/2006(H5N1)
ACU24756 A/chicken/Bangladesh/FDIL(J)32/2007(H5N1)
ACU24774 A/chicken/Bangladesh/394/2007(H5N1)
ACU24775 A/chicken/Bangladesh/376/2007(H5N1)
ACU24777 A/chicken/Bangladesh/363/2007(H5N1)
ACN39415 A/chicken/Hunan/1793/2007(H5N1)
ACN39419 A/chicken/Hubei/2856/2007(H5N1)
ACN39420 A/duck/Hubei/2911/2007(H5N1)
ACN39421 A/chicken/Hubei/3002/2007(H5N1)
ACO83271 A/plateau pika/Qinghai/04/2007(H5N1)
ACT31467 A/pika/Qinghai/BI/2007(H5N1)
ACT31500 A/pika/Qinghai/SHK/2007(H5N1)
ACT31478 A/pika/Qinghai/HMH/2007(H5N1)
ACT31496 A/pika/Qinghai/GRL/2007(H5N1)
ACT31511 A/pika/Qinghai/QW/2007(H5N1)
ACN37879 A/chicken/Manipur/NIV9743/2007(H5N1) - India
ACI87705 A/chicken/Astana/6/2005(H5N1) - Kazakhstan
ACJ24139 A/swan/Mangystau/3/2006(H5N1) - "
BAH03520 A/chicken/Hmawbi/517/2007(H5N1) - Myanmar
BAH03521 A/guinea fowl/North Okkalarpa/834/2007(H5N1) - Myanmar
BAH03522 A/quail/Mingalardone/866/2007(H5N1) - Myanmar

.

**gsgs** · August 28, 2009, 02:29 AM

Re: New Study Finds Wild Pikas Are Natural Mammalian Hosts To H5N1 Avian Influenza Virus

here are the difference for the plateau pika to some selected
viruses (close in some segment).
No mutation table this time, since there are too many differences
in some other segments.

differences in promille of nucleotides.
The typical acquisition of differences is 3 per year.
There is evidence that in China avian or swine flu
sometimes survives for years without mutating.
See this thread:

low mutation rates in flu-viruses - FluTrackers News and Information

http://www.flutrackers.com/forum/showthread.php?t=52214

Code:

  4 >A/PlateauPika/Qinghai/04/2007/04/19(H5N1)     
  1:  5, 14,  1,401,  5,468, 15,  0   A/Sw/Shandong/fNY/2003(H9N2)
  2:  6,  7,  7,399,  1,466,  4,  1   A/SilkyCk/Shantou/1818/2000(H9N2)
  3:  5,  5,  6,402,  1,460,  5,  0   A/Ck/Shantou/212/2000(H9N2)
  4:  0,  0,  0,  0,  0,  0,  0,  0   A/PlateauPika/Qinghai/04/2007/04/19(H5N1)
  5:  3,  3,  2,  4, 49,  4,  2,  0   A/Dk/Fujian/19/2000(H5N1)
  6: 10,  7, 47,  2, 14,  2, 21,  0   A/Ck/Hubei/wn/2003(H5N1)
  7:  8,  4,  3,  4,  1,  4,  4,  0   A/Sw/Shandong/2/2003(H5N1)
  8:  8, 30,  4,  4,  1,  2,  3,  7   A/Environment/Qinghai/1/2008/06/12(H5N1)
  9:  0,  0,  0,  4,  3,  9,  0,  0   A/Ck/China/1/2002(H5N1)
 10: 67, 67, 58, 10, 37, 12, 62,288   A/Gs/Guangdong/1/1996(H5N1)
 11: 61, 62, 55, 13, 39,  8, 66,284   A/Gs/Guangdong/3/1997(H5N1)
 12: 40, 63, 56,  4, 39,  6, 67,312   A/Dk/Zhejiang/11/2000(H5N1)
 14: 51, 48, 43,  3,  7, 17, 20, 19   A/Ck/Hubei/wf/2002(H5N1)
 15: 72, 55, 78,  6, 62, 22, 54, 61   A/Ck/Hubei/wh/1997(H5N1)

 10 >A/Gs/Guangdong/1/1996(H5N1)                   
  1: 63, 75, 67,400, 28,468, 85,306   A/Sw/Shandong/fNY/2003(H9N2)
  2: 60, 69, 60,398, 41,465, 64,293   A/SilkyCk/Shantou/1818/2000(H9N2)
  3: 62, 67, 58,400, 39,457, 65,294   A/Ck/Shantou/212/2000(H9N2)
  4: 67, 67, 58, 10, 37, 12, 62,288   A/PlateauPika/Qinghai/04/2007/04/19(H5N1)
  5: 61, 68, 59,  9, 23, 12, 65,313   A/Dk/Fujian/19/2000(H5N1)
  6: 59, 73, 68,  9, 34, 10, 71,291   A/Ck/Hubei/wn/2003(H5N1)
  7: 62, 68, 57, 11, 37, 12, 65,288   A/Sw/Shandong/2/2003(H5N1)
  8: 59, 63, 59, 11, 38, 10, 68,300   A/Environment/Qinghai/1/2008/06/12(H5N1)
  9:  0,  0,  0,  9, 39, 15,  0,  0   A/Ck/China/1/2002(H5N1)
 10:  0,  0,  0,  0,  0,  0,  0,  0   A/Gs/Guangdong/1/1996(H5N1)
 11: 16, 10, 16,  4,  3,  7, 10, 10   A/Gs/Guangdong/3/1997(H5N1)
 12: 34, 12, 24, 11,  4, 10,  6,  7   A/Dk/Zhejiang/11/2000(H5N1)
 14: 56, 59, 64, 10, 36, 21, 59,285   A/Ck/Hubei/wf/2002(H5N1)
 15: 73, 76, 83, 13, 67, 27, 41,286   A/Ck/Hubei/wh/1997(H5N1)

 15 >A/Ck/Hubei/wh/1997(H5N1)                      
  1: 72, 68, 97,402, 65,468, 70, 68   A/Sw/Shandong/fNY/2003(H9N2)
  2: 72, 56, 85,400, 62,469, 54, 64   A/SilkyCk/Shantou/1818/2000(H9N2)
  3: 70, 56, 80,403, 64,460, 55, 65   A/Ck/Shantou/212/2000(H9N2)
  4: 72, 55, 78,  6, 62, 22, 54, 61   A/PlateauPika/Qinghai/04/2007/04/19(H5N1)
  5: 68, 58, 80,  7, 72, 24, 51, 69   A/Dk/Fujian/19/2000(H5N1)
  6: 66, 60, 94,  4, 62, 22, 66, 63   A/Ck/Hubei/wn/2003(H5N1)
  7: 68, 58, 78,  6, 62, 24, 57, 61   A/Sw/Shandong/2/2003(H5N1)
  8: 67, 62, 80,  7, 63, 23, 57, 72   A/Environment/Qinghai/1/2008/06/12(H5N1)
  9:  0,  0,  0,  7, 65, 28,  0,  0   A/Ck/China/1/2002(H5N1)
 10: 73, 76, 83, 13, 67, 27, 41,286   A/Gs/Guangdong/1/1996(H5N1)
 11: 73, 72, 83, 15, 67, 22, 42,282   A/Gs/Guangdong/3/1997(H5N1)
 12: 59, 72, 84,  7, 66, 25, 38,300   A/Dk/Zhejiang/11/2000(H5N1)
 14: 69, 68, 81,  5, 63, 14, 57, 65   A/Ck/Hubei/wf/2002(H5N1)
 15:  0,  0,  0,  0,  0,  0,  0,  0   A/Ck/Hubei/wh/1997(H5N1)

So, a good match in all segments, the same reasortment-type, is A/Sw/Shandong/2/2003(H5N1)

A/Environment/Qinghai/1/2008/06/12(H5N1) is a good match in segments 1,3,4,5,6,7,8
but with another PB2.

------------edit-----------
/strain="A/environment/Qinghai/1/2008"
/isolation_source="fecal sample"
/country="China: Qinghai Lake"
/collection_date="12-Jun-2008"

hmm, did it come from the plateau-pikas or vice versa ?
I don't know how to see that from the sequences

**AlaskaDenise** · August 28, 2009, 02:41 AM

Re: New Study Finds Wild Pikas Are Natural Mammalian Hosts To H5N1 Avian Influenza Virus

Nothing closer in time preceeding the pika samples, than the 2003 Shandong Swine?

those differences are interesting. I also like to look at the genes that are the same, since I figure those represent the acquisition of "successful" polymorphisms - evolving into a "fit" pathogen.

I'd love to know how many years the pikas have been carrying influenza. Hopefully, the Chinese scientists are doing yearly tests.

.

**gsgs** · August 28, 2009, 03:07 AM

Re: New Study Finds Wild Pikas Are Natural Mammalian Hosts To H5N1 Avian Influenza Virus

apparantly they didn't find any other serotypes yet and H5N1 only "exists"
since 1997.
The plateau pika could have a virus which went to pikas in 2000.
Or existed in the environment since 2000.

**gsgs** · August 28, 2009, 03:45 AM

Re: New Study Finds Wild Pikas Are Natural Mammalian Hosts To H5N1 Avian Influenza Virus

OK, I just 13 related viruses, deleted some segments with many
differences, formed an index = average of those.

Here is the mutation table with all mutations, (and not only those
which occur at least twice as usual)

Code:

                                                  00000000000000000001111111112222222222222222222 0000000000000000000000111111111111111111111111112222222 00000000011111111111111112222 00000000000000000000000000000000000111111111111111111111111 0000000000000000000000000111111111111111111 00000000000000000000000000000000000000000000011111111111111 000000000000000000000000000000000000011 0000000000000000000000 
                                                  00000000122344467990112467890112222222222233333 0001111111223444556778000011111111122333556678880000022 01344447900111111123367990122 00000000011111222334555567788888999000111111233334566667777 0000133334456666688888889111333344445555555 00000000000000011112222333333344444555566668800011233344444 000001123344555567777777888899999999900 0011137777777778888888 
                                                  01125678202218956082442446502092237778888801222 0060244459554589493096006834477788923228473870444455989 33522387728000237721909084900 01112237856789018294455965704555288446445689001272204785678 5677856997753445801345791346013901180233346 01111123456779922561445012345955789237813492205519045903444 037781594604033491122669001911355556900 0502292457778891466666 
                                                  81371657658779548210033014455090184781346727345 3405923492896765396221250613703935211295885699050958405 36779569193019490311268509901 46785890355300978796201544026014225284031291423833493903632 1928040691459581716163138764522500656102616 43567908309487812542681580716925794162479737865649502939012 414768197427536315906072169558614893905 4322569791340624335678 
-codon-position-----------------------------------221      1       2    2         1   11 1 11112   1   12    111   2      1   1   1 1 12 2      1          1 1   22  2 222     11    12 112 11 122 2 121   221211121 122111112  211 1 2221 122 12                        112     1  2      2 2  11 1212212 2 1212222 222 2122 22  222222 2 2 12 12222122 12 1122211221  122 112  12  2 1     12  1  12 22     2    1 212 1 
---Index------------------------------------------GGTTAACAGGTCTCTACTGAATTTGGAGAGGGGGAGAAAAGATGAAA CGGTAATGAAGCCATCAAAAAGAAAAATACGAAGATCAATGCTTAGAATTCCGAA CATGCGGAGCAATAAAATGATAGGTCATC ACCACATCAAACACAACGTAAAAGCGAATGAGGCCAGCAAGCTATGATGCAGGTGAATT GATGTGAAACAAAGCTAACCAACTCAAATGCTACTCTTGACAT AATTCAAGTCAAGTTTCAAGGTGCCCTGGTCCAAGCACCCACAGGAGGTCAATGTAAAA ACTGACCCGAAGGCCAAATGAGACAGAAAGGGAAATGCG ACATAGAGAGGTTAATTATGAT 
   1 >A/Gs/Guangdong/1/1996(H5N1)                 ----------------------------------------------- ------------------------------------------------------- ----------------------------- -AT..........T.GT.C.G..AT..G.......G.A...T...AC..T.......-- ------------------------------------------- ..A.T....TGGA......AA.A....A................A.A.C..G.AC.... --------------------------------------- ----------------------      270    270 ,     32     32       1:>A/Gs/Guangdong/1/1996(H5N1)                 
   2 >A/Gs/Guangdong/3/1997(H5N1)                 ----------------------------------------------- ------------------------------------------------------- ----------------------------- -.TGT........T.GT.C.G..AT..G.........AG..TC..ACC.T.....C..- ------------------------------------------- -----....T..........A..T...A.C..G...........A.A.C..G...---- --------------------------------------- ----------------------      276    276 ,     30     30       2:>A/Gs/Guangdong/3/1997(H5N1)                 
   3 >A/Dk/Zhejiang/11/2000(H5N1)                 ----------------------------------------------- ------------------------------------------------------- ----------------------------- ------.....T.....A................T.A.......C..........---- ------------------------------------------- -------A...........-AC.....................A....CT.G...---- --------------------------------------- ----------------------      269    269 ,     12     12       3:>A/Dk/Zhejiang/11/2000(H5N1)                 
   4 >A/Ck/China/1/2002(H5N1)                     ----------------------------------------------- ------------------------------------------------------- ----------------------------- ---T-GC.................................................-AA T......................C..........C...A..GG -.GATTC............-.........................G.........GTCG --------------------------------------- ----------------------      220    220 ,     21     21       4:>A/Ck/China/1/2002(H5N1)                     
   5 >A/SilkyCk/Shantou/1818/2000(H9N2)           --------------------...AA.T.C.A............---- --.C..........CT.G.G..G..T.......T.C...C--------------- --------.TG...G.G..G..AACT--- ----------------------------------------------------A------ ....................G....------------------ ----------------------------------------------------------- -........................A.......GG.--- -....A............----      226    226 ,     30     30       5:>A/SilkyCk/Shantou/1818/2000(H9N2)           
   6 >A/Ck/Shantou/212/2000(H9N2)                 ----.........A......G....A.T...A...........---- --.............T.G....G............C......CC..C.CC..A.. T.C..AA....G....GCAG..A..T--- ----------------------------------------------------A------ ...........................C.T............. ----------------------------------------------------------- -.....TT.........................GG.--- -.................----      172    172 ,     33     33       6:>A/Ck/Shantou/212/2000(H9N2)                 
   7 >A/Dk/Fujian/19/2000(H5N1)                   ----............T....A.....................---- --..........A..........G................A..C...G.C....G .C..T.A......G......C.....--- ------..............G.G..........T.....G........A......---- ------------------------------------------- -------A.....CC....-...................T...............---- -.......A..............---------------- -.....----------------      136    136 ,     24     24       7:>A/Dk/Fujian/19/2000(H5N1)                   
   8 >A/PlateauPika/Qinghai/04/2007/04/19(H5N1)   CTACC....A....G...A................TT.G....CGGG ....G....................................T............. ...T...G.....G............... .........G......................A.......................C.. ........................................... .G......C..........-......................G................ ..........G............................ ......................       28     28 ,     27     27       8:>A/PlateauPika/Qinghai/04/2007/04/19(H5N1)   
   9 >A/Sw/Shandong/2/2003(H5N1)                  ..........C......C.G..C........................ .A..G...........T...GA..G..........CTGG................ ........A...C..G.....G....... ........G...G............T..C...........A.................. ......G..................G................. ...............C...-.............G................G........ .........G...T..G..........G........... ......................       33     33 ,     32     32       9:>A/Sw/Shandong/2/2003(H5N1)                  
  10 >A/Environment/Qinghai/1/2008/06/12(H5N1)    ----.GT.A..TG..G.................A......A.A.... ------------------------------------------------------- ........A...C..G.....G....TAT ------.......................AGA.....................CT---- ......G..................G................. -------............-..C...A................................ --..T.....G..........T.............C--- -................TATTG      117    117 ,     34     34      10:>A/Environment/Qinghai/1/2008/06/12(H5N1)    
  11 >A/Sw/Shandong/fNY/2003(H9N2)                -------G.........C...........A..C.G--T.TTG----- --------------------------.CGTAGG.G.........GA--------- -------......G.....---------- ----------------------------------------------------A------ --------------------------G..........A----- ----------------------------------------------------------- --AA-...A..CC.AT----------------------- -...............------      276    276 ,     29     29      11:>A/Sw/Shandong/fNY/2003(H9N2)                
  12 >A/Ck/Hubei/wn/2003(H5N1)                    .....GT.A..TG..G.................A......A.A.... G.AC.TATGTCT.T....T.......T.......................GT.G. ----------------------------- ............G.............................................. .GCAAA.GGTGGGATCGGAT.GT.........G.......A.. ...................-....................................... --------------------------------------- ......................      117    117 ,     48     48      12:>A/Ck/Hubei/wn/2003(H5N1)                    
  13 >A/Ck/Hubei/wh/1997(H5N1)                    ----------------------------------------------- ------------------------------------------------------- ----------------------------- G......T....G.G....G.C....T................C......G........ ------------------------------------------- ----------------------------------------------------------- --------------------------------------- ----------------------      303    303 ,      9      9      13:>A/Ck/Hubei/wh/1997(H5N1)                    
  14 >A/Ck/Hubei/wf/2002(H5N1)                    ----------------------------------------------- ------------------------------------------------------- ----------------------------- ---------.T.T......................................A....... ...A....................T...C.TCGT.TC..TG.. G.......C.......TGG.A..TTT.AA.TT..ATGTT.CT....AA...GC...... GT...T...........GCAC.GTC.C.GAAAG.G.ATA GTGCT.GAGAACCGGCC..A..      215    215 ,     75     75      14:>A/Ck/Hubei/wf/2002(H5N1)                    
  15 >Index                                       ............................................... ....................................................... ............................. ........................................................... ........................................... ........................................................... ....................................... ......................        0      0 ,      0      0      15:>Index

the Qinghai-lake environment sample from 2008
exactly matches the Ck/Hubei/wn from 2003 in PB2 !
Also close match in HA and NA.
While PA is very close to the swine in Shandong from 2003.

You have to wonder, how flu spreads in China in birds and swine !

--------edit-----------
better table:

Code:

                                            00000000000000000001111111112222222222222222222 0000000000000111111111111111111112222222 00000000011111111111111112222 0000000000000000000000000000000000011111111111111111111111 0000000000111111111111111111 00000000000000000000000000000111111111111 00000000000000000000 000000
                                            00000000122344467990112467890112222222222233333 0113444556778000011122333556678880000022 01344447900111111123367990122 0000000001111122233455556778888899900011111123333456667777 0038888889111333344445555555 00000000000000122223333446688001123344444 00012334455556788999 388888
                                            01125678202218956082442446502092237778888801222 0024589493096006838923228473870444455989 33522387728000237721909084900 0111223785678901829445596570455528844644568900127220885678 5761345791346013901180233346 11111234567799214450349781922051904903444 77859460403349609556 966666
                                            81371657658779548210033014455090184781346727345 4596765396221250615211295885699050958405 36779569193019490311268509901 4678589035530097879620154402601422528403129142383349014743 1806163138764522500656102616 35679083094878126815719797378654950939012 47619742753631065893 635678
-codon-position-----------------------------221      1       2    2         1   11 1 11112  1  11   2      1   1 12 2      1          1 1   22  2 222     11    12 112 11 122 2 121   221211121 122111112  211 1 2221 1 12 11       112     1  2      2 2  1 1212212 2 1212 22212   2 2 121222122 12 2221221  122 112112   212 1
---Index------------------------------------GGTTAACAGGTCTCTACTGAATTTGGAGAGGGGGAGAAAAGATGAAA GTACATCAAAAAGAAAAAGATCAATGCTTAGAATTCCGAA CATGCGGAGCAATAAAATGATAGGTCATC ACCACATCAAACACAACGTAAAAGCGAATGAGGCCAGCAAGCTATGATGCAGTGAATT GGACCAACTCAAATGCTACTCTTGACAT ATTCAAGTCAAGTTTGGTGCTGTAACAGGAGTCAAGTAAAA TGACCGAAGGCCAAGGAAAT GATGAT
   1 >A/Gs/Guangdong/1/1996(H5N1)           ----------------------------------------------- ---------------------------------------- ----------------------------- -AT..........T.GT.C.G..AT..G.......G.A...T...AC..T......-- ---------------------------- .A.T....TGGA...AA.A..A......A.AC..GAC.... -------------------- ------
   2 >A/Gs/Guangdong/3/1997(H5N1)           ----------------------------------------------- ---------------------------------------- ----------------------------- -.TGT........T.GT.C.G..AT..G.........AG..TC..ACC.T....C..- ---------------------------- ----....T.......A..T.ACG....A.AC..G..---- -------------------- ------
   3 >A/Dk/Zhejiang/11/2000(H5N1)           ----------------------------------------------- ---------------------------------------- ----------------------------- ------.....T.....A................T.A.......C.........---- ---------------------------- ------A........-AC.........A...CT.G..---- -------------------- ------
   4 >A/Ck/Hubei/wf/2002(H5N1)              ----------------------------------------------- ---------------------------------------- ----------------------------- ---------.T.T......................................A...... .A.......T...C.TCGT.TC..TG.. ----------------------------------------- -------------------- ------
   5 >A/Ck/Hubei/wh/1997(H5N1)              ----------------------------------------------- ---------------------------------------- ----------------------------- G......T....G.G....G.C....T................C......G....... ---------------------------- ----------------------------------------- -------------------- ------
   6 >A/Ck/Hubei/wn/2003(H5N1)              .....GT.A..TG..G.................A......A.A.... ----T....T.......T.................GT.G. ----------------------------- ............G............................................. ---AT.GT.........G.......A.. ...............-......................... -------------------- ......
   7 >A/Env/Qinghai/1/2008/06/12(H5N1)      ----.GT.A..TG..G.................A......A.A.... ---------------------------------------- ........A...C..G.....G....TAT ------.......................AGA......................---- ..G.......G................. ------.........-..C.A.................... ..T....G......T....C .TATTG
   8 >A/Sw/Shandong/2/2003(H5N1)            ..........C......C.G..C........................ A.G....T...GA..G....CTGG................ ........A...C..G.....G....... ........G...G............T..C...........A................. ..G.......G................. ..............C-........G........G....... ......G...T..G..G... ......
   9 >Index                                 ............................................... ........................................ ............................. .......................................................... ............................ ......................................... .................... ......
  10 >A/PPika/Qinghai/04/2007/04/19(H5N1)   CTACC....A....G...A................TT.G....CGGG ..G.......................T............. ...T...G.....G............... .........G......................A......................C.. ............................ G......C.......-..........G.............. .......G............ ......
  11 >A/Ck/Shantou/212/2000(H9N2)           ----.........A......G....A.T...A...........---- -.....T.G....G......C......CC..C.CC..A.. T.C..AA....G....GCAG..A..T--- ----------------------------------------------------AT---- ............C.T............. ----------------------------------------- ...TT............GG. ..----
  12 >A/SilkyCk/Shantou/1818/2000(H9N2)     --------------------...AA.T.C.A............---- -C...CT.G.G..G..T.T.C...C--------------- --------.TG...G.G..G..AACT--- ----------------------------------------------------AT---- .....G....------------------ ----------------------------------------- ...............A.GG. A.----
  13 >A/Ck/China/1/2002(H5N1)               ----------------------------------------------- ---------------------------------------- ----------------------------- ---T-GC................................................-AA T.......C..........C...A..GG .GATTC.........-.............G.......GTCG -------------------- ------
  14 >A/Dk/Fujian/19/2000(H5N1)             ----............T....A.....................---- -..A..........G..........A..C...G.C....G .C..T.A......G......C.....--- ------..............G.G..........T.....G........A.....---- ---------------------------- ------A.....CC.-.........T...........---- .....A.........----- .-----
  15 >A/Sw/Shandong/fNY/2003(H9N2)          -------G.........C...........A..C.G--T.TTG----- -------------------G.........GA--------- -------......G.....---------- ----------------------------------------------------AT---- -----------G..........A----- ----------------------------------------- AA-..A..CC.AT------- .-----

**gsgs** · August 28, 2009, 04:12 AM

Re: New Study Finds Wild Pikas Are Natural Mammalian Hosts To H5N1 Avian Influenza Virus

I assume plateau pika is from the big Qinghai high level "plateau", not from
Qinghai-lake area.

Plateau pika - Wikipedia

http://en.wikipedia.org/wiki/Plateau_Pika

There is permafrost, almost no travel since 2006

Qinghai–Tibet railway - Wikipedia

http://en.wikipedia.org/wiki/Qing-Zang_railway

Range Description:Ochotona curzoniae can be found throughout the Tibetan Plateau (Smith and Xie 2008). The geographic distribution extends through northern Nepal and Sikkim, India, north into Xizang, and the western regions of Sichuan, Qinghai and the southern regions of Xinjiang (Smith et al. 1990), and Gansu (CSIS 2008). It occurs at elevations of 3,000-5,000 m (Smith and Xie 2008).
Countries:Native:
China (Gansu, Qinghai, Sichuan, Tibet [or Xizang], Xinjiang); India (Sikkim); Nepal

The IUCN Red List of Threatened Species

http://www.iucnredlist.org/details/41258/0

Established in 1964, the IUCN Red List of Threatened Species has evolved to become the world’s most comprehensive information source on the global conservation status of animal, fungi and plant species.

**gsgs** · September 1, 2009, 01:33 AM

Re: New Study Finds Wild Pikas Are Natural Mammalian Hosts To H5N1 Avian Influenza Virus

there is a popular game called "pikachu".
I think people may get a disease in that game called
"pika-flu" and they can spread it to others.

The Pikachu Survivor Game - Week Three: Pandemic

http://www.smashboards.com/showthread.php?t=244284

OBJECTIVE Fevers, colds, chicken pox… those all came and went without a problem. However, when Pika Flu came along… let’s just say neither you nor your medicine cabinet were prepared… The city where you live was suddenly overcome by a mysterious sickness called Pika Flu, and when anyone...

Pikachu - Wikipedia

http://en.wikipedia.org/wiki/Pikachu

Collectible cards featuring Pikachu have appeared since the
initial Pokémon Trading Card Game released in October 1996,

An inability to discharge electricity, as occurs in the presence of a strong magnetic field,
causes an illness with flu-like symptoms

so, that pika-flu game was created before they found the H5N1 in pikas ?

**gsgs** · September 1, 2009, 01:54 AM

Re: New Study Finds Wild Pikas Are Natural Mammalian Hosts To H5N1 Avian Influenza Virus

full paper here:

404

http://www.asm.org/asm/images/Communications/pika.pdf

ASM is a nonprofit professional society that publishes scientific journals and advances microbiology through advocacy, global health and diversity in STEM programs.

they noticed that PA of the BI-virus is different, but didn't
notice the recombination ! (or kept it secret)

**gsgs** · September 1, 2009, 02:14 AM

Re: New Study Finds Wild Pikas Are Natural Mammalian Hosts To H5N1 Avian Influenza Virus

where is niman ?

isn't 1 week ban/suspension enough ? (for now)

**gsgs** · September 1, 2009, 02:51 AM

Re: New Study Finds Wild Pikas Are Natural Mammalian Hosts To H5N1 Avian Influenza Virus

so, how did the virus(-part) come from
Nigeria, 23.Jan.2007
to
Qinghai lake region, 02.Dec.2007

A/chicken/Nigeria/1071-1/2007,EMA1/EMA2-2:6-R07,Plateau,Jan 2
A/chicken/Nigeria/1071-3/2007,EMA2,Sokoto,Jan 5
A/chicken/Nigeria/1071-4/2007,EMA1/EMA2-2:6-R07,Borno,Jan 5
A/chicken/Nigeria/1071-5/2007,EMA1/EMA2-2:6–R07,Plateau,Jan 6
A/chicken/Nigeria/1071-7/2007,EMA2,Sokoto,Jan 10
A/chicken/Nigeria/1071-9/2007,EMA1/EMA2-2:6-R07,Bauchi,Jan 12
A/chicken/Nigeria/1071-10/2007,EMA1/EMA2-2:6-R07,Anambra,Jan 13
A/chicken/Nigeria/1071-15/2007,EMA1/EMA2-2:6-R07,Kaduna,Jan 23
A/chicken/Nigeria/1071-22/2007,EMA1/EMA2-2:6-R07,Kano,Jan 31
A/duck/Nigeria/1071-23/2007,EMA1/EMA2-2:6-R07,Borno,Feb 1
A/chicken/Nigeria/1071-29/2007,EMA1/EMA2-2:6-R07,Lagos,Feb 9
A/chicken/Nigeria/1071-30/2007,EMA1/EMA2-2:6-R07,Kaduna,Feb 10

Reassortant Avian Influenza Virus (H5N1) in Poultry, Nigeria, 2007

http://www.cdc.gov/eid/content/14/4/637.htm?s_cid=eid637_e

Reassortant Influenza (H5N1) in Poultry, Nigeria

**Roehl_JC** · September 1, 2009, 03:53 AM

Re: New Study Finds Wild Pikas Are Natural Mammalian Hosts To H5N1 Avian Influenza Virus

I for one wish Niman were back. He has a great insight into these genetic changes and stabilization of clades too.
Birds...Raptors must love feeding on pikas and on other birds, and perhaps vultures/griffins could be feeding on dead pika corpses too. The eagles and falcons would also feed on migrating wild birds that move across flyways into Africa, the Middle East, and on into Asia. That would increase the chances for evolutionary changes via recombination, and birds nesting above pika dens would give the recombinants ample opportunity to become endemic to pikas and other mammals, so the simplest thesis would be one of stabilization of each new recombinant as well as stablization of early genotypes via maximizing spread to numerous host reservoirs, birds AND mammals. If H5N1 continues to evolve at this rate, perhaps there are more reservoir species as yet undetermined where H5N1 has been able to sustain itself via subliminal low-pathogenic infections and wider prevalence of recombinant forms are out there but as yet haven't been sequenced because they may not harm those hosts, whether bird, mammal or human in their current low path phenotypic expression.
It may be that H5N1 recombinants that are non-symptomatic in ducks or geese or poultry may also be non-symptomatic after the initial waves of infection kill the most susceptible in a pika or other mammals, and eventually there are so many recombinants that one will achieve high pathogenic H2H spread. If that is a product of the high rate of change under the old theories of mutation and reassortment, or whether it is as a more likely consequence of conserved recombinational forms, it's only a matter of time til we wish we were pikas, naturally immune to this pathogen.

Announcement

New Study Finds Wild Pikas Are Natural Mammalian Hosts To H5N1 Avian Influenza Virus

Comment

Comment

Comment

Comment

Comment

Comment

Comment

Comment

Comment

Comment

Comment

Comment

Comment

Comment

Comment